Phenotypic Mutation 'curveball' (pdf version)
List |< first << previous [record 100 of 511] next >> last >|
Allelecurveball
Mutation Type missense
Chromosome10
Coordinate79,724,786 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Hcn2
Gene Name hyperpolarization-activated, cyclic nucleotide-gated K+ 2
Synonym(s) HAC1, trls
Chromosomal Location 79,716,634-79,736,108 bp (+)
MGI Phenotype Mice homozygous for a null allele exhibit decreased body weight, absence seizures, and behavioral/neurological abnormalities.
Accession Number

NCBI RefSeq: NM_008226; MGI:1298210

Mapped Yes 
Amino Acid Change Isoleucine changed to Asparagine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000020581] [ENSMUSP00000097113]
PDB Structure
HCN2J 443-645 in the presence of cGMP [X-RAY DIFFRACTION]
HCN2I 443-640 in the presence of cAMP, selenomethionine derivative [X-RAY DIFFRACTION]
HCN2J 443-645 in the presence of cAMP, selenomethionine derivative [X-RAY DIFFRACTION]
Structure and rearrangements in the carboxy-terminal region of SpIH channels [X-RAY DIFFRACTION]
HCN2-I 443-460 E502K in the presence of cAMP [X-RAY DIFFRACTION]
X-ray structure of cysteine-free fragment of mHCN2 C-terminal region from amino acids 443-630 including C508N, C584S, and C601S mutations [X-RAY DIFFRACTION]
HCN2I 443-640 apo-state [X-RAY DIFFRACTION]
Trip8b-1a#206-567 interacting with the carboxy-terminal seven residues of HCN2 [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000020581
Gene: ENSMUSG00000020331
AA Change: I317N

DomainStartEndE-ValueType
low complexity region 4 47 N/A INTRINSIC
low complexity region 106 128 N/A INTRINSIC
Pfam:Ion_trans_N 140 183 5e-23 PFAM
Pfam:Ion_trans 184 447 3.3e-24 PFAM
low complexity region 448 459 N/A INTRINSIC
Blast:cNMP 460 492 9e-13 BLAST
cNMP 517 630 4.79e-22 SMART
low complexity region 727 765 N/A INTRINSIC
low complexity region 778 800 N/A INTRINSIC
low complexity region 804 838 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
(Using ENSMUST00000020581)
SMART Domains Protein: ENSMUSP00000097113
Gene: ENSMUSG00000020331
AA Change: I317N

DomainStartEndE-ValueType
low complexity region 4 47 N/A INTRINSIC
low complexity region 106 128 N/A INTRINSIC
Pfam:Ion_trans_N 139 215 2.6e-47 PFAM
Pfam:Ion_trans 219 435 1.5e-20 PFAM
low complexity region 448 459 N/A INTRINSIC
Blast:cNMP 460 492 9e-13 BLAST
cNMP 517 630 4.79e-22 SMART
low complexity region 727 765 N/A INTRINSIC
low complexity region 778 800 N/A INTRINSIC
low complexity region 804 838 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
(Using ENSMUST00000099513)
Phenotypic Category behavior/neurological, decrease in body weight, decrease in CD8+ T cells in CD3+ T cells, increase in CD4:CD8, increase in CD4+ T cells in CD3+ T cells
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(9) : Chemically induced (other)(1) Spontaneous(3) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Hcn2 APN 10 79733803 nonsense probably null
IGL01339:Hcn2 APN 10 79729068 missense probably damaging 1.00
IGL02183:Hcn2 APN 10 79724813 unclassified probably null
R0269:Hcn2 UTSW 10 79734241 splice site noncoding transcript
R0671:Hcn2 UTSW 10 79734232 splice donor site probably null
R1879:Hcn2 UTSW 10 79726189 missense probably benign 0.03
R1913:Hcn2 UTSW 10 79730943 missense probably benign 0.14
R4051:Hcn2 UTSW 10 79733687 missense possibly damaging 0.47
R4052:Hcn2 UTSW 10 79733687 missense possibly damaging 0.47
R4328:Hcn2 UTSW 10 79724611 missense probably damaging 1.00
R4507:Hcn2 UTSW 10 79724786 missense probably damaging 1.00
R4518:Hcn2 UTSW 10 79724702 missense probably benign 0.17
R4578:Hcn2 UTSW 10 79724448 synonymous probably null
R5334:Hcn2 UTSW 10 79726291 missense probably damaging 0.99
R5788:Hcn2 UTSW 10 79717111 missense possibly damaging 0.48
R6131:Hcn2 UTSW 10 79733908 missense probably damaging 1.00
X0021:Hcn2 UTSW 10 79729123 splice donor site probably benign
X0024:Hcn2 UTSW 10 79734120 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 05/25/2017 5:12 PM by Katherine Timer
Record Created 07/07/2016 1:06 PM by Jamie Russell
Record Posted 01/11/2017
Phenotypic Description

Figure 1. Curveball mice exhibit ataxia.

Figure 2. Curveball mice exhibit reduced body weights. Scaled body weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Curveball mice exhibit increased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Scaled data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Curveball mice exhibit increased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Curveball mice exhibit reduced frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The curveball phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R4507, some of which showed ataxia (Figure 1) and reduced body weights compared to wild-type littermates (Figure 2). Some mice also showed an increase in the CD4 to CD8 T cell ratio (Figure 3) caused by an increase in the frequency of CD4+ T cells in CD3+ T cells (Figure 4) with a concomitant decrease in the frequency of CD8+ T cells in CD3+ T cells (Figure 5), all in the peripheral blood.

Nature of Mutation

Figure 6. Linkage mapping of the ataxia phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 39 mutations (X-axis) identified in the G1 male of pedigree R4507. Phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 39 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Hcn2:  a T to A transversion at base pair 79,724,786 (v38) on chromosome 10, or base pair 8,153 in the GenBank genomic region NC_000076 encoding Hcn2. The strongest association was found with a recessive model of linkage to the ataxia phenotype, wherein eight variant homozygotes departed phenotypically from 11 homozygous reference mice and 19 heterozygous mice with a P value of 4.513 x 10-8 (Figure 6).  A substantial semidominant effect was observed with the ataxia phenotype but the mutation is preponderantly recessive.

 

The mutation corresponds to residue 985 in the mRNA sequence NM_178666 within exon 2 of 8 total exons.

 

969 CGGCTATCACGGCTCATCCGATATATCCACCAG

312 -R--L--S--R--L--I--R--Y--I--H--Q-

 

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine (I) to asparagine (N) substitution at position 317 (I317N) in the HCN2 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.998).

Protein Prediction
Figure 7. Domain organization and topology of mouse HCN2. HCN2 has six transmembrane domains and cytoplasmic N- and C-termini. The ion-conducting pore region is between transmembrane domains 5 and 6. The HCN2 C-terminus has two domains: a C-linker domain and the cyclic nucleotide-binding domain (CNBD). The curveball mutation results in an isoleucine (I) to asparagine (N) substitution at position 317 (I317N).

Hcn2 encodes hyperpolarization-activated cyclic nucleotide-gated (HCN) channel 2 (HCN2). The HCN channels (i.e., HCN1, HCN2, HCN3, and HCN4) are members of the voltage-gated potassium ion channel superfamily present mainly in neurons and heart cells (1). The HCN channels are complexes of four HCN subunits arranged around a central pore; the HCN proteins can form homomeric or heteromeric channels with other members of the HCN family (2-4). The HCN proteins share 80 to 90% sequence identity between transmembrane domain 1 and to the end of the cyclic nucleotide-binding domain (CNBD). Most differences between the HCN proteins are within the N- and C-termini.

 

HCN2 has six transmembrane domains and cytoplasmic N- and C-termini. Transmembrane domain 4 is a positively charged voltage sensor. The ion-conducting pore region is between transmembrane domains 5 and 6. The HCN2 C-terminus has two domains: a C-linker domain composed of six α-helices separated by short loops and the CNBD. The C-linker domain connects the CNBD to the transmembrane domains.  The CNBD mediates modulation by cyclic nucleotides (5). Cyclic adenosine monophosphate (cAMP) is the physiological agonist of HCN2 (6;7), but 3′,5′-Cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic cytidine monophosphate (cCMP) also bind to the CNBD and regulate the channel (6; 8-10)).  The CNBD has four α-helices (A, P, B, C) with a β-roll (eight anti-parallel β-strands) between the A- and B-helices (9). The β-roll comprises eight β-strands in a jelly-roll-like topology. Cyclic nucleotides are bound inside the jelly-roll and interact with the β-roll and the C-helix. cAMP shifts the voltage activation range of HCN2 in the positive direction  (7;11;12). Binding of cyclic nucleotides to the CNBD of HCN2 results in conformational changes that stabilize its open state  (5;7;12). The cyclic nucleotides bind HCN2 between the β-roll and the C-helix (6). Upon cAMP binding, the C-helix moves in toward the β-roll (9;10;13).The conformation of the CNBD after cAMP, cGMP, and cCMP binding are similar, but the equilibrium between conformations varies between the ligands, and ligand specificity differs from the intact channel.

 

HCN2 associates with several proteins to regulate its function. HCN2 is trafficked to dendrites through binding to the chaperone TRIP8b (tetratricopeptide repeat (TPR)-containing Rab8b interacting protein) (12;14-16). Reduced TRIP8b expression resulted in reduced HCN surface expression and disruption of the normal gradient of HCN subunits in CA1 pyramidal neurons (17). HCN2 forms a complex with the scaffold proteins tamalin, S-SCAM, and Mint2 (18). Assembly with the scaffold proteins promotes the correct distribution, trafficking, and clustering of ion channels. Tamalin interacts with the PDZ-binding motif (S/XS/ANL/M in the HCN proteins; SRLSSNL in HCN2) and the C-terminal tail of HCN2. S-SCAM binds at the CNBD and the sequence downstream of the CNBD in the C-terminal tail of HCN2. The sequence downstream of the HCN2 CNBD interacts with Mint2.

 

Several residues in HCN2 have specific functions. HCN2 is N-linked glycosylated at Asn380. N-linked glycosylation of the HCN channels is required for trafficking to the plasma membrane and for its stability (19). All four subunits of the tetrameric HCN2 channel do not have to be glycosylated for HCN2 channels to insert into cell membranes. His321 is a major determinant of pH sensitivity (20). His321 is at the boundary between transmembrane domain 4 and the cytoplasmic loop between transmembrane 4 and 5. Mutation of His321 to arginine, glutamine, or glutamate causes loss in intracellular pH sensitivity. Mutation of His321 does not alter cAMP-mediated modulation of the HCN2 channel. Lys291, Arg294, Arg297, and Arg300 contribute to the voltage dependence of gating, but are not required for trafficking or folding (21). Lys303 and Ser306 are required for gating, but are not required for trafficking or folding. Arg312 is required for folding, but not gating. Arg309, Arg315, and Arg318 are required for HCN2 folding and trafficking.

 

The curveball mutation results in an isoleucine (I) to asparagine (N) substitution at position 317 (I317N) within the cytoplasmic loop between transmembrane domains 4 and 5. Residue 317 is within the proximity of Arg315 and Arg318, which are required for HCN2 folding and trafficking.

Expression/Localization

HCN2 is ubiquitously expressed throughout the central nervous system, with highest expression in the thalamus and brain stem nuclei [(1;22-24); reviewed in (25)]. HCN2 is predominantly localized mainly in pyramidal cell dendrites. HCN2 is also found at lower concentrations in the somata of pyramidal neurons as well as other neuron subtypes [reviewed in (25)]. HCN2 is also expressed in the heart (26-28).

Background
Figure 8. cAMP and cGMP signaling pathways. cAMP is produced by adenylyl cyclase ( AC ) stimulated by G protein-coupled receptors ( GPCRs ) coupled to stimulatory G protein ( Gs ). cAMP activates HCN2 by binding to the CNBD.

HCN2 is a regulator of nociceptor excitability. In nociceptive neurons, HCN2 modulates the generation of action potentials in response to inflammation. For example, upon prostaglandin E2 (PGE2) binding to a G protein-coupled receptor coupled to Gs, adenylate cyclase is activated, which elevates cAMP. The elevation of cAMP shifts the activation curve of HCN2 in the positive direction, which causes an HCN2-dependent tonic inward current (termed Ih) to be activated at the resting potential. The Ih current is essential for cardiac and neuronal pacemaker activity, dendritic integration of synaptic transmission, and the setting of resting potentials (18).

 

Hcn2-deficient (Hcn2-/-) mice were hypoactive and smaller than their wild-type littermates (29). The Hcn2-/- mice exhibited absence epilepsy, ataxia, and sinus arrhythmia (29). Mice with a cardiomyocyte-specific deletion of Hcn2 also exhibited sinus arrhythmia indicating that the heart phenotype is independent of the neuronal defects. Heart rate was not affected. Mice in which HCN2 is only deleted in the NaV1.8-expressing population of sensory neurons are normal (11). NaV1.8 is expressed only in nociceptive primary sensory neurons. These mice have an absence of hyperalgesia when tested with heat after injection with the inflammatory stimuli PGE2 or carrageenan. The mice also show an attenuated response in the late phase of the formalin model. They exhibit normal hyperalgesia to mechanical stimuli post-inflammation. Without inflammation, the mice exhibit normal withdrawal thresholds to acute noxious stimuli. Neuron-specific loss of HCN2 expression caused reduced tactile hypersensitivity after exposure to complete Freund's adjuvant (a chronic inflammatory pain model), but heat hypersensitivity was unaffected (30). The apathetic (ap/ap) mouse model has a spontaneous Hcn2 mutation that results in ataxia, absence seizures, and generalized tonic-clonic seizures (17). Heterozygous apathetic (ap/+) mice have a normal gait and occasional absence seizures.

 

Loss-of-function mutations in human HCN2 have been linked to idiopathic generalized epilepsies in patients (31;32). In addition, gain-of-function mutations are linked to polygenic epilepsy (33). Mutations in HCN2 have been correlated with increased incidence of febrile seizures (34). The mutant HCN2 channels exhibited faster kinetics with higher temperatures and subsequent increased rate of availability of the current.

Putative Mechanism

The reduced size and the ataxia phenotype observed in the curveball mice indicates a loss of HCN2curveball function.

Primers PCR Primer
curveball(F):5'- GGACAACACGGAGATCATCC -3'
curveball(R):5'- TGCCCTGTCCACAATCAAG -3'

Sequencing Primer
curveball_seq(F):5'- GATCATCCTGGACCCCGAGAAG -3'
curveball_seq(R):5'- TGTCCACAATCAAGGCCCC -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsJamie Russell, Emre Turer, Xue Zhong, and Bruce Beutler
List |< first << previous [record 100 of 511] next >> last >|