Phenotypic Mutation 'abra2' (pdf version)
List |< first << previous [record 6 of 511] next >> last >|
Alleleabra2
Mutation Type splice donor site
Chromosome2
Coordinate126,920,313 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Sppl2a
Gene Name signal peptide peptidase like 2A
Synonym(s) C130089K23Rik, 2010106G01Rik
Chromosomal Location 126,890,391-126,933,235 bp (-)
MGI Phenotype Mice homozygous for a knock-out allele exhibit decreased immunoglobulin prior to and after immunization and decreased splenic B cells, myeloid dendritic cells, T2 B cells and follicular B cells. Mice homozygous for a hypomorphic allele exhibit similar albeit less severe phenotypes.
Accession Number

NCBI RefSeq: NM_023220; MGI:1913802

Mapped Yes 
Limits of the Critical Region 126890391 - 126933235 bp
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted sequence gene model
SMART Domains Protein: ENSMUSP00000028844
Gene: ENSMUSG00000027366

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:PA 58 153 1.7e-12 PFAM
transmembrane domain 173 195 N/A INTRINSIC
PSN 218 486 3.65e-102 SMART
Predicted Effect probably null
Phenotypic Category T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(14) : Chemically induced (ENU)(2) Chemically induced (other)(1) Gene trapped(6) Radiation induced(1) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Sppl2a APN 2 126919720 missense probably benign 0.34
IGL01471:Sppl2a APN 2 126917867 nonsense probably null 0.00
IGL01572:Sppl2a APN 2 126920312 splice donor site probably benign 0.00
IGL01712:Sppl2a APN 2 126904903 splice donor site probably benign 0.00
IGL02203:Sppl2a APN 2 126904941 missense possibly damaging 0.66
IGL02572:Sppl2a APN 2 126926296 missense probably benign 0.04
abra UTSW 2 126923594 missense probably benign 0.00
R0023:Sppl2a UTSW 2 126913293 splice donor site probably null
R0240:Sppl2a UTSW 2 126920336 missense probably benign 0.14
R0240:Sppl2a UTSW 2 126920336 missense probably benign 0.14
R0458:Sppl2a UTSW 2 126904959 missense probably damaging 1.00
R0627:Sppl2a UTSW 2 126920417 splice acceptor site probably benign
R0732:Sppl2a UTSW 2 126917299 splice acceptor site probably benign
R0799:Sppl2a UTSW 2 126920307 splice donor site probably benign
R1029:Sppl2a UTSW 2 126923594 missense probably benign 0.00
R1245:Sppl2a UTSW 2 126913521 splice donor site probably benign
R1579:Sppl2a UTSW 2 126917204 splice donor site probably benign
R1669:Sppl2a UTSW 2 126917794 splice donor site probably benign
R2047:Sppl2a UTSW 2 126926852 missense probably damaging 1.00
R2215:Sppl2a UTSW 2 126927834 missense probably benign 0.00
R2428:Sppl2a UTSW 2 126912695 missense possibly damaging 0.93
R3522:Sppl2a UTSW 2 126920322 missense possibly damaging 0.66
R4653:Sppl2a UTSW 2 126920313 missense probably null
R4747:Sppl2a UTSW 2 126923538 missense noncoding transcript
R5398:Sppl2a UTSW 2 126919718 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 10/28/2016 2:15 PM by Anne Murray
Record Created 06/23/2016 10:42 PM by Jin Huk Choi
Record Posted 10/28/2016
Phenotypic Description
Figure 1. Homozygous abra2 mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Homozygous abra2 mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Homozygous abra2 mice exhibit diminished T-independent IgM responses to recombinant NP-Ficoll. IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The abra2 phenotype was identified among G3 mice of the pedigree R4653, some of which showed diminished T-dependent antibody response to ovalbumin administered with aluminum hydroxide (Figure 1) and to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 2) were diminished. The T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) was also diminished (Figure 3). 

Nature of Mutation

Figure 4. Linkage mapping of the reduced antibody response to rSFV-β-gal using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 62 mutations (X-axis) identified in the G1 male of pedigree R4653.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in three genes on chromosome 2: Ext2, Ryr3, and Sppl2a. The Sppl2a mutation is presumed causative, because the immune phenotypes observed in abra2 mimic those listed on MGI and another Sppl2a mutant identified in a second pedigree (see abra). The Sppl2a mutation is a G to A transition at base pair 126,920,313 (v38) on chromosome 2, or base pair 12,950 in the GenBank genomic region NC_000068 encoding the Sppl2a gene. The strongest association was found with a recessive model of linkage to the normalized antibody response to rSFV-β-gal (P = 7.067 x 10-15), wherein four variant homozygotes departed phenotypically from four homozygous reference mice and four heterozygous mice (Figure 4).  

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in the use of a cryptic site in intron 7. Use of the cryptic splice site would result in a 54-base pair insertion in intron 7, leading to a frame-shifted protein product beginning after amino acid 281, and termination after the inclusion of 9 aberrant amino acids.


 

C57BL/6J:

             <--exon 6        <--exon 7 intron 7-->     exon 8-->

    ……TTCTACAGGTGGCTTG ……TGTGGACAGTGCAC gtacgtatctgtt…… GATTTTGTGTTGTGG……

244 ……-F--Y--R--W--L-- ……-C--G--Q--C--T                 --I--L--C--C--G…

 

Genomic numbering corresponds to NC_000068. The donor splice site of intron 7, which is destroyed by the abra2 mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction
Figure 5. Domain organization of mouse SPPL2A. The location of the abra2 mutation and the YD, GXGD, and PAL motifs are indicated. Abbreviations: SP, signal peptide; PA, protease-associated domain; TM, transmembrane domains. The orientation of the N- (lumenal) and C- (cytoplasmic) termini are indicated. The image is interactive; click to view other mutations in SPPL2A.

Sppl2a encodes SPPL2a, a signal peptide peptidase-like (SPPL) protease, and member of the GxGD intramembrane-cleaving protease family of aspartyl intramembrane-cleaving proteases (I-CLiPs) (Figure 5). SPPL proteins share a YD motif (amino acids 354-355), a GXGD motif (amino acids 413-416), and a PAL sequence (amino acids 466-468) (1-4). SPPL2A has nine transmembrane domains. The abra2 mutation is within intron 7.

 

For more information about Sppl2a, please see the record for abra.

Putative Mechanism

GxGD proteases are essential for the regulated intramembrane proteolysis (RIP) of single span type II transmembrane proteins. SPPL2A cleaves TNF-α (see the record for PanR1; (5)), ITM2B (Bri2) (6), Fas ligand (FasL; see the record for riogrande) (7), CD74 (8-13), TMEM106B (14), and neuregulin 1 type III (15).

 

Sppl2a knockout (Sppl2a-/-) mice have a developmental block during the splenic phase of B cell maturation. As a result, the frequency of mature and functionally competent B cells is reduced, and the mice exhibit impaired humoral immune responses (8). Abra2 mice exhibited defects in the T-independent B cell response to NP-Ficoll as well as T-dependent antibody responses to rSFV-β-gal and OVA-alum. Taken together, the abra2 mutation results in loss of SPPL2A function.  

Primers PCR Primer
abra2(F):5'- TCAGGAATTCAGTGTAAAGATCCC -3'
abra2(R):5'- AGACTCTTGGTTGCGCCTTAG -3'

Sequencing Primer
abra2_seq(F):5'- CCTTTAAGTCCTAGCACTGAGGTAG -3'
abra2_seq(R):5'- TGCGCCTTAGCAACTGC -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsJin Huk Choi, James Butler, Bruce Beutler
List |< first << previous [record 6 of 511] next >> last >|