Phenotypic Mutation 'nut'

• Allele: nut
• Mutation Type: splice donor site (5 bp from exon)
• Chromosome: 9
• Gene: Myo5a
• Gene Name: myosin VA
• Synonym(s): flail, Myo5, MVa, Dbv, 9630007J19Rik, MyoVA
• Chromosomal Location: 74,978,297-75,130,970 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008] ; PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Ref Sequences:
  Ensembl: ENSMUSP00000116028
• Gene Model: not available
• AlphaFold: Q99104
• PDB Structure: Structure of apo-calmodulin bound to unconventional myosin V [X-RAY DIFFRACTION] ; Crystal Structure of MyoVa-GTD [X-RAY DIFFRACTION] ; Crystal Structure of MyoVa-GTD in Complex with Two Cargos [X-RAY DIFFRACTION]
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably essential (E-score: 0.961)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• Last Updated: 2016-05-13 3:09 PM by Peter Jurek
• Record Created: unknown
• Record Posted: 2008-02-25
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Celine Eidenschenk, Bruce Beutler

Accession Number

NCBI RefSeq: NM_010864; MGI: 105976

Alleles Listed at MGI

All alleles(71) : Gene trapped(2) Spontaneous(52) Chemically induced(17) 

Repository

none

Phenotypic Description

Nut was identified as a visible phenotype among ENU-induced G3 mutant mice. Homozygous nut mice display a gray coat color and black eyes, as observed in concrete, new gray, and silver decerebrate mutants, as well as in the classical coat color mutant dilute (d) bearing a Myo5a mutation (1;2). Normal degranulation by natural killer (NK) cells from nut mice is observed after antibody stimulation of NKp46 or Ly49H receptors, after exposure to YAC-1 cells, or after PMA/ionomycin stimulation. No neurological defects are evident in homozygous nut mutants.

Nature of Mutation

The nut mutation corresponds to a G to A transition in the donor splice site of intron 9 (GTAAGT -> GTAAAT) of the Myo5a gene on Chromosome 9 (position 72979 in the Genbank genomic region NC_000075 for linear genomic DNA sequence of Myo5a). The mutation weakens the donor splice site, and results in skipping of exon 9 (out of 41 total exons) in a portion of the transcripts, as detected by sequencing of Myo5a from nut cDNA. Skipping of exon 9 destroys the reading frame of the encoded protein (aberrant amino acids after position 315), and creates a predicted premature stop codon that would truncate the protein after amino acid 325 (Figure 1).

       <--exon 8  <--exon 9 intron 9-->   exon 10-->
70322 ACTCTGCTGG……ACAATACCT GTAAGTTCA……………CCCAAGCACGAACCTCTTACCATCTTCTGTGA 75691
313   -T--L--L--……-T--I--P-               A--Q--A--R--T--S--Y--H--L--L--*  325
       correct     deleted                           aberrant

Figure 1. Domain structure of myosin Va.  The head domain contains the actin-binding and ATP-binding sites and generates force.  A central neck domain or light-chain binding domain contains six calmodulin binding IQ motifs.  The C-terminal half of myosin Va consists of the coiled coil (CC) segments responsible for myosin heavy chain dimerization and a globular tail domain (GTD) that mediates cargo binding.  The nut mutation results in skipping of exon 9, destroying the reading frame of the encoded protein (aberrant amino acids after position 315) and creating a predicted premature stop codon at amino acid 325 (red asterisk). This image is interactive. Click on the image to view other mutations found in Myo5a (red). Click on the mutations for more specific information.

Please see the record for new gray for information about Myo5a.

Putative Mechanism

The nut mutation results in the insertion of aberrant amino acids and premature truncation within the head region (aa 1-887) of myosin Va. However, a portion of transcripts is correctly spliced, suggesting that some wild type protein is produced in homozygous nut mutants. This conclusion is further supported by the lack of a neurological phenotype in nut mice. Null mutations of Myo5a cause both coat color and neurological phenotypes, because they affect both neuronal- and skin-specific isoforms of Myo5a (3-6), as does the nut mutation. However, in nut, sufficient functional myosin Va protein must exist to allow normal neurological function. Some work suggests that neuronal mechanisms exist to compensate for the partial loss of myosin Va function in the brain (7).

Primers

Primers cannot be located by automatic search.

Genotyping

Nut genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

Nut(F): 5’-GTGTGTGATGTGGCAGGACATAGAC-3’

Nut(R): 5’-CTGCCTGTGAACGTACTTATGGTTGAA-3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Nut_seq(F): 5’- CCACATTGCTAAACTGCCTAGTATG-3’

Nut_seq(R): 5’- AAGAGATCCAATGTCCTCTTCTGG-3’

 

The following sequence of 1460 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Myo5α) is amplified:

 

72640                                           g tgtgtgatgt ggcaggacat

72661 agaccagatt aggcacactg tacaacccac attgctaaac tgcctagtat gttactgtct

72721 caaagatgaa agtgttgtta tatgtgacta tgaatgtact atgcacatct ggcaatattc

72781 aagaattaat aatagactta aaattttctt ataattactt tgttgctatt ctgacatcaa

72841 ttgcttgttt actctattct attccaggaa ttagtgaatc ttaccaaatg ggaatttttc

72901 gaatacttgc tggcattctt cacttaggca atgttggatt tgcatctcgg gattcagaca

72961 gctgcacaat acctgtaagt tcagaacaag cttaatgcga tggtggcctg tgtattagtt

73021 ttgtttgttt gtttgtttgt ttgtttcttt tactactggg gctagaacaa gtagaacaag

73081 ctaggggtct ctgcacatgc taggcaatca ctgtatttgt aacatgccac catgttagtc

73141 tttttgaaca tgattttggg gggcaaattc aggtctactt tatctactga gccatctccc

73201 tagatctaca gtagatttaa ttgcttcatt tatttgttta tttattattt tatttattct

73261 gtgtttgtac acatgtataa gcacacaggt acacaaagct gtatgtgtac agaggccaga

73321 agaggacatt ggatctctta gagctagagg ttcaggcagt agcttattac atgggtgcag

73381 gaacgcaaac tccagtcctg atattttgtg gcaagtactt ttcactgctg acctatctat

73441 tcaaccctgt tatttttact tgtgtgtttg tgtgtgtgtg tgtgtatgtg agtgctggca

73501 tgtatgtgcc acacatgtgg aatccaaagt acaacatttg ggagtcagtt ctcctcttcc

73561 accccattga ggcaggtctc tcttgttgct acctgctcat ggtattctag accgggaacc

73621 tttggccagt tctcctgcct tggctttcca tttcattgtg gagtactgac tgggattaga

73681 gatgattgcc atcatgccca gctttttacc tgtgtcctgg agattgaacg taggtcatca

73741 ggcttgtgtg gcttcaagct cttttgccca cttacccatc tctctggcct agtagttttt

73801 aaagatgaaa atgatggctc tgatttaaac ctctaatttc ttttaagaaa ataatcacac

73861 acacccccac ccactctttt ttcaaaatag agtcttgtct gtggcccagg ccggcctcaa

73921 acttgtgaca atctgggatt acaggagtgc ataatcacac ctagcaccag ttttttgttt

73981 tcgttttgtt ttgttttgtt tccaaaagca tattttattg agatataatt tagcaacacc

74041 aatatatggc tgtgattatg ctcatagata tgttcaacca taagtacgtt cacaggcag

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is shown in red text.

References

   1.  Russell, E. S. (1949) A quantitative histological study of the pigment found in the coat-color mutants of the house mouse. IV. The nature of the effects of genic substitution in five major allelic series, Genetics 34, 146-166.

   2.  Markert, C. L. and Silvers, W. K. (1956) The Effects of Genotype and Cell Environment on Melanoblast Differentiation in the House Mouse, Genetics 41, 429-450.

   3.  Searle, A. G. (1952) A lethal allele of dilute in the house mouse, Heredity 6, 395-401.

   4.  Russell, L. B. (1971) Definition of functional units in a small chromosomal segment of the mouse and its use in interpreting the nature of radiation-induced mutations, Mutat. Res. 11, 107-123.

   5.  Moore, K. J., Seperack, P. K., Strobel, M. C., Swing, D. A., Copeland, N. G., and Jenkins, N. A. (1988) Dilute suppressor dsu acts semidominantly to suppress the coat color phenotype of a deletion mutation, dl20J, of the murine dilute locus, Proc. Natl. Acad. Sci. U. S. A 85, 8131-8135.

   6.  Strobel, M. C., Seperack, P. K., Copeland, N. G., and Jenkins, N. A. (1990) Molecular analysis of two mouse dilute locus deletion mutations: spontaneous dilute lethal20J and radiation-induced dilute prenatal lethal Aa2 alleles, Mol. Cell Biol. 10, 501-509.

   7.  Huang, J. D., Cope, M. J., Mermall, V., Strobel, M. C., Kendrick-Jones, J., Russell, L. B., Mooseker, M. S., Copeland, N. G., and Jenkins, N. A. (1998) Molecular genetic dissection of mouse unconventional myosin-VA: head region mutations, Genetics 148, 1951-1961.