Phenotypic Mutation 'grey goose'

• Gene Symbol: Slc45a2
• Gene Name: solute carrier family 45, member 2
• Synonym(s): Aim-1, Aim1, Dbr, Matp, blanc-sale, bls, uw
• Allele: grey goose
• Institutional Source: Beutler Lab
• Mapped: Yes
• Chromosome: 15
• Chromosomal Location: 11,000,721-11,029,233 bp (+)
• Type of Mutation: MISSENSE
• DNA Base Change(Sense Strand): T to C at 10,932,736 bp (NCBIm37)
• Amino Acid Change: Leucine changed to Proline
• Ref Sequences:
  L180P in NCBI: NP_444307.1
• Predicted Effect: probably damaging ; ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using NCBI: NP_444307.1)
• Phenotypic Category: pigmentation, skin/coat/nails
• Penetrance: 100%
• Lab Alleles: UTSW: cardigan, cheng, galak, june gloom, nilla, sweater, yuki, zuckerkuss, R0148:Slc45a2, R0433:Slc45a2, R0440:Slc45a2
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Embryos, gDNA
• Last Updated: 06/07/2013 1:09 PM by Anne Murray
• Record Created: unknown
• Record Posted: 04/15/2008
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Celine Eidenschenk, Amanda L. Blasius, Bruce Beutler

Accession Number

NCBI RefSeq: NM_053077; MGI: 2153040

Alleles Listed at MGI

All alleles(11) : Targeted, other(1) Spontaneous(5) Chemically induced(5)

Repository

none

Phenotypic Description

The grey goose mutation was induced by ENU mutagenesis on the C57BL/6J (black) background, and was discovered in G3 animals.  Homozygous mutant mice exhibit a "dirty white" coat color associated with a light ocular albinism.  Newborn mutants have very light-colored skin and eyes in comparison with their heterozygote littermates.  Their eyes darken during development until only a light red glint remains in adults.  Grey goose mutants are viable and fertile.  Grey goose mutants bear a strong resemblance to galak, sweater, and cardigan mutant animals.

Nature of Mutation

The grey goose mutation was mapped to Chromosome 15, and corresponds to a T to C transition at position 635 of the Slc45a2 transcript, in exon 2 of 7 total exons.

619 GACAAGGAGAAGGGCCTCCACTACCATGCCCTC

175 -D--K--E--K--G--L--H--Y--H--A--L-

 

The mutated nucleotide is indicated in red lettering, and results in a leucine to proline change at amino acid 180 of the SLC45A2 (solute carrier family 45, member 2) or MATP (membrane associated transporter protein) protein.

Protein Prediction

Figure 1. Protein topology and domain structure of SLC45A2. SLC45A2 is a 55kD protein with 12 membrane-spanning (TM) domains, an elongated N-terminus, and enlarged cytoplasmic loop between transmembrane domains six and seven. The sucrose-transporter signature sequence, R-W-G-R-R is noted. The grey goose mutation (red asterisk) results in a leucine to proline change at amino acid 180 of the SLC45A2 protein.  This image is interactive. Click on the image to view other mutations found in SLC45A2. Click on the mutations for more specific information. 

The grey goose mutation occurs in the cytosolic loop between the fourth and fifth transmembrane domains of the SLC45A2 protein (Figure 1). It is unknown whether normal levels of the altered protein protein exist in grey goose mice or whether this protein is localized appropriately.

 

Please see the record for cardigan for more information on Slc45a2.

Putative Mechanism

The grey goose mutation results in an L180P change near the fifth transmembrane domain of SLC45A2.  This region is well-conserved in fish, mice and humans (1,2).  Although both leucine and proline are nonpolar hydrophobic residues, proline has a rigid conformation that often disrupts secondary structure, and is often found in turns and loops.  Although L180 is not located within the fifth transmembrane domain, the substitution of proline near the transmembrane domain may disrupt the structure of the protein in this region.  A human mutation in this region causes oculocutaneous albinism with patients presenting with very little pigment, suggesting this region of the SLC45A2 protein is functionally important.

Genotyping

Grey goose genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. This protocol has not been tested.

 

Primers for PCR amplification

Goose(F): 5’- ACCAAAACAAGGTGATTTGATGGGAGTT -3’

Goose(R): 5’- AGACGAATGCCCCGAGGCT - 3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Goose_seq(F): 5’- AAGGTGATTTGATGGGAGTTTAAGTG -3’

Goose_seq(R): 5’- GCAGTGTTCTGAAGAAACCTC -3’

 

The following sequence of 578 nucleotides (from Genbank genomic region NC_000081 for linear DNA sequence of Slc45a2) is amplified:

 

2011                                  accaaaacaa ggtgatttga tgggagttta
2041 agtgaaataa aaaatatgtg ggttgtttaa acctgattta gaaggcctat gtttgttttt
2101 cttttagctt tggttgctaa cccaaggcag aagctgatct gggccataag catcaccatg
2161 gtaggtgtgg ttctcttcga tttttctgct gacttcattg acgggcccat caaagcctac
2221 ttatttgatg tctgctccca ccaggacaag gagaagggcc tccactacca tgccctcttc
2281 acaggtaggg aatattccag aaagctggtc catccgcttt gcagacaggg agaaatgtca
2341 gcggacgcat ccagtgtctc tgcacttaga accttttgga tgaatgggtc agttgatagg
2401 aagtgcctat cacgcgctct ggcccgtctc catctgtgtc cctgaacaaa gtaagctcat
2461 gactgggctg cagagttcct gaaaaggaag tttacataag aggtttcttc agaacactgc
2521 aaaatgtagg aaggagtcct gtgcactgaa cattctcttt aaagcaatga gcctcggggc
2581 attcgtct                                                            

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References

   1.  Newton, J. M., Cohen-Barak, O., Hagiwara, N., Gardner, J. M., Davisson, M. T., King, R. A., and Brilliant, M. H. (2001) Mutations in the human orthologue of the mouse underwhite gene (uw) underlie a new form of oculocutaneous albinism, OCA4, Am. J Hum. Genet 69, 981-988.

   2.  Fukamachi, S., Shimada, A., and Shima, A. (2001) Mutations in the gene encoding B, a novel transporter protein, reduce melanin content in medaka, Nat. Genet 28, 381-385.