Phenotypic Mutation 'Porch'

• Allele: Porch
• Mutation Type: nonsense
• Chromosome: 14
• Coordinate: 51,188,380 bp (GRCm39)
• Base Change: C ⇒ T (forward strand)
• Gene: Pnp
• Gene Name: purine-nucleoside phosphorylase
• Synonym(s): Np, Np-2, Pnp1, Np-1, Pnp
• Chromosomal Location: 51,181,760-51,190,869 bp (+) (GRCm39)
• MGI Phenotype: PHENOTYPE: Nullizygous mice show impaired thymocyte differentiation, T cell function and mitochondrial DNA repair, altered lymphocyte subpopulations and metabolism, and enhanced thymocyte apoptosis and sensitivity to gamma-irradiation. ENU-induced mutants show a gradual decline in T cell number and function. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 50944302 - 50953412 bp
• Amino Acid Change: Arginine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000043926] [ENSMUSP00000136557] [ENSMUSP00000154805]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000043926; Gene: ENSMUSG00000115338; AA Change: R185*

Domain	Start	End	E-Value	Type
Pfam:PNP_UDP_1	26	280	5.2e-56	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000136557; Gene: ENSMUSG00000115338; AA Change: R185*

Domain	Start	End	E-Value	Type
Pfam:PNP_UDP_1	26	280	2e-54	PFAM

• Predicted Effect: probably null
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Probably nonessential (E-score: 0.114)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:42 PM by Anne Murray
• Record Created: 2016-06-23 11:02 PM by Jin Huk Choi
• Record Posted: 2018-07-18
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, James Butler, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_013632; MGI:97365

Alleles Listed at MGI

All Mutations and Alleles(20) : Chemically induced (ENU)(6) Chemically induced (other)(1) Gene trapped(11) Targeted(2)

Phenotypic Description

Figure 1. Homozygous porch mice exhibit diminished T-dependent IgG responses to OVA + alum. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Porch phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4639, some of which showed a diminished T-dependent antibody response to ovalbumin administered with aluminum hydroxide (OVA/alum) (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced T-dependent antibody response to OVA + alum using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 38 mutations (X-axis) identified in the G1 male of pedigree R4639. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 38 mutations. The T-dependent antibody response to OVA/alum phenotype was linked to four mutations on chromosome 14: Eaf1, Pnp, Sacs, and Ppp2r2a. The mutation in Pnp was presumed causative, and a second Pnp allele in the R5078 pedigree confirmed that mutations in Pnp lead to immune phenotypes (see the record for porch2). The mutation in Pnp is a C to T transition at base pair 50,950,923 (v38) on chromosome 14, or base pair 6,621 in the GenBank genomic region NC_000080 encoding Pnp. Linkage was found with a recessive model of inheritance, wherein 1 variant homozygote departed phenotypically from seven homozygous reference mice and 10 heterozygous mice with a P value of 9.276 x 10^-5 (Figure 2).  

The mutation corresponds to residue 833 in the mRNA sequence NM_013632 within exon 5 of 6 total exons.

818 CAAATGGGGGAGCAACGAAAGCTACAAGAAGGC 180 -Q--M--G--E--Q--R--K--L--Q--E--G-

The mutated nucleotide is indicated in red. The mutation results in substitution of arginine 185 for a premature stop codon (R185*) in the PNP protein.

Protein Prediction

Figure 3. Domain organization of PNP. PNP has no defined domains. The locations of the structural elements of PNP are shown. The location of the Porch mutation is indicated. Other mutations found in PNP are noted in red. Click on each mutation for more information.

Figure 4. Crystal structure of a human PNP monomer. Figure generated by UCSF Chimera and is based on PDB: 3D1V.

Pnp encodes purine nucleoside phosphorylase (PNP). PNP has no defined domains (Figure 3). The crystal structure of human PNP has been solved [Figure 4; PDB:3D1V; (1)]. PNP is a homotrimer, and each PNP monomer displays an α-/β-fold consisting of a mixed β-sheet surrounded by α-helices. PNP has an eight-stranded mixed β-sheet and a five-stranded mixed β-sheet, which join to form a distorted β-barrel. Seven α-helices surround the β-sheet structure. Tyr88, Phe141, Phe159, Phe200, and Leu209 are involved in subunit interaction. Amino acids 241 to 260 act as a gate that opens during substrate binding and controls access to the active site. Gate opening occurs upon a helical transformation of residues 257 to 265.

The Porch mutation results in substitution of arginine 185 for a premature stop codon (R185*) in the PNP protein (Figure 3). Amino acid 185 precedes the seventh strand of the β-sheet.

Expression/Localization

PNP is ubiquitously expressed.

Background

Figure 5. The two biochemical pathways (salvage and de novo) involved in deoxycytidine metabolism converge at the level of dCDP. In the salvage pathway deoxycytidine (dC) is continuously converted to dCMP by dCK. Upstream of dCK, cellular and extracellular dC pools are in equilibrium via the nucleoside transporters (ENTs). Downstream of dCK, the dCMP pool is in equilibrium with the dCDP pool. The de novo pathway contributes to the dCDP pool by RNR-mediated reduction of CDP. ENT, equilibrative nucleoside transporters; NT, 5′ nucleotidase; dCDP, deoxycytidine diphosphate; CDP, cytidine diphosphate; RNR, ribonucleotide reductase. See the text for more details. Figure is modeled after Figure 1 in Ref. 3.

Purine and pyrimidine nucleotides are synthesized through both de novo and deoxyribonucleoside salvage pathways (Figure 5) (2). The de novo pathway facilitates the synthesis of purine and pyrimidine ribonucleotides from carboyhydrate and amino acid derivatives. The de novo pathway produces ribonucleoside diphosphates (NDPs), which are reduced by the enzyme ribonucleotide reductase to deoxyribonucleotide diphosphates (dNDPs) and converted to deoxyribonucleotidetriphosphates (dNTPs) [reviewed in (3)]. In the salvage pathway, nucleosides are transported through the plasma and mitochondrial membranes by nucleoside transporters and phosphorylated by cytosolic (dCK [see the record for rosa] and TK1) or mitochondrial (deoxyguanosine kinase (dGK) and TK2) dNKs, respectively. The dNK family members control the rate-limiting phosphorylation of deoxynucleoside and catalyze the production of deoxynucleotide 5'-monophosphate from a deoxynucleoside, using ATP and yielding ADP in the process. The salvage and de novo pathways converge at the level of dCDP.

PNP is an enzyme that functions in purine degradation and salvage. PNP catalyzes the reversible phosphorolysis of inosine, guanosine, deoxyinosine, and deoxyguanosine (dGuo) to their respective bases and ribose-1-phosphate sugar. Control of the levels of PNP substrates (and their phosphorylated products) is essential for cell signaling, energy production, and DNA formation; accumulation of dGuo is toxic to lymphocytes (4;5). PNP inhibitors (e.g., immucillin-H and DADMe–immucillin-H) have been used to treat T-cell cancers and several autoimmune diseases, including rheumatoid arthritis, psoriasis, multiple sclerosis, gout, and tissue transplant rejection (6).

Mutations in PNP are linked to immunodeficiency due to purine nucleoside phosphorylase deficiency (OMIM: #613179; (7-9)). Patients with immunodeficiency due to purine nucleoside phosphorylase deficiency exhibit reduced T cell function and some patients exhibit neurologic impairments such as spastic paresis. Patients can exhibit variable B-cell dysfuction. Patients with PNP deficiency have increased risk of autoimmune disorders, including hemolytic anemia, neutropenia, thyroiditis, and thrombocytopenia (10). Patients have normal serum immunoglobulin levels, but T-dependent antibody production is reduced [reviewed in (11)].

Mice homozygous for an ENU-induced mutant Pnp allele (Pnp^bata/bata) exhibit reduced numbers of marginal zone B cells with concomitant increased numbers of T follicular helper cells (MGI). Proliferation of IL-17-stimulated bone marrow-derived B cells was diminished (MGI). Mice homozygous for other ENU-induced mutant Pnp alleles (Pnp^e/e, Pnp^f/f, and Pnp^g/g) exhibited thymus hypoplasia, reduced numbers of double-positive T cells and CD8+ T cells in the spleen with concomitant increased numbers of double-negative T cells (12). The Pnp^e/e, Pnp^f/f, and Pnp^g/g mice also had impaired spleen leukocyte responses to conA and IL-12 (12). The Pnp^e/e and Pnp^f/f mice also showed increased amounts of inosine and some guanosine excreted in the urine compared to wild-type controls (13). Pnp-deficient mice exhibited increased thymocyte apoptosis as well as increased double-negative T cell numbers and pre-B cells with concomitant reduced numbers of double-positive T cells, CD4+ T cells, and CD8+ T cells (4). The Pnp-deficient mice had high concentrations of purine nucleosides (inosine, deoxyinosine, guanosine, and deoxyguanosine) in the urine and deficient mitochondrial DNA repair (4).

Putative Mechanism

Figure 6. Mechanism of T cell inhibition by inhibition of PNP. Abbreviations: DR-1-P, deoxyribose-1-phosphate; G, guanosine; dG, 2'-deoxyguanosine; dGMP, 2'-deoxyguanosine monophosphate; dGDP, 2'-deoxyguanosine 5'-diphosphate; dGTP, deoxyguanosine 5'-triphosphate; dNTP, deoxynucleoside triphosphate; PNP, purine nucleoside phosphorylase.

Aberrant PNP activation results in the accumulation of dGTP, an imbalance of the deoxynucleoside triphosphate (dNTP) pools, and induces cell apoptosis (Figure 6). The phenotype of the Porch indicates loss of PNP^Porch function.

Primers

PCR Primer
Porch_pcr_F: TCTACATGCAGAGAGTCTGGC
Porch_pcr_R: AACAGTGCTGAGCTCAAGC

Sequencing Primer
Porch_seq_F: AGAGAGTCTGGCCTTGTCCAG
Porch_seq_R: TGAGCTCAAGCCTGTGGTCTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 421 nucleotides is amplified (chromosome 14, + strand):

1   tctacatgca gagagtctgg ccttgtccag gagttgggaa agaaagttca cttggtgcca
61  tttatctgag ataatcccac ctgtgttcca ggtttggagt tcgttttcct gccatgtctg
121 atgcttatga ccgggatatg aggcagaagg ctttcagtgc ctggaaacaa atgggggagc
181 aacgaaagct acaagaaggc acctacgtga tgttggcagg ccccaacttt gagactgtgg
241 cagagagtcg tctgctaaag atgctggggg cagatgctgt tggtgagaag ggggatttgg
301 ctggtggttt gaggaaagga tctggtaaaa tagcaaaggg gagagagaac ttatggattt
361 gggggaggat gacatagaat actaggaaag cagagaccac aggcttgagc tcagcactgt
421 t

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. de Azevedo, W. F.,Jr, Canduri, F., dos Santos, D. M., Silva, R. G., de Oliveira, J. S., de Carvalho, L. P., Basso, L. A., Mendes, M. A., Palma, M. S., and Santos, D. S. (2003) Crystal Structure of Human Purine Nucleoside Phosphorylase at 2.3A Resolution. Biochem Biophys Res Commun. 308, 545-552.

  2. Reichard, P. (1988) Interactions between Deoxyribonucleotide and DNA Synthesis. Annu Rev Biochem. 57, 349-374.

  3. Staub, M., and Eriksson, S. (2006) The Role of Deoxycitidine Kinase in DNA Synthesis and Nucleoside Analog Activation, in Cancer Drug Discovery and Development: Deoxynucleoside Analogs in Cancer Therapy (G. J. Peters, Ed.) pp 29, Humana Press Inc., Totowa, N.J.

  4. Arpaia, E., Benveniste, P., Di Cristofano, A., Gu, Y., Dalal, I., Kelly, S., Hershfield, M., Pandolfi, P. P., Roifman, C. M., and Cohen, A. (2000) Mitochondrial Basis for Immune Deficiency. Evidence from Purine Nucleoside Phosphorylase-Deficient Mice. J Exp Med. 191, 2197-2208.

  5. Cohen, A., Gudas, L. J., Ammann, A. J., Staal, G. E., and Martin, D. W.,Jr. (1978) Deoxyguanosine Triphosphate as a Possible Toxic Metabolite in the Immunodeficiency Associated with Purine Nucleoside Phosphorylase Deficiency. J Clin Invest. 61, 1405-1409.

  6. Ho, M. C., Shi, W., Rinaldo-Matthis, A., Tyler, P. C., Evans, G. B., Clinch, K., Almo, S. C., and Schramm, V. L. (2010) Four Generations of Transition-State Analogues for Human Purine Nucleoside Phosphorylase. Proc Natl Acad Sci U S A. 107, 4805-4812.

  7. Williams, S. R., Gekeler, V., McIvor, R. S., and Martin, D. W.,Jr. (1987) A Human Purine Nucleoside Phosphorylase Deficiency Caused by a Single Base Change. J Biol Chem. 262, 2332-2338.

  8. Aust, M. R., Andrews, L. G., Barrett, M. J., Norby-Slycord, C. J., and Markert, M. L. (1992) Molecular Analysis of Mutations in a Patient with Purine Nucleoside Phosphorylase Deficiency. Am J Hum Genet. 51, 763-772.

  9. Dalal, I., Grunebaum, E., Cohen, A., and Roifman, C. M. (2001) Two Novel Mutations in a Purine Nucleoside Phosphorylase (PNP)-Deficient Patient. Clin Genet. 59, 430-437.

  10. Notarangelo, L. D. (2009) Primary Immunodeficiencies (PIDs) Presenting with Cytopenias. Hematology Am Soc Hematol Educ Program. , 139-143.

  11. Somech, R., Lev, A., Simon, A. J., Hanna, S., and Etzioni, A. (2012) T- and B-Cell Defects in a Novel Purine Nucleoside Phosphorylase Mutation. J Allergy Clin Immunol. 130, 539-542.

  12. Snyder, F. F., Jenuth, J. P., Mably, E. R., and Mangat, R. K. (1997) Point Mutations at the Purine Nucleoside Phosphorylase Locus Impair Thymocyte Differentiation in the Mouse. Proc Natl Acad Sci U S A. 94, 2522-2527.

  13. Mably, E. R., Fung, E., and Snyder, F. F. (1989) Genetic Deficiency of Purine Nucleoside Phosphorylase in the Mouse. Characterization of Partially and Severely Enzyme Deficient Mutants. Genome. 32, 1026-1032.