Phenotypic Mutation 'almond_joy' (pdf version)
List |< first << previous [record 13 of 511] next >> last >|
Allelealmond_joy
Mutation Type missense
Chromosome5
Coordinate17,813,088 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Cd36
Gene Name CD36 antigen
Synonym(s) fatty acid translocase, FAT, Scarb3
Chromosomal Location 17,781,690-17,888,959 bp (-)
MGI Phenotype Homozygous mutant mice exhibit an immunodeficiency phenotype, are susceptible to S. aureus infection and develop ocular pterygium. Mice homozygous for disruptions in this gene display abnormal lipid homeostasis which affects energy utilization in the heart.
Accession Number

NCBI RefSeq: NM_001159558 (variant 1), NM_007643 (variant 2), NM_001159555 (variant 3), NM_001159557 (variant 4), NM_00159556 (variant 5); MGI: 107889

Mapped Yes 
Amino Acid Change Aspartic acid changed to Valine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000080974] [ENSMUSP00000126300] [ENSMUSP00000131832] [ENSMUSP00000133008] [ENSMUSP00000143061]
SMART Domains Protein: ENSMUSP00000080974
Gene: ENSMUSG00000002944
AA Change: D209V

DomainStartEndE-ValueType
Pfam:CD36 14 463 2.5e-151 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000082367)
SMART Domains Protein: ENSMUSP00000126300
Gene: ENSMUSG00000002944
AA Change: D209V

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000165232)
SMART Domains Protein: ENSMUSP00000131832
Gene: ENSMUSG00000002944
AA Change: D209V

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000169095)
SMART Domains Protein: ENSMUSP00000133008
Gene: ENSMUSG00000002944
AA Change: D209V

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000170051)
SMART Domains Protein: ENSMUSP00000143061
Gene: ENSMUSG00000002944
AA Change: D209V

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000197890)
Phenotypic Category fasting hyperglycemia
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(11) : Chemically induced (ENU)(1) Gene trapped(2) Radiation induced(1) Spontaneous(1) Targeted(5) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Cd36 APN 5 17787702 missense possibly damaging 0.92
IGL01355:Cd36 APN 5 17813074 missense possibly damaging 0.79
IGL02140:Cd36 APN 5 17828768 splice site 0.00
IGL02385:Cd36 APN 5 17814719 missense possibly damaging 0.82
IGL02626:Cd36 APN 5 17797128 nonsense probably null 0.00
IGL02645:Cd36 APN 5 17785880 missense possibly damaging 0.66
IGL03149:Cd36 APN 5 17820565 missense probably benign 0.12
oblivious UTSW 5 17874966 nonsense
E0370:Cd36 UTSW 5 17785749 nonsense probably null
F5770:Cd36 UTSW 5 17820528 frame shift probably null
R0266:Cd36 UTSW 5 17798252 missense probably benign 0.09
R1102:Cd36 UTSW 5 17814213 missense possibly damaging 0.79
R1120:Cd36 UTSW 5 17785828 missense possibly damaging 0.67
R1170:Cd36 UTSW 5 17813088 missense probably damaging 1.00
R1551:Cd36 UTSW 5 17797122 missense probably benign 0.00
R1621:Cd36 UTSW 5 17796991 splice donor site probably benign
R1852:Cd36 UTSW 5 17811236 splice acceptor site probably benign
R1918:Cd36 UTSW 5 17797036 nonsense probably null
R4090:Cd36 UTSW 5 17785720 unclassified probably null
R4197:Cd36 UTSW 5 17813088 missense probably damaging 1.00
R5602:Cd36 UTSW 5 17814792 missense possibly damaging 0.94
R5647:Cd36 UTSW 5 17814765 missense probably damaging 1.00
R5867:Cd36 UTSW 5 17785735 missense probably benign 0.05
V7580:Cd36 UTSW 5 17820528 frame shift probably null
X0020:Cd36 UTSW 5 17797188 splice acceptor site probably benign
Z1088:Cd36 UTSW 5 17795575 unclassified probably null
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 07/27/2017 2:29 PM by Bruce Beutler
Record Created 05/31/2016 8:59 PM
Record Posted 11/15/2016
Phenotypic Description

Figure 1. Almond_joy mice exhibit fasting hyperglycemia. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The almond_joy phenotype was identified among G3 mice of the pedigree R4197, some of which fasting hyperglycemia (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the fasting hyperglycemia using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 37mutations (X-axis) identified in the G1 male of pedigree R4197. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. The hyperglycemia phenotype was linked to a mutation in Cd36: an A to T transversion at base pair 17,813,088 (v38) on chromosome 5, or base pair 75,872 in the GenBank genomic region NC_000071 encoding Cd36. Linkage was found with a recessive model of inheritance, wherein three variant homozygotes departed phenotypically from 24 homozygous reference mice and 32 heterozygous mice (Figure 2; P = 2.232 x 10-5).

 

The mutation corresponds to residue 1,089 in the NM_021879 mRNA sequence in exon 7 of 15 total exons. 


 

75856 TACAATGACACTGTAGATGGAGTTTATAAAGTT

204   -Y--N--D--T--V--D--G--V--Y--K--V-

 

Genomic numbering corresponds to NC_000071. The mutated nucleotide is indicated in red.  The mutation results in an aspartic acid (D) to valine (V) substitution at position 209 (D209V) in the CD36 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 3. Domain structure of CD36. The almond_joy mutation creates an aspartic acid (D) to valine (V) substitution at position 209 (D209V). The positions of cysteines are indicated (C); those in the extracellular domain are labeled C1-C6. Predicted N-linked glycosylation sites are noted with yellow circles. TM, transmembrane domain. This image is interactive; click to view additional mutations in Cd36.

CD36 has two transmembrane domains (amino acids 7-28 and 439-460) located at the two termini of the protein, with the ends of the protein (amino acids 1-6 and 461-472) facing inside the cell (Figure 3) (1-3). A 412-amino acid extracellular loop connects the two transmembrane domains, and is predicted to contain ten N-linked glycosylation sites (3;4). In bovine CD36, six conserved cysteines (designated C1 to C6) in the extracellular domain form disulfide bonds with each other in a 1-3, 2-6, 4-5 arrangement (5). Additionally, two cysteines close to the membrane in each of the cytoplasmic domains may be palmitoylated (6). A putative protein kinase C (PKC) phosphorylation site exists at threonine 92 (in the extracellular domain), and is thought to differentially regulate adhesion to collagen or thrombospondin depending on phosphorylation status (7).

 

CD36 has several alternative transcripts in which at least six alternative first exons and promoters may be utilized (8;9), in which 5’- and 3’-untranslated exons are alternatively spliced (10;11), or in which middle exons may be skipped (12). Alternative splicing of the first exon is differentially regulated in different tissues (8), but exactly how any of the alternative transcripts are regulated is unknown.

 

The almond_joy mutation results in an aspartic acid (D) to valine (V) substitution at position 209 (D209V) within the extracellular loop.

 

For more information about Cd36, please see the record for oblivious.

Putative Mechanism

CD36 (originally called glycoprotein IV) was identified more than 30 years ago as the fourth major glycoprotein of the carbohydrate-rich outer coat of platelets (13). Since then, study has revealed its diverse range of functions and binding partners. These include cell adhesion (via thrombospondin and collagen), fatty acid and lipid transport (by binding long-chain fatty acids and oxidized LDL), clearance of apoptotic cells and antigen presentation.

 

Transgenic overexpression of CD36 in mice reduces blood triglycerides and fatty acids, leading to defective fatty acid and glucose metabolism (14), while mice with a targeted deletion of Cd36 have increased levels of cholesterol, fatty acids and triacylglycerol (15). Cd36-/- adipocytes have a decreased ability to transport LCFA (15). CD36 is also a receptor for oxidatively modified LDL (oxLDL) (16), a finding supported by the impaired ability of Cd36-/- peritoneal macrophages to bind and take up oxLDL (15). LDL contributes to the development of atherosclerotic lesions, and Cd36 deficiency protects against these lesions (15).

 

Several human diseases are associated with mutations in CD36 (OMIM 173510, #608404). Interestingly, mutations in CD36 have been found to both protect against (17) and increase susceptibility (18) to malaria. Prader-Willi syndrome (PWS), characterized by an insatiable hunger that results in life-threatening obesity, is correlated with reduced CD36 expression (19). The mechanism by which CD36 contributes to PWS is unknown, but may involve impaired lipid and glucose homeostasis. Finally, similar to Cd36-/- mice, humans with CD36 deficiency also have insulin resistance, hypertriglyceridemia, increased serum LDL cholesterol, and decreased capacity for fatty acid uptake (20;21).

 

The almond_joy phenotype is similar to that observed in Cd36-/- mice and some humans with PWS, indicating loss of CD36almond_joy function.

Primers PCR Primer
almond_joy(F):5'- ATGGTGGCATGAAGAGCTTC -3'
almond_joy(R):5'- GGAAGGTACCTATAGCCATGG -3'

Sequencing Primer
almond_joy_seq(F):5'- GGTCAGCACTTGTGCATTAAAAG -3'
almond_joy_seq(R):5'- ACCTATAGCCATGGTTACTTATTCTC -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
List |< first << previous [record 13 of 511] next >> last >|