Phenotypic Mutation 'steve'

• Allele: steve
• Mutation Type: nonsense
• Chromosome: 6
• Coordinate: 29,204,631 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Impdh1
• Gene Name: inosine monophosphate dehydrogenase 1
• Synonym(s): B930086D20Rik
• Chromosomal Location: 29,200,435-29,216,363 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer to regulate cell growth. The encoded protein is an enzyme that catalyzes the synthesis of xanthine monophosphate (XMP) from inosine-5'-monophosphate (IMP). This is the rate-limiting step in the de novo synthesis of guanine nucleotides. Defects in this gene are a cause of retinitis pigmentosa type 10 (RP10). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008] ; PHENOTYPE: Mic homozygous for disruptions of this gene display abnormalities in T cell proliferation. Mice homozygous for an ENU-induced mutation exhibit reduced thickness of the outer nuclear layer and total retina thickness. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000077289] [ENSMUSP00000124931] [ENSMUSP00000125488] [ENSMUSP00000124269] [ENSMUSP00000124541] [ENSMUSP00000125077] [ENSMUSP00000125235]
• AlphaFold: P50096
• SMART Domains: Protein: ENSMUSP00000077289; Gene: ENSMUSG00000003500; AA Change: Q283*

Domain	Start	End	E-Value	Type
IMPDH	28	504	6.73e-263	SMART
CBS	117	168	6.49e-10	SMART
CBS	184	232	3.37e-8	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000124931; Gene: ENSMUSG00000003500; AA Change: Q283*

Domain	Start	End	E-Value	Type
IMPDH	28	504	6.73e-263	SMART
CBS	117	168	6.49e-10	SMART
CBS	184	232	3.37e-8	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000125488; Gene: ENSMUSG00000003500

Domain	Start	End	E-Value	Type
Pfam:IMPDH	28	84	3.9e-20	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000124269; Gene: ENSMUSG00000003500; AA Change: Q258*

Domain	Start	End	E-Value	Type
IMPDH	28	479	2.97e-232	SMART
CBS	92	143	6.49e-10	SMART
CBS	159	207	3.37e-8	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000124541; Gene: ENSMUSG00000003500; AA Change: Q283*

Domain	Start	End	E-Value	Type
IMPDH	28	504	6.73e-263	SMART
CBS	117	168	6.49e-10	SMART
CBS	184	232	3.37e-8	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000125077; Gene: ENSMUSG00000003500; AA Change: Q307*

Domain	Start	End	E-Value	Type
low complexity region	8	22	N/A	INTRINSIC
low complexity region	32	61	N/A	INTRINSIC
IMPDH	86	558	2e-256	SMART
CBS	171	222	6.49e-10	SMART
CBS	238	286	3.37e-8	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000123981; Gene: ENSMUSG00000003500

Domain	Start	End	E-Value	Type
IMPDH	1	145	2e-11	SMART
low complexity region	165	181	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000125235; Gene: ENSMUSG00000003500

Domain	Start	End	E-Value	Type
IMPDH	28	231	5.75e-17	SMART
CBS	161	209	3.37e-8	SMART

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Probably nonessential (E-score: 0.247)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:42 PM by Anne Murray
• Record Created: 2016-08-15 12:33 PM
• Record Posted: 2017-02-23
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Rafael Ufret

Accession Number

NCBI RefSeq: NM_001302933 (variant 1), NM_001302934 (variant 2), NM_011829 (variant 3); MGI:96567

Alleles Listed at MGI

All Mutations and Alleles(3) : Targeted(3)

Phenotypic Description

Figure 1. Steve mice exhibit a reduction in total retina thickness. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Steve mice exhibit a reduced thickness of the outer retina . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Steve mice exhibit a reduced thickness of the outer nuclear layer. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The steve phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4471, some of which showed a reduction in total retina thickness (as measured from the basement membrane of the retinal pigment epithelium (RPE) to the internal limiting membrane) (Figure 1), reduced thickness of the outer retina (as measured from the basement membrane of the RPE to the external limiting membrane) (Figure 2), and reduced thickness of the outer nuclear layer of the retina (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the reduced reduced thickness of the outer retina using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 68 mutations (X-axis) identified in the G1 male of pedigree R4471. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 68 mutations.  All of the above anomalies were linked by continuous variable mapping to a mutation in Impdh1:  a C to T transition at base pair 29,204,632 (v38) on chromosome 6, or base pair 11,733 in the GenBank genomic region NC_000072 encoding Impdh1. The strongest association was found with a recessive model of linkage to the normalized thickness of the outer retina, wherein three variant homozygotes departed phenotypically from six homozygous reference mice and 12 heterozygous mice with a P value of 1.492 x 10^-9 (Figure 4).  

The mutation corresponds to residue 978 in the mRNA sequence NM_178666 within exon 8 of 14 total exons, and residue 1,144 in the mRNA sequences NM_001302933 and NM_001302934 in exon 8 of 14 total exons.

11718 GGGAACTCAGTGTATCAGATCGCCATGGTGCAC 278   -G--N--S--V--Y--Q--I--A--M--V--H- (NP_035959) 302   -G--N--S--V--Y--Q--I--A--M--V--H- (NP_001289862 & NP_001289863)

Genomic numbering corresponds to NC_000072. The mutated nucleotide is indicated in red.  The mutation results in substitution of glutamine (Q) 283 to a premature stop codon (Q283*) in isoform 3 of the IMPDH1 protein and Q307* in isoform 1 and 2 of the IMPDH1 protein.

Protein Prediction

Figure 5. Domain organization of mouse IMPDH1. IMPDH1 has two cystathionine β-synthase (CBS) repeats. The C-terminal region of IMPDH1 is the catalytic region. The steve mutation results in substitution of glutamine (Q) 283 to a premature stop codon (Q283*)

Figure 6. Crystal structure of a catlytically active IMPDH monomer and tetramer from S. pyogenes. (A) Each IMPDH monomer has a catalytic region formed by an eight-stranded α/β barrel structure. A subdomain flanking the catalytic region has two cystathionine β-synthase (CBS) repeats. The corresponding location of the steve mutation is indicated. (B) The tetramer is displayed parallel to the 4-fold axis. Each subunit is shown with a different color. The CBS dimer domain and the catalytic domain is shown in one monomer. Figure completed using UCSF Chimera was adapted from PDB:1ZFJ.

Impdh1 encodes inosine 5’-monophosphate dehydrogenase 1 (IMPDH1), one of two members of the IMDPH family that also include IMPDH2. IMPDH1 and IMPDH2 share 84% sequence identity as well as enzymatic properties [(1); reviewed in (2)]. The IMPDH proteins form homotetramers (3). Each IMPDH monomer has a catalytic region formed by an eight-stranded α/β barrel structure (Figure 5 & 6A). A subdomain flanking the catalytic region has two cystathionine β-synthase (CBS) repeats (4). The CBS repeats are often found in proteins that bind adenine and/or guanine nucleotides (5;6). The IMPDH proteins are able to bind single-stranded nucleic acid, and the CBS repeats putatively mediate that function (7;8); the role of the nucleic acid binding property of IMPDH is unknown (7). The CBS repeats of the IMPDH proteins mediate an association with polyribosomes (3).The CBS repeats are not necessary for the enzymatic activity of the IMPDH proteins (9;10).

The crystal structure of the IMPDH protein from S. pyogenes has been solved (Figure 6; PDB:1ZFJ) (11). Similar to mammalian IMDPH, S. pyogenes IMPDH forms a tetramer in the shape of a square (Figure 6B). The catalytic domain of S. pyogenes IMPDH is the interior core of the enzyme and the CBS repeats project outward from the corners. The CBS dimer domain is located between helix α₂ and strand β₃. Connections between the remaining α/β motifs are short (2−5 amino acid residues). Each CBS motif has a sheet/helix/sheet/sheet/helix topology. In S. pyogenes IMPDH, two CBS domains form a minibarrel structure that has a distinct hydrophobic core. Similar to mammalian IMPDH, the catalytic core forms a TIM barrel that has eight parallel α/β motifs; the active site is near the C-terminus of the β-strands. An extended region projects from the C-terminal face of each monomer. The extended regions are composed of two antiparallel β-strand structures.

Human IMDPH1 encodes three different transcripts (4.0, 2.7, and 2.5 kb). The three transcripts have identical coding sequences (12), are derived from 14 exons, and have identical 3’-untranslated regions (13). The three transcripts differ due to alternative splicing of three 5’ exons (designated A, B, and C). In the retina, there are two alternative isoforms expressed in addition to canonical IMDPH [IMPDH1(514)]: a 546-amino acid protein [IMPDH1(546); alternatively, IMPDH1α/IMPDH1(13b)] and a 595-amino acid IMPDH1 [IMPDH1 (595); alternatively, IMPDHγ/IMPDH1(A+13b)] (13-15). IMPDH1(546) is considered to be a major alternative IMPDH1 isoform, while IMPDH1 (595) is a minor isoform. IMPDH1(546) and IMPDH1(595) contain a 32-amino acid extension at the C-terminus, and IMPDH1 (595) has an N-terminal extension (16). The functional activity of the alternative isoforms is unclear. In one study, the retinal isoforms exhibited comparable enzymatic activity to the canonical IMPDH1 isoform (17). In a second study, the IMPDH1 (595) isoform exhibited increased enzymatic activity (14). The cellular distribution of the alternative retina isoforms is similar to that of the canonical isoform (17). The unique proportions of the retinal IMPDH1 isoforms may facilitate binding to a different set of nucleic acids than conventional IMPDH1.

The steve mutation results in substitution of glutamine (Q) 283 to a premature stop codon (Q283*). Residue 283 is within the catalytic region of IMPDH1.

Expression/Localization

IMPDH1 is expressed in most tissues (13). IMPDH1 is highly expressed in the lung, thymus, brain, retina, and peripheral blood lymphocytes and at low levels in the liver and testis (13;18). IMPDH1 is highly expressed in the photoreceptor cells of the retina (13;18). In the photoreceptors, IMPDH1 is localized in the inner segment and synaptic terminals (13). IMPDH1 is localized both to the cytoplasm and nucleus of cells (13).

Background

Figure 7. Mechanism used by IMPDH to convert inosine monophosphate (IMP) to xanthosine monophosphate (XMP). Note that only the purine poriton of each molecule is shown. The IMPDH mechanism involves two chemical reactions. (A) A fast redox reaction involving a hydride transfer to NAD + generates NADH and an enzyme-bound XMP intermediate (E-XMP*). (B) A hydrolysis step releases XMP from the enzyme. IMP binds to the active site and a conserved cysteine residue attacks the 2-position of the purine ring. A hydride ion is then transferred from the C2 position to NAD + and the E-XMP* intermediate is formed. NADH dissociates from the enzyme and a mobile active-site flap element moves a conserved catalytic dyad of arginine and threonine into the newly unoccupied NAD binding site. Figure and legend were adapted from Wikiwand .

Guanine nucleotides are essential for several functions, including DNA replication, RNA and protein synthesis, and transmembrane and intracellular signaling. Both a de novo pathway and a salvage pathway generate guanine nucleotides. IMDPH1 is the rate-limiting enzyme in the de novo guanine nucleotide biosynthesis pathway. IMPDH1 converts inosine monophosphate (IMP) into xanthosine monophosphate (XMP) with reduction of NAD (Figure 7). XMP is subsequently converted into guanosine diphosphate (GDP) and triphosphate (GTP). Guanine nucleotides are produced in the salvage pathway through the function of phosphoribosyltransferases and/or nucleoside phosphotransferases/kinases.

In addition to its role in the de novo guanine nucleotide pathway, IMPDH binds to single-stranded nucleic acids and associates with polyribosomes (7). Although the role of these interactions is unknown, IMPDH putatively functions in RNA and/or DNA metabolism, replication, transcription, and/or translation (7).

Impdh1-deficient (Impdh1^-/-) mice are overtly healthy, fertile, and viable. However, the Impdh1^-/- mice exhibit a slowly progressive form of retinal degeneration. At 12 months of age both rod and cone-associated retinal function is reduced, but most photoreceptors are intact (18). In addition, CD3- and CD28-induced T cell activation was diminished in the Impdh1^-/- mice (19).

Mutations in IMPDH1 have been linked to both Leber congenital amaurosis 11 (OMIM: #613837; (20)) and autosomal dominant retinitis pigmentosa 10 (OMIM: #180105; (20;21)). Retinitis pigmentosa is a degenerative disease of the retina in which rod photoreceptor cells degenerate. Loss of the rod photoreceptor cells eventually leads to cone photoreceptor cell degeneration. Upon the rod photoreceptor cell death, patients exhibit night blindness; the loss of the cone photoreceptors results in complete blindness.

Putative Mechanism

RP-associated mutations in IMPDH1 cause retinal degeneration due to protein misfolding and aggregation rather than reduced IMPDH1 enzyme activity (8;18;20). Further studies showed that IMPDH1 mutations lead to changes in the affinity and/or specificity of the nucleic acid binding property of IMPDH1 (8;20). Retina degeneration due to IMPDH1 mutations are predicted to be due to loss in the function of one or more of the unique retinal IMDPH1 isoforms (13).

The retina phenotypes observed in the steve mice indicates loss of IMPDH1^steve function. Similar to RP-causing IMPDH1 mutations, the mutant protein in the steve mice may be misfolded or aggregates. The steve mutation is predicted to affect all of the IMPDH1 isoforms.

Primers

PCR Primer
steve_pcr_F: CAATCAAGTTCTTGGCCTGGG
steve_pcr_R: TCACTGAGAGGCCCCATTTG

Sequencing Primer
steve_seq_F: TGCTGTCACCACTGGGGATG
steve_seq_R: ATTTGCCCGGCACTGAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 482 nucleotides is amplified (chromosome 6, - strand):

1   tcactgagag gccccatttg cccggcactg agctcagctt tatacatgct cacttgtttc
61  actcagtgtt taacttagtt agcagcagct ctctgagtgc tggtccctaa ttcccgtgag
121 gggacttggc tgtttagctt gagccttttt gtccctgcta acaggattca tcccagggga
181 actcagtgta tcagatcgcc atggtgcact atatcaagca gaagtacccc cacctccaag
241 tgattggggg aaatggtgag tgtggagtgg cccccctcag ccccccagaa ctcctaagtg
301 atgtcattct tccaggcata ggggataaag ggtaggatgg gctttggtga gcatttaggt
361 tgggggagat atactaagat cccaggacat tcctgggcag ggtggggaca ctatcctcac
421 attcctctgt ctgcttcctc catccccagt ggtgacagca gcccaggcca agaacttgat
481 tg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Natsumeda, Y., Ohno, S., Kawasaki, H., Konno, Y., Weber, G., and Suzuki, K. (1990) Two Distinct cDNAs for Human IMP Dehydrogenase. J Biol Chem. 265, 5292-5295.

  2. Hedstrom, L. (2009) IMP Dehydrogenase: Structure, Mechanism, and Inhibition. Chem Rev. 109, 2903-2928.

  3. Mortimer, S. E., Xu, D., McGrew, D., Hamaguchi, N., Lim, H. C., Bowne, S. J., Daiger, S. P., and Hedstrom, L. (2008) IMP Dehydrogenase Type 1 Associates with Polyribosomes Translating Rhodopsin mRNA. J Biol Chem. 283, 36354-36360.

  4. Sintchak, M. D., Fleming, M. A., Futer, O., Raybuck, S. A., Chambers, S. P., Caron, P. R., Murcko, M. A., and Wilson, K. P. (1996) Structure and Mechanism of Inosine Monophosphate Dehydrogenase in Complex with the Immunosuppressant Mycophenolic Acid. Cell. 85, 921-930.

  5. Kemp, B. E. (2004) Bateman Domains and Adenosine Derivatives Form a Binding Contract. J Clin Invest. 113, 182-184.

  6. Mortimer, S. E., and Hedstrom, L. (2005) Autosomal Dominant Retinitis Pigmentosa Mutations in Inosine 5'-Monophosphate Dehydrogenase Type I Disrupt Nucleic Acid Binding. Biochem J. 390, 41-47.

  7. McLean, J. E., Hamaguchi, N., Belenky, P., Mortimer, S. E., Stanton, M., and Hedstrom, L. (2004) Inosine 5'-Monophosphate Dehydrogenase Binds Nucleic Acids in Vitro and in Vivo. Biochem J. 379, 243-251.

  8. Nimmesgern, E., Black, J., Futer, O., Fulghum, J. R., Chambers, S. P., Brummel, C. L., Raybuck, S. A., and Sintchak, M. D. (1999) Biochemical Analysis of the Modular Enzyme Inosine 5'-Monophosphate Dehydrogenase. Protein Expr Purif. 17, 282-289.

  9. Gan, L., Petsko, G. A., and Hedstrom, L. (2002) Crystal Structure of a Ternary Complex of Tritrichomonas Foetus Inosine 5'-Monophosphate Dehydrogenase: NAD+ Orients the Active Site Loop for Catalysis. Biochemistry. 41, 13309-13317.

  10. Pimkin, M., and Markham, G. D. (2008) The CBS Subdomain of Inosine 5'-Monophosphate Dehydrogenase Regulates Purine Nucleotide Turnover. Mol Microbiol. 68, 342-359.

  11. Zhang, R., Evans, G., Rotella, F. J., Westbrook, E. M., Beno, D., Huberman, E., Joachimiak, A., and Collart, F. R. (1999) Characteristics and Crystal Structure of Bacterial Inosine-5'-Monophosphate Dehydrogenase. Biochemistry. 38, 4691-4700.

  12. Gu, J. J., Spychala, J., and Mitchell, B. S. (1997) Regulation of the Human Inosine Monophosphate Dehydrogenase Type I Gene. Utilization of Alternative Promoters. J Biol Chem. 272, 4458-4466.

  13. Bowne, S. J., Liu, Q., Sullivan, L. S., Zhu, J., Spellicy, C. J., Rickman, C. B., Pierce, E. A., and Daiger, S. P. (2006) Why do Mutations in the Ubiquitously Expressed Housekeeping Gene IMPDH1 Cause Retina-Specific Photoreceptor Degeneration? Invest Ophthalmol Vis Sci. 47, 3754-3765.

  14. Gunter, J. H., Thomas, E. C., Lengefeld, N., Kruger, S. J., Worton, L., Gardiner, E. M., Jones, A., Barnett, N. L., and Whitehead, J. P. (2008) Characterisation of Inosine Monophosphate Dehydrogenase Expression during Retinal Development: Differences between Variants and Isoforms. Int J Biochem Cell Biol. 40, 1716-1728.

  15. Spellicy, C. J., Daiger, S. P., Sullivan, L. S., Zhu, J., Liu, Q., Pierce, E. A., and Bowne, S. J. (2007) Characterization of Retinal Inosine Monophosphate Dehydrogenase 1 in several Mammalian Species. Mol Vis. 13, 1866-1872.

  16. McGrew, D. A., and Hedstrom, L. (2012) Towards a Pathological Mechanism for IMPDH1-Linked Retinitis Pigmentosa. Adv Exp Med Biol. 723, 539-545.

  17. Xu, D., Cobb, G., Spellicy, C. J., Bowne, S. J., Daiger, S. P., and Hedstrom, L. (2008) Retinal Isoforms of Inosine 5'-Monophosphate Dehydrogenase Type 1 are Poor Nucleic Acid Binding Proteins. Arch Biochem Biophys. 472, 100-104.

  18. Aherne, A., Kennan, A., Kenna, P. F., McNally, N., Lloyd, D. G., Alberts, I. L., Kiang, A. S., Humphries, M. M., Ayuso, C., Engel, P. C., Gu, J. J., Mitchell, B. S., Farrar, G. J., and Humphries, P. (2004) On the Molecular Pathology of Neurodegeneration in IMPDH1-Based Retinitis Pigmentosa. Hum Mol Genet. 13, 641-650.

  19. Gu, J. J., Tolin, A. K., Jain, J., Huang, H., Santiago, L., and Mitchell, B. S. (2003) Targeted Disruption of the Inosine 5'-Monophosphate Dehydrogenase Type I Gene in Mice. Mol Cell Biol. 23, 6702-6712.

  20. Bowne, S. J., Sullivan, L. S., Mortimer, S. E., Hedstrom, L., Zhu, J., Spellicy, C. J., Gire, A. I., Hughbanks-Wheaton, D., Birch, D. G., Lewis, R. A., Heckenlively, J. R., and Daiger, S. P. (2006) Spectrum and Frequency of Mutations in IMPDH1 Associated with Autosomal Dominant Retinitis Pigmentosa and Leber Congenital Amaurosis. Invest Ophthalmol Vis Sci. 47, 34-42.

  21. Bowne, S. J., Sullivan, L. S., Blanton, S. H., Cepko, C. L., Blackshaw, S., Birch, D. G., Hughbanks-Wheaton, D., Heckenlively, J. R., and Daiger, S. P. (2002) Mutations in the Inosine Monophosphate Dehydrogenase 1 Gene (IMPDH1) Cause the RP10 Form of Autosomal Dominant Retinitis Pigmentosa. Hum Mol Genet. 11, 559-568.