Phenotypic Mutation 'Kortiku' (pdf version)
Allele | Kortiku |
Mutation Type |
missense
|
Chromosome | 1 |
Coordinate | 91,351,551 bp (GRCm39) |
Base Change | A ⇒ G (forward strand) |
Gene |
Per2
|
Gene Name | period circadian clock 2 |
Synonym(s) | mPer2 |
Chromosomal Location |
91,343,704-91,387,046 bp (-) (GRCm39)
|
MGI Phenotype |
FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers and have been linked to sleep disorders. [provided by RefSeq, Jan 2014] PHENOTYPE: Homozygous null mutants have a partially functional circadian clock, exhibiting a short circadian period followed by loss of circadian rhythmicity in constant darkness. Mutants are also deficient in DNA damage responses and show increased sensitivity togamma radiation and tumor development. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_011066; MGI:1195265
|
Mapped | Yes |
Amino Acid Change |
Leucine changed to Proline
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000066620]
|
AlphaFold |
no structure available at present |
SMART Domains |
Protein: ENSMUSP00000066620 Gene: ENSMUSG00000055866 AA Change: L985P
Domain | Start | End | E-Value | Type |
PAS
|
179 |
246 |
3.23e1 |
SMART |
PAS
|
319 |
385 |
5.75e-2 |
SMART |
PAC
|
393 |
436 |
1.6e0 |
SMART |
low complexity region
|
475 |
488 |
N/A |
INTRINSIC |
low complexity region
|
821 |
834 |
N/A |
INTRINSIC |
low complexity region
|
996 |
1014 |
N/A |
INTRINSIC |
Pfam:Period_C
|
1040 |
1234 |
2.7e-93 |
PFAM |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000069620)
|
Meta Mutation Damage Score |
0.2556 |
Is this an essential gene? |
Probably nonessential (E-score: 0.194) |
Phenotypic Category |
Autosomal Semidominant |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All Mutations and Alleles(20) : Chemically induced (other)(1) Radiation induced(1) Targeted(10) Transgenic(8)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL01306:Per2
|
APN |
1 |
91376555 |
missense |
probably damaging |
0.98 |
IGL01350:Per2
|
APN |
1 |
91358583 |
missense |
probably damaging |
1.00 |
IGL01865:Per2
|
APN |
1 |
91349239 |
missense |
probably benign |
0.10 |
IGL01974:Per2
|
APN |
1 |
91351440 |
missense |
probably benign |
0.02 |
IGL02118:Per2
|
APN |
1 |
91352031 |
missense |
probably damaging |
0.99 |
IGL02271:Per2
|
APN |
1 |
91373332 |
missense |
probably damaging |
1.00 |
IGL02533:Per2
|
APN |
1 |
91358724 |
missense |
possibly damaging |
0.92 |
IGL02707:Per2
|
APN |
1 |
91378450 |
missense |
possibly damaging |
0.94 |
IGL02972:Per2
|
APN |
1 |
91351703 |
missense |
possibly damaging |
0.50 |
IGL03118:Per2
|
APN |
1 |
91372341 |
nonsense |
probably null |
|
IGL03125:Per2
|
APN |
1 |
91378333 |
missense |
probably benign |
0.00 |
IGL03375:Per2
|
APN |
1 |
91351950 |
missense |
possibly damaging |
0.76 |
IGL03388:Per2
|
APN |
1 |
91372511 |
splice site |
probably benign |
|
obst
|
UTSW |
1 |
91373261 |
missense |
probably benign |
0.00 |
R7092_Per2_246
|
UTSW |
1 |
91349153 |
missense |
probably damaging |
1.00 |
rhythm
|
UTSW |
1 |
91357104 |
critical splice donor site |
probably null |
|
ANU23:Per2
|
UTSW |
1 |
91376555 |
missense |
probably damaging |
0.98 |
R0029:Per2
|
UTSW |
1 |
91351434 |
missense |
possibly damaging |
0.58 |
R0029:Per2
|
UTSW |
1 |
91351434 |
missense |
possibly damaging |
0.58 |
R0542:Per2
|
UTSW |
1 |
91366054 |
critical splice donor site |
probably null |
|
R0764:Per2
|
UTSW |
1 |
91357142 |
missense |
probably damaging |
1.00 |
R1370:Per2
|
UTSW |
1 |
91373279 |
missense |
possibly damaging |
0.94 |
R1655:Per2
|
UTSW |
1 |
91376490 |
missense |
probably damaging |
1.00 |
R1688:Per2
|
UTSW |
1 |
91351551 |
missense |
probably damaging |
1.00 |
R1997:Per2
|
UTSW |
1 |
91368581 |
missense |
probably damaging |
1.00 |
R2891:Per2
|
UTSW |
1 |
91373325 |
missense |
probably damaging |
1.00 |
R2893:Per2
|
UTSW |
1 |
91373325 |
missense |
probably damaging |
1.00 |
R2894:Per2
|
UTSW |
1 |
91373325 |
missense |
probably damaging |
1.00 |
R3109:Per2
|
UTSW |
1 |
91373297 |
missense |
probably benign |
0.02 |
R4125:Per2
|
UTSW |
1 |
91357172 |
missense |
possibly damaging |
0.71 |
R4997:Per2
|
UTSW |
1 |
91378505 |
missense |
probably benign |
0.02 |
R5110:Per2
|
UTSW |
1 |
91357237 |
missense |
possibly damaging |
0.57 |
R5478:Per2
|
UTSW |
1 |
91360590 |
missense |
probably benign |
0.09 |
R5590:Per2
|
UTSW |
1 |
91355578 |
nonsense |
probably null |
|
R5634:Per2
|
UTSW |
1 |
91372429 |
missense |
probably benign |
0.02 |
R5654:Per2
|
UTSW |
1 |
91373223 |
splice site |
probably null |
|
R5928:Per2
|
UTSW |
1 |
91372373 |
missense |
probably damaging |
1.00 |
R6241:Per2
|
UTSW |
1 |
91349251 |
missense |
probably damaging |
0.97 |
R6295:Per2
|
UTSW |
1 |
91377594 |
missense |
unknown |
|
R6345:Per2
|
UTSW |
1 |
91376444 |
missense |
probably damaging |
1.00 |
R6480:Per2
|
UTSW |
1 |
91357104 |
critical splice donor site |
probably null |
|
R6502:Per2
|
UTSW |
1 |
91355485 |
missense |
probably benign |
0.01 |
R6702:Per2
|
UTSW |
1 |
91355671 |
missense |
probably damaging |
1.00 |
R6703:Per2
|
UTSW |
1 |
91355671 |
missense |
probably damaging |
1.00 |
R6790:Per2
|
UTSW |
1 |
91373261 |
missense |
probably benign |
0.00 |
R7043:Per2
|
UTSW |
1 |
91347130 |
missense |
probably benign |
|
R7092:Per2
|
UTSW |
1 |
91349153 |
missense |
probably damaging |
1.00 |
R7430:Per2
|
UTSW |
1 |
91351705 |
nonsense |
probably null |
|
R7555:Per2
|
UTSW |
1 |
91362857 |
missense |
probably damaging |
1.00 |
R7860:Per2
|
UTSW |
1 |
91372481 |
missense |
probably damaging |
0.99 |
R8046:Per2
|
UTSW |
1 |
91363425 |
missense |
possibly damaging |
0.56 |
R8142:Per2
|
UTSW |
1 |
91349269 |
missense |
possibly damaging |
0.90 |
R8261:Per2
|
UTSW |
1 |
91361170 |
missense |
possibly damaging |
0.87 |
R8277:Per2
|
UTSW |
1 |
91348274 |
missense |
probably benign |
0.15 |
R8534:Per2
|
UTSW |
1 |
91351659 |
missense |
probably benign |
0.09 |
R8685:Per2
|
UTSW |
1 |
91378402 |
missense |
possibly damaging |
0.88 |
R8703:Per2
|
UTSW |
1 |
91351767 |
missense |
possibly damaging |
0.92 |
R9100:Per2
|
UTSW |
1 |
91351464 |
missense |
possibly damaging |
0.91 |
R9228:Per2
|
UTSW |
1 |
91366081 |
missense |
probably damaging |
1.00 |
R9257:Per2
|
UTSW |
1 |
91376445 |
missense |
probably damaging |
1.00 |
R9429:Per2
|
UTSW |
1 |
91351489 |
missense |
probably benign |
|
X0011:Per2
|
UTSW |
1 |
91348311 |
missense |
possibly damaging |
0.85 |
Z1176:Per2
|
UTSW |
1 |
91349215 |
missense |
possibly damaging |
0.94 |
|
Mode of Inheritance |
Autosomal Semidominant |
Local Stock | |
Repository | |
Last Updated |
2019-09-04 9:42 PM
by Diantha La Vine
|
Record Created |
2016-08-15 1:53 PM
|
Record Posted |
2017-03-31 |
Phenotypic Description |
The Kortiku phenotype was identified among G3 mice of the pedigree R1688, some of which showed a shortened free-running period in constant darkness and an advanced phase of entrainment compared to wild-type controls (Figure 1).
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 74 mutations. The circadian period phenotype was linked to a mutation in Per2: an A to G transition at base pair 91,423,829 (v38) on chromosome 1, or base pair 35,574 in the GenBank genomic region NC_000067 encoding Per2. The mutation corresponds to residue 3,128 in the NM_011066 mRNA sequence for Per2, in exon 19 of 23 total exons. Linkage was found with a semidominant model of inheritance, wherein 5 variant homozygotes and 10 heterozygotes differed phenotypically from 5 homozygous reference mice (P = 6.877 x 10-16; Figure 2).
35558 AGTAGTCCCCTACAACTTAACCTGCTTCAGCTA
980 -S--S--P--L--Q--L--N--L--L--Q--L-
|
Nucleotide numbering corresponds to NC_000067; the mutated nucleotide is indicated in red. The mutation results in substitution of leucine 985 with proline (L985P) in the PER2 protein.
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
The PERIOD2 (PER2) protein is one of three mammalian PER proteins (PER1, PER2, and PER3) that are key components of the core feedback loop controlling circadian rhythm in mammals. In the positive arm of the feedback loop, the transcription factors CLOCK (see uhr), BMAL1, and NPAS2 activate the expression of the PER proteins and the two cryptochromes (CRY1 and CRY2) (1). PER and CRY proteins inhibit their own transcription, completing the circle of negative feedback. Similar to several other circadian clock components (CLOCK, BMAL1, BMAL2, NPAS2), PER proteins contain two Per-Arnt-Sim (PAS) domain repeats (PAS-A and PAS-B; Figure 3). The PAS domain is approximately 100-120 amino acids in length. The PAS-A domain has been proposed to primarily mediate protein-protein interactions with other PAS-containing proteins (2). It has been suggested that the PAS-B domain is important as a sensor of environmental signals through binding to proteins that transduce sensory information (2;3). Sequence analysis of 34 mouse PAS domain-containing proteins suggests that PAS-A and PAS-B domains have distinct consensus sequences (PAS-A: LxALDGFxxV VxxxxGxxxY xSExVxxxLG xxQxxLxxxG xSxxxxxHPx DxxExxxxL; PAS-B: IxxxxxxFx xRHxxDxxFx xxDxRxxxxx GYxPxxLxGx xxYxxxHxxD xxxxxxxH) (2). However, they exhibit a similar three dimensional fold in a variety of proteins, with four to five α-helices surrounding a sheet of five antiparallel β-strands (4;5). The crystal structure of a fragment of mouse PER2 (aa170–473) encompassing the two PAS domains showed that both PAS domains exhibited the canonical PAS fold (Figure 4) (6). The structure contained a homodimer of two PER2 peptides stabilized by antiparallel interactions between the PAS-B β-sheets of each molecule, and by interactions of the PAS-A domain of one molecule with helix αE (C-terminal to PAS-B domain) and the PAS-B domain of the second molecule (6). It has been reported that the PAS domain homodimer interface differs between mouse and fly PER2 (6;7), and between mouse PER1, PER2, and PER3 (8).
In addition to homodimerization, the PAS domains of PER2 mediate heterodimerization among the PER proteins (9-12), and interactions with other proteins including CLOCK, BMAL1 (also called Arntl, aryl hydrocarbon receptor nuclear translocator-like), and NPAS2 (5;13-15). It has been reported that all three PER proteins also bind to heme; the PAS domains and a C-terminal region of PER2 mediate the interaction with heme, which may modulate PER2 stability and expression (16-18). Important dimerization partners of the PER proteins are CRY1 and CRY2, which bind to a C-terminal region of PER2 (aa1157-1257) (19-23). Crystal structures of the CRY-binding domain (CBD) of PER2 in complex with the photolyase-homology region (PHR) of CRY1 or CRY2 show a highly extended structure of the PER2 CBD, which folds into five α-helices that wrap around the CRY C-terminal α-helical domain (Figure 5) (24;25). A zinc ion is coordinated within a CCCH-type intermolecular zinc finger motif at the PER2-CRY interface, stabilizing it. Binding of the PER2 CBD conceals binding sites on CRY for FBXL3 and CLOCK/BMAL1 (24;25). This finding is consistent with reports that PER2 competes with the ubiquitin ligase FBXL3 (see De Largo) for binding to CRY1/2; PER2-CRY interaction stabilizes CRY by preventing FBXL3-mediated ubiquitination and degradation by the proteasome (26-28).
PER2 contains a nuclear localization signal (NLS; aa778-794) and three nuclear export signals recognized by the CRM1/Exportin1 system (NES; aa109-118, 460-469, 983-990) with consensus sequence LX1-3LX2-4LXL(V/I/M) (11;22). The three NES can function independently but also additively (22). The kortiku mutation affects a leucine residue within the most C-terminal nuclear export sequence.
|
Expression/Localization | Gene expression of Per2 is ubiquitous (29;30). Most sub-regions of the brain displayed Per2 expression, with the exception of the pars tuberalis and Purkinje neurons (29). In the suprachiasmatic nucleus of the hypothalamus, Per2 expression peaks during the subjective day (29;30). PER2 localization cycles between the nucleus and cytoplasm (22).
|
Background |
Circadian rhythms are intrinsic daily cycles of behavioral and physiological changes driven by an endogenous “clock” or “oscillator” [reviewed in (31-33)]. Changes in sleep/wakefulness, locomotion, feeding, and temperature are all overt signs of the body’s circadian rhythm. These rhythms, which follow a 24-hour cycle or period, are both self-sustained, occurring even in the absence of external inputs, and entrained (synchronized) by environmental cues such as the light-dark cycle. In mammals, the master circadian clock is located in the hypothalamic suprachiasmatic nucleus (SCN) (34), where a network of interconnected and therefore synchronized neurons receives photic input from the retina and provides circadian timing information to the rest of the body (35). This information is conveyed by direct neuronal projections to other brain and peripheral regions, as well as by diffusible factors (36;37) and systemic cues (e.g. body temperature) from the SCN (38-40). Peripheral organs can sustain circadian rhythms in the absence of SCN input, and do so with tissue-specific differences in period and phase (41). However, peripheral tissues rely on the master clock for long term synchronization to an internally coherent timing system (41-44). At the molecular level, the circadian clock consists of several interacting positive and negative transcriptional feedback loops that drive recurrent cycling of RNA and protein levels of clock components (Figure 6) (1;32;45). In the canonical model, the core feedback loop consists of BMAL1 and CLOCK, components of the positive arm of the loop, and three PER and two CRY proteins, components of the negative arm of the loop. CLOCK-BMAL1 heterodimers activate the transcription of Per, Cry, and Rev-Erbα genes through interaction with E-box enhancers (46;47). After heterodimerization in the cytoplasm, PER-CRY complexes translocate into the nucleus where they directly interact with CLOCK-BMAL1 and inhibit transcription (21;23;48-50). Ubiquitin-mediated degradation of PER and CRY proteins gradually relieves their repression of CLOCK-BMAL1, and the cycle begins again (28;51-54). Rhythmic changes in Bmal1 transcription are controlled by another transcriptional feedback loop involving the retinoic acid receptor (RAR)-related orphan receptors (RORα, RORβ, RORγ; see 4-limb clasper and chestnut) and Rev-Erbα/Rev-Erbβ (Figure 6). RORα and RORβ have been shown to interact with several ROR response elements (RORE) in the promoter of Bmal1, cyclically competing with the transcriptional repressors Rev-Erbα and Rev-Erbβ for binding (47;55-57). ROREs are also found in intron 1 of Cry1; these, together with E-box elements found in the Cry1 promoter, generate an essential delay in Cry1 expression relative to genes regulated strictly by CLOCK-BMAL1 (58;59). Although rhythmicity of BMAL1 expression is not necessary for proper timing of the core feedback loop (60), the delay in feedback repression by CRY1 is required for mammalian circadian clock function (58). Recent studies have explained more precisely the functions of PER and CRY proteins in the circadian core feedback loop. Biochemical experiments demonstrated that CRY proteins bind to the CLOCK-BMAL1-E-box DNA complex independently of PER to repress transcription (61;62), a finding supported by genetic data (21;23). By itself, PER1/PER2 had no effect on CLOCK-BMAL1-mediated transcription (62). However, in the presence of CRY, PER1/PER2 entered the nucleus and displaced CLOCK-BMAL1-CRY from E-box DNA to either inhibit or promote transcription in a manner dependent on the regulatory elements present in the particular promoter (62;63). A gene predominantly regulated by an E-box, such as Nr1d1 encoding Rev-Erbα, is repressed by PER2 when PER2 removes CLOCK-BMAL1 from the promoter. A gene predominantly (negatively) regulated by Rev-Erbα, such as Bmal1, is de-repressed by PER2 indirectly through the repressive effect of PER2 on Nr1d1 transcription. A third type of gene with multiple transcriptional regulatory elements in its promoter including an E-box, D-box, and RRE (e.g. Cry1) is de-repressed by PER2; PER2 displaces the repressive CLOCK-BMAL1-CRY from the promoter, and it is proposed that a binding site is for an unknown transcriptional activator is thereby uncovered to promote transcription (63). Other reports have proposed different mechanisms for the positive effect of PER2 on transcription of some genes (64;65). The 24-hour period of the circadian cycle is modulated by casein kinase 1δ (CK1δ) and CK1ε, serine kinases that interact with and phosphorylate PER proteins and thereby control their translocation into the nucleus (66;67) or their degradation (54). PER1 and PER2 protein degradation is mediated by the SKP1-CUL1-F-box (SCF) E3 ubiquitin ligase complex containing the F-box protein β-TrCP1 or β-TrCP2 (54;68;69). CK1δ/ε deficiency results in the constitutive cytoplasmic localization of PER proteins (66). The activities of CK1δ and CK1ε are regulated by phosphatases PP1 and PP5 (66;67). Although each of the three PER proteins can moderately inhibit transcription activated by CLOCK-BMAL1 in vitro (21), studies of single and double mutant mice suggest their functions in vivo are not equivalent. Circadian behavior became arrhythmic in Per1-/- or Per2-/- mice after a period of time in constant darkness (10 days to 3 weeks) (70). In the interval before arrhythmicity, the circadian period of locomotor activity was slightly shortened (70); ; notably, Per2-/- mice congenic with the C57BL/6J strain had a near-normal to normal period and did not develop arrhythmicity (71;72). Analysis of clock gene and protein expression in these mice indicated that PER2 acted as a positive regulator of Per1, Per2, Cry1, and Bmal1 gene expression, while PER1 promoted the expression of PER2 and CRY1 proteins but not their gene expression (70;73;74). Double knockout Per1-/-Per2-/- mice showed abrupt loss of behavioral rhythmicity immediately upon placement in constant darkness, a more severe defect than observed in either single knockout mutant (70). In contrast, PER3 deficiency had no effect on gene expression of Per1, Per2, Cry1, or Bmal1, and only a subtle effect on circadian cycle length, reducing it by 0.5 hour (75). Per3-/-Per1-/- or Per3-/-Per2-/- mice showed circadian behavior phenotypes identical to single mutant PER1- or PER2-deficient mice, respectively, suggesting that PER3 is not a component of the circadian core feedback loop (70). This is consistent with the finding that mRNA levels in the mouse SCN of Per1 and Per2, but not Per3, were acutely induced by light exposure during the night (76). Humans with a heterozygous mutation of PER2 display familial advanced sleep phase syndrome 1 (FASPS1; OMIM #604348), in which a shortened circadian period leads to very early sleep onset and offset (77;78). The mutation, S662G, resulted in impaired binding of CK1δ and CK1ε, consequent hypophosphorylation, and premature nuclear clearance of PER2 (72;79). As a result of premature nuclear clearance, increased degradation of mutated PER2 occurred in the cytoplasm.
|
Putative Mechanism | The Per2kortiku mutation results in a leucine to proline substitution at position 985, within the most C-terminal nuclear export sequence of PER2. The shortening of the free-running period of heterozygous and homozygous Kortiku mice is more severe than that observed in other PER2-deficient mice on a C57BL/6J background (70-72;74), suggesting that Kortiku is a gain-of-function allele. Another ENU-induced missense mutation of Per2 affecting a residue in the interdomain linker between the PAS domains resulted in a period phenotype similar to that observed in Kortiku homozygotes; that allele (Per2Edo; C57BL/6J congenic) was shown to cause a gain of function (80).
|
Primers |
PCR Primer
Kortiku_pcr_F: GCTGACTACCATGTGTACTGCCTG
Kortiku_pcr_R: ACTGGCTTCACCATGCCTGTTG
Sequencing Primer
Kortiku_seq_F: TACCATGTGTACTGCCTGAGAAAG
Kortiku_seq_R: AATTCGCAGTGCAGCCC
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 544 nucleotides is amplified (chromosome 1, - strand):
1 actggcttca ccatgcctgt tgtgcctatg ggcacccagc ctgaattcgc agtgcagccc 61 ctgccattcg ctgccccttt ggctcctgtc atggccttca tgctgcccag ctacccgttc 121 ccaccagcaa ccccaaacct gcctcaggcc ttcctcccca gccagcctca ctttccagcc 181 caccccacac ttgcctccga aataactcct gcctcccagg ctgagttccc tagtcggacc 241 tcgacgctca gacagccgtg cgcttgccca gtcacccctc cagccggcac agtggccctg 301 ggcagagcct ccccaccgct cttccagtcc agaggcagta gtcccctaca acttaacctg 361 cttcagctag aggaggcgcc tgaaggcagc actggagccg cagggaccct ggggaccaca 421 gggacagcag cttctggtct ggactgcaca tctggcacat ctcgggatcg gcagccaaag 481 gcacctccaa cagtaaggct tctctgctgt gtctctttct caggcagtac acatggtagt 541 cagc
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References |
5. Huang, N., Chelliah, Y., Shan, Y., Taylor, C. A., Yoo, S. H., Partch, C., Green, C. B., Zhang, H., and Takahashi, J. S. (2012) Crystal Structure of the Heterodimeric CLOCK:BMAL1 Transcriptional Activator Complex. Science. 337, 189-194.
6. Hennig, S., Strauss, H. M., Vanselow, K., Yildiz, O., Schulze, S., Arens, J., Kramer, A., and Wolf, E. (2009) Structural and Functional Analyses of PAS Domain Interactions of the Clock Proteins Drosophila PERIOD and Mouse PERIOD2. PLoS Biol. 7, e94.
7. Yildiz, O., Doi, M., Yujnovsky, I., Cardone, L., Berndt, A., Hennig, S., Schulze, S., Urbanke, C., Sassone-Corsi, P., and Wolf, E. (2005) Crystal Structure and Interactions of the PAS Repeat Region of the Drosophila Clock Protein PERIOD. Mol Cell. 17, 69-82.
8. Kucera, N., Schmalen, I., Hennig, S., Ollinger, R., Strauss, H. M., Grudziecki, A., Wieczorek, C., Kramer, A., and Wolf, E. (2012) Unwinding the Differences of the Mammalian PERIOD Clock Proteins from Crystal Structure to Cellular Function. Proc Natl Acad Sci U S A. 109, 3311-3316.
9. Field, M. D., Maywood, E. S., O'Brien, J. A., Weaver, D. R., Reppert, S. M., and Hastings, M. H. (2000) Analysis of Clock Proteins in Mouse SCN Demonstrates Phylogenetic Divergence of the Circadian Clockwork and Resetting Mechanisms. Neuron. 25, 437-447.
11. Yagita, K., Yamaguchi, S., Tamanini, F., van Der Horst, G. T., Hoeijmakers, J. H., Yasui, A., Loros, J. J., Dunlap, J. C., and Okamura, H. (2000) Dimerization and Nuclear Entry of mPER Proteins in Mammalian Cells. Genes Dev. 14, 1353-1363.
12. Zylka, M. J., Shearman, L. P., Levine, J. D., Jin, X., Weaver, D. R., and Reppert, S. M. (1998) Molecular Analysis of Mammalian Timeless. Neuron. 21, 1115-1122.
13. Chen, R., Schirmer, A., Lee, Y., Lee, H., Kumar, V., Yoo, S. H., Takahashi, J. S., and Lee, C. (2009) Rhythmic PER Abundance Defines a Critical Nodal Point for Negative Feedback within the Circadian Clock Mechanism. Mol Cell. 36, 417-430.
14. Langmesser, S., Tallone, T., Bordon, A., Rusconi, S., and Albrecht, U. (2008) Interaction of Circadian Clock Proteins PER2 and CRY with BMAL1 and CLOCK. BMC Mol Biol. 9, 41-2199-9-41.
15. Sasaki, M., Yoshitane, H., Du, N. H., Okano, T., and Fukada, Y. (2009) Preferential Inhibition of BMAL2-CLOCK Activity by PER2 Reemphasizes its Negative Role and a Positive Role of BMAL2 in the Circadian Transcription. J Biol Chem. 284, 25149-25159.
17. Kitanishi, K., Igarashi, J., Hayasaka, K., Hikage, N., Saiful, I., Yamauchi, S., Uchida, T., Ishimori, K., and Shimizu, T. (2008) Heme-Binding Characteristics of the Isolated PAS-A Domain of Mouse Per2, a Transcriptional Regulatory Factor Associated with Circadian Rhythms. Biochemistry. 47, 6157-6168.
18. Yang, J., Kim, K. D., Lucas, A., Drahos, K. E., Santos, C. S., Mury, S. P., Capelluto, D. G., and Finkielstein, C. V. (2008) A Novel Heme-Regulatory Motif Mediates Heme-Dependent Degradation of the Circadian Factor Period 2. Mol Cell Biol. 28, 4697-4711.
19. Ozber, N., Baris, I., Tatlici, G., Gur, I., Kilinc, S., Unal, E. B., and Kavakli, I. H. (2010) Identification of Two Amino Acids in the C-Terminal Domain of Mouse CRY2 Essential for PER2 Interaction. BMC Mol Biol. 11, 69-2199-11-69.
20. Tomita, T., Miyazaki, K., Onishi, Y., Honda, S., Ishida, N., and Oishi, K. (2010) Conserved Amino Acid Residues in C-Terminus of PERIOD 2 are Involved in Interaction with CRYPTOCHROME 1. Biochim Biophys Acta. 1803, 492-498.
21. Kume, K., Zylka, M. J., Sriram, S., Shearman, L. P., Weaver, D. R., Jin, X., Maywood, E. S., Hastings, M. H., and Reppert, S. M. (1999) MCRY1 and mCRY2 are Essential Components of the Negative Limb of the Circadian Clock Feedback Loop. Cell. 98, 193-205.
22. Yagita, K., Tamanini, F., Yasuda, M., Hoeijmakers, J. H., van der Horst, G. T., and Okamura, H. (2002) Nucleocytoplasmic Shuttling and mCRY-Dependent Inhibition of Ubiquitylation of the mPER2 Clock Protein. EMBO J. 21, 1301-1314.
24. Nangle, S. N., Rosensweig, C., Koike, N., Tei, H., Takahashi, J. S., Green, C. B., and Zheng, N. (2014) Molecular Assembly of the Period-Cryptochrome Circadian Transcriptional Repressor Complex. Elife. 3, e03674.
25. Schmalen, I., Reischl, S., Wallach, T., Klemz, R., Grudziecki, A., Prabu, J. R., Benda, C., Kramer, A., and Wolf, E. (2014) Interaction of Circadian Clock Proteins CRY1 and PER2 is Modulated by Zinc Binding and Disulfide Bond Formation. Cell. 157, 1203-1215.
26. Godinho, S. I., Maywood, E. S., Shaw, L., Tucci, V., Barnard, A. R., Busino, L., Pagano, M., Kendall, R., Quwailid, M. M., Romero, M. R., O'neill, J., Chesham, J. E., Brooker, D., Lalanne, Z., Hastings, M. H., and Nolan, P. M. (2007) The After-Hours Mutant Reveals a Role for Fbxl3 in Determining Mammalian Circadian Period. Science. 316, 897-900.
27. Busino, L., Bassermann, F., Maiolica, A., Lee, C., Nolan, P. M., Godinho, S. I., Draetta, G. F., and Pagano, M. (2007) SCFFbxl3 Controls the Oscillation of the Circadian Clock by Directing the Degradation of Cryptochrome Proteins. Science. 316, 900-904.
28. Siepka, S. M., Yoo, S. H., Park, J., Song, W., Kumar, V., Hu, Y., Lee, C., and Takahashi, J. S. (2007) Circadian Mutant Overtime Reveals F-Box Protein FBXL3 Regulation of Cryptochrome and Period Gene Expression. Cell. 129, 1011-1023.
29. Albrecht, U., Sun, Z. S., Eichele, G., and Lee, C. C. (1997) A Differential Response of Two Putative Mammalian Circadian Regulators, mper1 and mper2, to Light. Cell. 91, 1055-1064.
30. Shearman, L. P., Zylka, M. J., Weaver, D. R., Kolakowski, L. F.,Jr, and Reppert, S. M. (1997) Two Period Homologs: Circadian Expression and Photic Regulation in the Suprachiasmatic Nuclei. Neuron. 19, 1261-1269.
35. Liu, A. C., Welsh, D. K., Ko, C. H., Tran, H. G., Zhang, E. E., Priest, A. A., Buhr, E. D., Singer, O., Meeker, K., Verma, I. M., Doyle, F. J.,3rd, Takahashi, J. S., and Kay, S. A. (2007) Intercellular Coupling Confers Robustness Against Mutations in the SCN Circadian Clock Network. Cell. 129, 605-616.
38. Brown, S. A., Zumbrunn, G., Fleury-Olela, F., Preitner, N., and Schibler, U. (2002) Rhythms of Mammalian Body Temperature can Sustain Peripheral Circadian Clocks. Curr Biol. 12, 1574-1583.
39. Saini, C., Morf, J., Stratmann, M., Gos, P., and Schibler, U. (2012) Simulated Body Temperature Rhythms Reveal the Phase-Shifting Behavior and Plasticity of Mammalian Circadian Oscillators. Genes Dev. 26, 567-580.
41. Yoo, S. H., Yamazaki, S., Lowrey, P. L., Shimomura, K., Ko, C. H., Buhr, E. D., Siepka, S. M., Hong, H. K., Oh, W. J., Yoo, O. J., Menaker, M., and Takahashi, J. S. (2004) PERIOD2::LUCIFERASE Real-Time Reporting of Circadian Dynamics Reveals Persistent Circadian Oscillations in Mouse Peripheral Tissues. Proc Natl Acad Sci U S A. 101, 5339-5346.
43. Nagoshi, E., Saini, C., Bauer, C., Laroche, T., Naef, F., and Schibler, U. (2004) Circadian Gene Expression in Individual Fibroblasts: Cell-Autonomous and Self-Sustained Oscillators Pass Time to Daughter Cells. Cell. 119, 693-705.
44. Welsh, D. K., Yoo, S. H., Liu, A. C., Takahashi, J. S., and Kay, S. A. (2004) Bioluminescence Imaging of Individual Fibroblasts Reveals Persistent, Independently Phased Circadian Rhythms of Clock Gene Expression. Curr Biol. 14, 2289-2295.
46. Gekakis, N., Staknis, D., Nguyen, H. B., Davis, F. C., Wilsbacher, L. D., King, D. P., Takahashi, J. S., and Weitz, C. J. (1998) Role of the CLOCK Protein in the Mammalian Circadian Mechanism. Science. 280, 1564-1569.
47. Preitner, N., Damiola, F., Lopez-Molina, L., Zakany, J., Duboule, D., Albrecht, U., and Schibler, U. (2002) The Orphan Nuclear Receptor REV-ERBalpha Controls Circadian Transcription within the Positive Limb of the Mammalian Circadian Oscillator. Cell. 110, 251-260.
48. Xu, H., Gustafson, C. L., Sammons, P. J., Khan, S. K., Parsley, N. C., Ramanathan, C., Lee, H. W., Liu, A. C., and Partch, C. L. (2015) Cryptochrome 1 Regulates the Circadian Clock through Dynamic Interactions with the BMAL1 C Terminus. Nat Struct Mol Biol. 22, 476-484.
49. Ye, R., Selby, C. P., Chiou, Y. Y., Ozkan-Dagliyan, I., Gaddameedhi, S., and Sancar, A. (2014) Dual Modes of CLOCK:BMAL1 Inhibition Mediated by Cryptochrome and Period Proteins in the Mammalian Circadian Clock. Genes Dev. 28, 1989-1998.
50. Vitaterna, M. H., Selby, C. P., Todo, T., Niwa, H., Thompson, C., Fruechte, E. M., Hitomi, K., Thresher, R. J., Ishikawa, T., Miyazaki, J., Takahashi, J. S., and Sancar, A. (1999) Differential Regulation of Mammalian Period Genes and Circadian Rhythmicity by Cryptochromes 1 and 2. Proc Natl Acad Sci U S A. 96, 12114-12119.
51. Busino, L., Bassermann, F., Maiolica, A., Lee, C., Nolan, P. M., Godinho, S. I., Draetta, G. F., and Pagano, M. (2007) SCFFbxl3 Controls the Oscillation of the Circadian Clock by Directing the Degradation of Cryptochrome Proteins. Science. 316, 900-904.
52. Godinho, S. I., Maywood, E. S., Shaw, L., Tucci, V., Barnard, A. R., Busino, L., Pagano, M., Kendall, R., Quwailid, M. M., Romero, M. R., O'neill, J., Chesham, J. E., Brooker, D., Lalanne, Z., Hastings, M. H., and Nolan, P. M. (2007) The After-Hours Mutant Reveals a Role for Fbxl3 in Determining Mammalian Circadian Period. Science. 316, 897-900.
53. Reischl, S., Vanselow, K., Westermark, P. O., Thierfelder, N., Maier, B., Herzel, H., and Kramer, A. (2007) Beta-TrCP1-Mediated Degradation of PERIOD2 is Essential for Circadian Dynamics. J Biol Rhythms. 22, 375-386.
55. Ueda, H. R., Chen, W., Adachi, A., Wakamatsu, H., Hayashi, S., Takasugi, T., Nagano, M., Nakahama, K., Suzuki, Y., Sugano, S., Iino, M., Shigeyoshi, Y., and Hashimoto, S. (2002) A Transcription Factor Response Element for Gene Expression during Circadian Night. Nature. 418, 534-539.
58. Ukai-Tadenuma, M., Yamada, R. G., Xu, H., Ripperger, J. A., Liu, A. C., and Ueda, H. R. (2011) Delay in Feedback Repression by Cryptochrome 1 is Required for Circadian Clock Function. Cell. 144, 268-281.
59. Fustin, J. M., O'Neill, J. S., Hastings, M. H., Hazlerigg, D. G., and Dardente, H. (2009) Cry1 Circadian Phase in Vitro: Wrapped Up with an E-Box. J Biol Rhythms. 24, 16-24.
60. Liu, A. C., Tran, H. G., Zhang, E. E., Priest, A. A., Welsh, D. K., and Kay, S. A. (2008) Redundant Function of REV-ERBalpha and Beta and Non-Essential Role for Bmal1 Cycling in Transcriptional Regulation of Intracellular Circadian Rhythms. PLoS Genet. 4, e1000023.
61. Ye, R., Selby, C. P., Ozturk, N., Annayev, Y., and Sancar, A. (2011) Biochemical Analysis of the Canonical Model for the Mammalian Circadian Clock. J Biol Chem. 286, 25891-25902.
62. Ye, R., Selby, C. P., Chiou, Y. Y., Ozkan-Dagliyan, I., Gaddameedhi, S., and Sancar, A. (2014) Dual Modes of CLOCK:BMAL1 Inhibition Mediated by Cryptochrome and Period Proteins in the Mammalian Circadian Clock. Genes Dev. 28, 1989-1998.
63. Chiou, Y. Y., Yang, Y., Rashid, N., Ye, R., Selby, C. P., and Sancar, A. (2016) Mammalian Period Represses and De-Represses Transcription by Displacing CLOCK-BMAL1 from Promoters in a Cryptochrome-Dependent Manner. Proc Natl Acad Sci U S A. 113, E6072-E6079.
65. Akashi, M., Okamoto, A., Tsuchiya, Y., Todo, T., Nishida, E., and Node, K. (2014) A Positive Role for PERIOD in Mammalian Circadian Gene Expression. Cell Rep. 7, 1056-1064.
66. Lee, H. M., Chen, R., Kim, H., Etchegaray, J. P., Weaver, D. R., and Lee, C. (2011) The Period of the Circadian Oscillator is Primarily Determined by the Balance between Casein Kinase 1 and Protein Phosphatase 1. Proc Natl Acad Sci U S A. 108, 16451-16456.
67. Partch, C. L., Shields, K. F., Thompson, C. L., Selby, C. P., and Sancar, A. (2006) Posttranslational Regulation of the Mammalian Circadian Clock by Cryptochrome and Protein Phosphatase 5. Proc Natl Acad Sci U S A. 103, 10467-10472.
68. Eide, E. J., Woolf, M. F., Kang, H., Woolf, P., Hurst, W., Camacho, F., Vielhaber, E. L., Giovanni, A., and Virshup, D. M. (2005) Control of Mammalian Circadian Rhythm by CKIepsilon-Regulated Proteasome-Mediated PER2 Degradation. Mol Cell Biol. 25, 2795-2807.
69. Reischl, S., Vanselow, K., Westermark, P. O., Thierfelder, N., Maier, B., Herzel, H., and Kramer, A. (2007) Beta-TrCP1-Mediated Degradation of PERIOD2 is Essential for Circadian Dynamics. J Biol Rhythms. 22, 375-386.
70. Bae, K., Jin, X., Maywood, E. S., Hastings, M. H., Reppert, S. M., and Weaver, D. R. (2001) Differential Functions of mPer1, mPer2, and mPer3 in the SCN Circadian Clock. Neuron. 30, 525-536.
72. Xu, Y., Toh, K. L., Jones, C. R., Shin, J. Y., Fu, Y. H., and Ptacek, L. J. (2007) Modeling of a Human Circadian Mutation Yields Insights into Clock Regulation by PER2. Cell. 128, 59-70.
73. Shearman, L. P., Sriram, S., Weaver, D. R., Maywood, E. S., Chaves, I., Zheng, B., Kume, K., Lee, C. C., van der Horst, G. T., Hastings, M. H., and Reppert, S. M. (2000) Interacting Molecular Loops in the Mammalian Circadian Clock. Science. 288, 1013-1019.
74. Zheng, B., Larkin, D. W., Albrecht, U., Sun, Z. S., Sage, M., Eichele, G., Lee, C. C., and Bradley, A. (1999) The mPer2 Gene Encodes a Functional Component of the Mammalian Circadian Clock. Nature. 400, 169-173.
75. Shearman, L. P., Jin, X., Lee, C., Reppert, S. M., and Weaver, D. R. (2000) Targeted Disruption of the mPer3 Gene: Subtle Effects on Circadian Clock Function. Mol Cell Biol. 20, 6269-6275.
77. Jones, C. R., Campbell, S. S., Zone, S. E., Cooper, F., DeSano, A., Murphy, P. J., Jones, B., Czajkowski, L., and Ptacek, L. J. (1999) Familial Advanced Sleep-Phase Syndrome: A Short-Period Circadian Rhythm Variant in Humans. Nat Med. 5, 1062-1065.
78. Toh, K. L., Jones, C. R., He, Y., Eide, E. J., Hinz, W. A., Virshup, D. M., Ptacek, L. J., and Fu, Y. H. (2001) An hPer2 Phosphorylation Site Mutation in Familial Advanced Sleep Phase Syndrome. Science. 291, 1040-1043.
79. Vanselow, K., Vanselow, J. T., Westermark, P. O., Reischl, S., Maier, B., Korte, T., Herrmann, A., Herzel, H., Schlosser, A., and Kramer, A. (2006) Differential Effects of PER2 Phosphorylation: Molecular Basis for the Human Familial Advanced Sleep Phase Syndrome (FASPS). Genes Dev. 20, 2660-2672.
80. Militi, S., Maywood, E. S., Sandate, C. R., Chesham, J. E., Barnard, A. R., Parsons, M. J., Vibert, J. L., Joynson, G. M., Partch, C. L., Hastings, M. H., and Nolan, P. M. (2016) Early Doors (Edo) Mutant Mouse Reveals the Importance of Period 2 (PER2) PAS Domain Structure for Circadian Pacemaking. Proc Natl Acad Sci U S A. 113, 2756-2761.
|
Science Writers | Eva Marie Y. Moresco |
Illustrators | Katherine Timer |
Authors | Marleen de Groot, Joseph Takahashi |