Allele | wenzhou | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 6 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 71,350,856 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | A ⇒ T (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Cd8a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | CD8 subunit alpha | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Lyt-2, Ly-B, Ly-35, Ly-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 71,350,411-71,356,155 bp (+) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen acts as a coreceptor with the T-cell receptor on the T lymphocyte to recognize antigens displayed by an antigen presenting cell in the context of class I MHC molecules. The coreceptor functions as either a homodimer composed of two alpha chains or as a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 alpha chain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011] PHENOTYPE: Animals homozygous for a mutation in this gene lack CD8+CD4- cytotoxic T cells in the thymus and spleen and do not mount a cytotoxic response to alloantigens. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_001081110.2 (variant 1), NM_009857.1 (variant 2); MGI: 88346 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Limits of the Critical Region | 71373427 - 71379171 bp | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Aspartic acid changed to Valine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000068123] [ENSMUSP00000131873] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P01731 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PDB Structure |
MURINE CD8AA ECTODOMAIN FRAGMENT IN COMPLEX WITH H-2KB/VSV8 [X-RAY DIFFRACTION]
The Crystal Structure of a TL/CD8aa Complex at 2.1A resolution:Implications for Memory T cell Generation, Co-receptor Preference and Affinity [X-RAY DIFFRACTION] CD8alpha-alpha in complex with YTS 105.18 Fab [X-RAY DIFFRACTION] Crystal structure of a CD8ab heterodimer [X-RAY DIFFRACTION] Crystal structure of CD8alpha-beta in complex with YTS 156.7 FAB [X-RAY DIFFRACTION] Crystal structure of the CD8 alpha beta/H-2Dd complex [X-RAY DIFFRACTION] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000068123 Gene: ENSMUSG00000053977 AA Change: D107V
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000131873 Gene: ENSMUSG00000053977 AA Change: D107V
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.8322 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Probably nonessential (E-score: 0.089) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All mutations/alleles(18) : Chemically induced (ENU)(1) Spontaneous(1) Targeted(13) Transgenic(3) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2016-09-22 10:20 AM by Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2016-06-16 8:12 PM by Xue Zhong | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2016-09-22 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The wenzhou phenotype was identified among G3 mice of the pedigree R4541, some of which showed an increase in the CD4+ to CD8+ T cell ratio (Figure 1) caused by reduced frequencies of CD8+ T cells (Figure 2), CD8+ T cells in CD3+ T cells (Figure 3), effector memory CD8+ T cells in CD8+ T cells (Figure 4), and naïve CD8+ T cells in CD8+ T cells (Figure 5). |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 48 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Cd8a: an A to T transversion at base pair 71,373,872 (v38) on chromosome 6, or base pair 446 in the GenBank genomic region NC_000072 encoding Cd8a. The strongest association was found with a recessive model of linkage to the normalized frequency of CD8+ T cells in CD3+ T cells, wherein three variant homozygotes departed phenotypically from five homozygous reference mice and 11 heterozygous mice with a P value of 2.17 x 10-13 (Figure 6). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. The mutation affects nucleotide 446 of Cd8a mRNA variants 1 (NM_001081110.2) and 2 (NM_009857.1) within exon 1 of 5 total exons and exon 1 of 4 total exons, respectively:
The mutated nucleotide is indicated in red. The mutation results in an aspartic acid (D) to valine (V) substitution at position 107 (D107V) of both variants of the CD8 antigen, α chain (CD8α) and is strongly predicted by PolyPhen-2 to be benign (score = 0.022). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
The CD8α chain (also known as Lyt-2) is a 34-37 kDa single pass type I transmembrane glycoprotein of the immunoglobulin (Ig) superfamily. The CD8αβ heterodimer functions as a coreceptor for the T cell receptor (TCR) [reviewed in (1)]. In contrast, the function of CD8αα is unknown; it has been speculated to function as a TCR corepressor that negatively regulates cellular activation (2). Both CD8 isoforms bind to MHC class I molecules with equivalent affinity (3;4). The 247-amino acid mouse CD8α chain consists of an N-terminal hydrophobic signal sequence (amino acids (aa) 1-27), an extracellular Ig-like domain (aa 28-139) followed by a hinge or stalk region containing three O-linked glycosylation sites (aa 140-196), a transmembrane segment (aa 197-217), and a cytoplasmic tail (aa 218-247) [Figure 7; reviewed in (5)]. In mouse CD8α, cysteines 53 and 129 form an intramolecular disulfide bond that is characteristic of an Ig fold. Disulfide linkage with the CD8β protein is mediated by cysteines 178 and 193. The extracellular Ig-like domain of both CD8 dimers contact the α3 domain of the MHCI heavy chain, whereas CD8αα additionally contacts the α2 domain and β2-microglobulin. Three complementarity-determining regions (CDRs), consisting of the BC loop (CDR1), the C’C” loop (CDR2), and the FG loop (CDR3), are involved in binding to the α3 domain of pMHCI, and in the case of CD8αα also to β2m. Connecting the Ig-like domain to the transmembrane domain, the stalk region of CD8α contains numerous threonine, serine, and proline residues and is heavily O-glycosylated (6-8). The cytoplasmic domain of CD8α binds to the Src family kinase Lck (see iconoclast) (9;10). Two cysteines in the CD8α cytoplasmic domain (C227 and C229 in mouse) are necessary for this interaction (11;12). The wenzhou mutation lies within the extracellular Ig-like domain of CD8α, in the region between the CDR2 and CDR3 regions. For more information about Cd8a, please see the record for alfalfa. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | T cells become activated when the TCR engages a peptide antigen in complex with an MHC molecule on the surface of a target or antigen-presenting cell. TCR signaling is necessary for both adaptive immune responses and for thymocyte differentiation. The major function of CD8αβ is to recruit the kinase Lck to the TCR-MHC interaction site where it can phosphorylate immunoreceptor tyrosine-based activation motifs (ITAMs) on the cytoplasmic tails of associated CD3 proteins (see tumormouse, a mutation of Cd3e, and allia, a mutation of Cd247) (13;14). Their phosphorylation recruits and activates other proteins including ZAP-70 (ζ-chain-associated protein of 70 kDa; see murdock), SLP-76 (SH2 domain-containing leukocyte protein of 76 kDa), and LAT (linker for activation of T cells) necessary for signaling leading to T cell activation, proliferation, and differentiation. CD8α serves as a Lck docking site (9;10) through a ‘zinc clasp’ structure that tethers Lck to the CD8α cytoplasmic tail (15). Mice deficient in CD8α and/or CD8β displayed diminished or absent CD8+ T cells in the periphery, although thymocyte differentiation to the DP stage was intact. Consequently, cytotoxic responses against alloantigens and viral antigens were reduced in T cells from these mice. The CDRs are involved in binding to the α3 domain of pMHCI. It is likely that the wenzhou mutation impairs the binding of CD8αβ to pMHC1, leading to diminished numbers and frequencies of CD8 T cells in the blood as a result of defective positive selection. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer wenzhou_pcr_F: AAAATGGACGCCGAACTTGG wenzhou_pcr_R: GAGGGAATCTGCGTGAAACTTG Sequencing Primer wenzhou_seq_F: CGCCGAACTTGGTCAGAAG wenzhou_seq_R: GAAACTTGTTCAGATGTGACCCC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation. PCR Primers R45410014_PCR_F: 5’- AAAATGGACGCCGAACTTGG-3’ R45410014_PCR_R: 5’- GAGGGAATCTGCGTGAAACTTG-3’ Sequencing Primers R45410014_SEQ_F: 5’- CGCCGAACTTGGTCAGAAG-3’ R45410014_SEQ_R: 5’- GAAACTTGTTCAGATGTGACCCC-3’ PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40X 6) 72°C 10:00 7) 4°C hold The following sequence of 400 nucleotides is amplified (NCBI RefSeq: NC_000072, chromosome 6. Chr6:71373670-71374069): aaaatggacg ccgaacttgg tcagaaggtg gacctggtat gtgaagtgtt ggggtccgtt tcgcaaggat gctcttggct cttccagaac tccagctcca aactccccca gcccaccttc gttgtctata tggcttcatc ccacaacaag ataacgtggg acgagaagct gaattcgtcg aaactgtttt ctgccatgag ggacacgaat aataagtacg ttctcaccct gaacaagttc agcaaggaaa acgaaggcta ctatttctgc tcagtcatca gcaactcggt gatgtacttc agttctgtcg tgccagtcct tcagaaaggt ttggaagtgg aggttcccgt ctcctgggtt ttaggggtca catctgaaca agtttcacgc agattccctc Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = A>T) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Katherine Timer | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Ming Zeng, Xue Zhong, Bruce Beutler |