Phenotypic Mutation 'stevie'

• Allele: stevie
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 95,986,758 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Cngb1
• Gene Name: cyclic nucleotide gated channel beta 1
• Synonym(s): Cngb1b, BC016201, Cngb1
• Chromosomal Location: 95,965,673-96,033,213 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: Homozygous null mice display postnatal lethality, reduced body size and weight, and retinal rod degeneration followed by cone degeneration. Mice homozygous for an allele lacking the calmodulin-binding domain exhibit defective olfactory neural signaling. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000113827] [ENSMUSP00000113750] [ENSMUSP00000112437]
• AlphaFold: E1AZ71
• SMART Domains: Protein: ENSMUSP00000113827; Gene: ENSMUSG00000031789; AA Change: L837P

Domain	Start	End	E-Value	Type
low complexity region	20	46	N/A	INTRINSIC
Pfam:Ion_trans	83	315	9.8e-17	PFAM
cNMP	389	508	4.1e-25	SMART
low complexity region	555	596	N/A	INTRINSIC
low complexity region	599	636	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
  (Using ENSMUST00000119870)
• SMART Domains: Protein: ENSMUSP00000113750; Gene: ENSMUSG00000031789; AA Change: L378P

Domain	Start	End	E-Value	Type
low complexity region	20	46	N/A	INTRINSIC
transmembrane domain	79	101	N/A	INTRINSIC
transmembrane domain	114	136	N/A	INTRINSIC
low complexity region	169	182	N/A	INTRINSIC
cNMP	389	508	4e-25	SMART
low complexity region	555	596	N/A	INTRINSIC
low complexity region	599	636	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
  (Using ENSMUST00000120044)
• SMART Domains: Protein: ENSMUSP00000112437; Gene: ENSMUSG00000031789; AA Change: L378P

Domain	Start	End	E-Value	Type
low complexity region	20	46	N/A	INTRINSIC
transmembrane domain	79	101	N/A	INTRINSIC
transmembrane domain	114	136	N/A	INTRINSIC
low complexity region	169	182	N/A	INTRINSIC
cNMP	389	508	4e-25	SMART
low complexity region	555	596	N/A	INTRINSIC
low complexity region	599	636	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
  (Using ENSMUST00000121162)
• Meta Mutation Damage Score: 0.8606
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:42 PM by Anne Murray
• Record Created: 2016-08-15 6:32 PM
• Record Posted: 2017-05-25
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Rafael Ufret-Vincenty and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001195413 (variant 1), NM_145601 (variant 2); MGI:2664102

Alleles Listed at MGI

All Mutations and Alleles(9) : Gene trapped(3) Targeted(6)

Phenotypic Description

Figure 1. Stevie mice exhibit a reduction in total retina thickness. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Stevie mice exhibit a reduced thickness of the outer retina . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Stevie mice exhibit a reduced thickness of the outer nuclear layer. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The stevie phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2379, some of which showed reduction in total retina thickness (as measured from the basement membrane of the retinal pigment epithelium (RPE) to the internal limiting membrane) (Figure 1), reduced thickness of the outer retina (as measured from the basement membrane of the RPE to the external limiting membrane) (Figure 2), and reduced thickness of the outer nuclear layer of the retina (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the reduced reduced outer nuclear layer thickness using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 62 mutations (X-axis) identified in the G1 male of pedigree R2379. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. All of the above anomalies were linked by continuous variable mapping to two mutations on chromosome 8, one in Cngb1 and the other in Ddx60.  The mutation in Cngb1 is presumed causative because the stevie retina phenotypes mimic other alleles of Cngb1 (see MGI for a list of Cngb1 alleles). The Cngb1 mutation is a T to C transition at base pair 95,260,130 (v38) on chromosome 8, or base pair 46,456 in the GenBank genomic region NC_000074 encoding Cngb1. The strongest association was found with a recessive model of linkage to the reduced outer nuclear layer thickness phenotype, wherein one variant homozygote departed phenotypically from eight homozygous reference mice and eight heterozygous mice with a P value of 2.357 x 10^-12 (Figure 4).  

The mutation corresponds to residue 2,572 in the mRNA sequence NM_001195413 within exon 23 of 33 total exons.

2559 ATCAACCCTCTCCTTCGCCTGCCCCGCTGC 833  -I--N--P--L--L--R--L--P--R--C- (NP_001182342)

The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to proline (P) substitution at position 837 (L837P) in the CNGB1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.998).

Protein Prediction

Figure 5. Domain organization and topology of CNGB1. CNGB1 has six transmembrane (TM) domains, a pore loop domain between the fifth and sixth transmembrane domains, and intracellular N- and C-termini. CNGB1 a large glutamic acid-rich protein (GARP) region in the N-terminal tail. CNGB1 interacts with the C-terminus of the CNGA1 subunit through a region containing the Ca 2+ /CaM binding site. The stevie mutation results in a leucine (L) to proline (P) substitution at position 837 (L837P).

Cngb1 encodes the β subunit of the cyclic nucleotide-gated (CNG)-gated channel (designated as CNGB1) (Figure 5). CNG channels have four subunits around a centrally located pore. The CNG channel is composed three α subunits and one β subunit (1-7). CNG channels can be comprised on four types of α subunits: CNGA1 through CNGA4. CNGA1 is expressed in rod photoreceptor cells of the retina, CNGA3 is expressed in cone photoreceptor cells of the retina, and CNGA2 and CNGA4 are expressed in the olfactory system (1). There are two known β subunit CNG channel proteins: CNGB1 and CNGB3. CNGB1 is found in CNG channels of the rod photoreceptors (CNGB1a) and in the olfactory system (CNGB1b), while CNGB3 is in cone photoreceptor cells (1). The α subunits are able to form functional homomeric channels, but the β subunits only form functional channels when associated with α subunits (8-11).

Each CNG channel subunit has six transmembrane domains, a pore loop domain between the fifth and sixth transmembrane domains, and intracellular N- and C-termini (12;13). The C-terminal tail of the CNG channel subunits have a cyclic nucleotide-binding domain (CNBD) (2).

CNGB1 a large glutamic acid-rich protein (GARP) region in the N-terminal tail (14). The GARP portion of CNGB1 has four consecutive proline-rich repeats, which each have an invariant Trp and a Pro-Gln-Pro triplet separated by nine residues. The proline-rich repeats putatively mediate protein binding. In addition to the GARP, the N-terminal region of CNGB1 has a calcium/calmodulin (Ca²⁺/CaM) binding site (15;16). The GARP region and Ca²⁺/CaM binding site distinguishes CNGB1 from the α subunits. CNGB1 interacts with the C-terminus of the CNGA1 subunit through a region containing the Ca²⁺/CaM binding site (17). Ca²⁺/CaM binding to CNGB1 causes it to uncouple from the CNGA1 subunit (18). In olfactory sensory neurons, Ca²⁺/CaM binding mediates slow response termination and transmitting of the olfactory information to the olfactory bulb.

Cngb1 encodes two isoforms: CNGB1a and CNGB1b. The CNGB1a isoform is expressed in rod photoreceptor cells and contains the GARP region (19;20). The CNGB1b isoform is expressed in the olfactory system, sperm cells, and other tissues. The CNGB1b isoform does not have the GARP region (6;7;21;22). Two soluble GARP proteins of unknown function are encoded by Cngb1: GARP1 and GARP2 (13;20). GARP2 is 32-kDa and is highly expressed in the rod photoreceptor cell outer segments (ROS); GARP1 is 65-kDa and is expressed at very low levels in rod cells. GARP2 binds dark-adapted rod PDE6 and putatively inhibits its activation (14;23). GARP2 and the N-terminus of full-length CNGB1 can both bind peripherin-2 (alternatively, Rds), a protein required for the structural integrity of the ROS (24).

CNG channels are regulated by several factors. Direct binding of intracellular cyclic nucleotides activates the CNG channels (2). CNG channel sensitivity to cGMP is regulated by several factors including calcium and phosphorylation (18). After light adaptation, CNG channel sensitivity is reduced by calcium, which together with CaM binds directly to the CNG channel. Ca²⁺/CaM binding weakens the interaction between CNGB1 and CNGA1, reducing the ability of the channel to open in response cGMP (25;26). Phosphorylation of the CNG subunits also reduces cGMP sensitivity by preventing Ca²⁺/CaM-mediated inhibition and the affinity for cGMP (18;27-29).

The stevie mutation results in a leucine (L) to proline (P) substitution at position 837 (L837P) in the CNGB1a isoform; residue 837 is within the proximity of the transmembrane domains.

Expression/Localization

CNGB1 is expressed in rod photoreceptor cell outer segments (12;13) and in olfactory receptor neurons.

Background

Figure 6. The phototransduction cycle in rod cells. In the dark, opsin is bound to 11-cis-retinal to form inactive rhodopsin (R) in the disc membranes. Basal activity of the guanylyl cyclase (GC) keeps cGMP levels high. The binding of Ca²⁺-bound calmodulin (CaM) confers high affinity for cGMP to cGMP-gated channels in the plasma membrane, allowing these channels to remain open. Both Na⁺ and Ca²⁺ enter the channels resulting in high Ca²⁺ levels and Ca²⁺-bound guanylate cyclase-activing protein (GCAP). Light (hv) results in photoisomerization of 11-cis retinal to all-trans-retinal, forming activated rhodopsin (R*), which binds and activates the heterotrimeric G protein, transducin (αβγ). The GTP-bound transducin α subunit activates cGMP phosphodiesterase (PDE), which hydrolyzes cGMP to GMP, reducing the cGMP concentration and the binding of cGMP to the cGMP-gated channels. The probability of channel closing increases proportional to light intensity, reducing Ca²⁺ influx. Intracellular Ca²⁺ is further depleted by activity of the Na⁺-Ca²⁺, K⁺ exchanger. Low intracellular Ca²⁺ leads to active GCAP, which in turn activates GC to synthesize cGMP from GTP supplied by the guanine nucleotide cycle. This comprises guanylate kinase (GK) and nucleoside diphosphate kinase (NDPK). Release of Ca²⁺ from CaM leads to its dissociation from the cGMP-gated channels, conferring a lower affinity for cGMP and further closure of the channels. 

Figure 7. Olfactory transduction in cilia of olfactory receptor neurons. Odorants bind to odorant receptors (OR) activating a G-protein (G olf ) that in turn stimulates the adenylyl cyclase type III (ACIII). The rise in cAMP opens the CNG channel which passes a depolarizing Na + and Ca 2+ current. Ca 2+ opens a Ca 2+ -activated Cl − channel (ClC Ca ) leading to Cl − efflux which further depolarizes the cell. Ca 2+ binds to calmodulin lowering the cAMP sensitivity of the CNG channel and activating a phosphodiesterase (PDE1C2). Ca 2+ also reduces the activity of ACIII via CaM-kinase II-mediated phosphorylation. Ca 2+ is extruded by a Na + -Ca 2+ exchanger (NCX). Figure and legend adapted from Biel & Michalakis (2009) .

The retina consists of highly specialized, multilayered neuronal tissues that function to perceive and process light signals. The retinal pigment epithelium (RPE) contains parts of the retinoid acid cycle and is involved in the continuous regeneration of visual pigments. The photoreceptor cells are specialized neurons that absorb photons from the field of view and signal this information through a change in membrane potential. Photoreceptors use the aldehyde of Vitamin A1, 11-cis-retinal, as the light-absorbing chromophore bound to opsins that are able to sense different types of light. Cone opsins are low-sensitivity, high-acuity opsins found in cone photoreceptors, while rhodopsin (see the record for Bemr3) is a high-sensitivity, low-acuity opsin that is very sensitive to low levels of light and is used in night vision. Phototransduction is a process by which light is converted into electrical signals in the rod cells, cone cells and photosensitive ganglion cells in the retina. This process is initiated by the absorption of photons and isomerization of 11-cis-retinal into all-trans-retinal, resulting in rhodopsin activation (Figure 6). The first step of the phototransduction cascade is the transitory binding of photoactivated rhodopsin (Rho*) and transducin, a heterotrimeric G protein that alternates between an inactive guanosine diphosphate (GDP) and an active guanosine triphosphate (GTP) bound state. The GDP form of transducin docks onto the Rho* surface, and GDP then dissociates from the complex allowing GTP to bind to transducin. GTP-bound transducin then dissociates from Rho*, interacts with the γ subunits of the cyclic GMP (cGMP) phosphodiesterase PDE6, which activates the catalytic α or β subunits and results in hydrolysis of cGMP. Depletion of cGMP in the ROS results in closure of cGMP-gated channels in the plasma membrane and hyperpolarization of the photoreceptor cell, which prevents the release of neurotransmitters (30). Once activated, rhodopsin can activate hundreds of transducin molecules, each of which in turn activate a phosphodiesterase molecule, which can break down over a thousand cGMP molecules per second (31-33). Hyperpolarization of the rod cell results in continuous function of the plasma membrane Na⁺-Ca²⁺, K⁺ exchanger, which causes Ca²⁺ depletion and results in activation of the Ca²⁺-binding guanylate cyclase activating protein (GCAP). In turn, GCAP activates GC allowing the accelerated synthesis of cGMP from GTP supplied by the guanine nucleotide cycle (31-33).  

Mutations in human CNGB1 have been linked to retinitis pigmentosa 45 [OMIM: #613767; (34)]. Symptoms of retinitis pigmentosa include night blindness, the development of tunnel vision, and an accumulation of retinal pigment-like deposits (35). Mutation-induced rod cell death is followed by secondary cone cell death. The degeneration of both rods and cones results in tertiary degeneration of inner retina neurons (36). 

In addition to visual transduction, CNG channels also function in olfactory transduction (8;10;11;37) (Figure 7). Olfactory sensory neurons convert odor stimuli into electrical signals. Olfactory signal transduction occurs in olfactory sensory neuron cilia. The olfactory CNG channels are open at physiological levels of cAMP. Binding of an ordorant to surface receptors triggers a G protein-coupled cascade, which leads to an increase in the intracellular concentration of cAMP and the subsequent opening of CNG channels and neuron depolarization upon the influx of sodium and calcium (38). The neuron depolarization triggers action potentials that propagate along the olfactory sensory neuron axon to the olfactory bulb in the brain. CNGB1 is required for olfactory transduction and for the ciliary targeting of the olfactory CNG channel (39). In Cngb1^-/- mice, the CNGA2/CNGA4 channel targeted to the plasma membrane of olfactory knobs, but did not traffic to the olfactory cilia (39). The Cngb1^-/- CNG channel was sensitive to proteasome-mediated degradation. The electro-olfactogram responses of the Cngb1^-/- mice were reduced and exhibited a decelerated onset and recovery kinetics compared to wild-type littermates. In addition, the Cngb1^-/- mice exhibited reduced olfactory performance during a behavioral test. The Cngb1^-/- mice had thinner olfactory epithelium and smaller olfactory bulbs then wild-type mice. The Cngb1^-/- mice exhibited delayed weight gain putatively due to reduced olfactory function interfering with nursing and food intake.

Putative Mechanism

The retina from Cngb1^-/- mice did not respond to light and only slight amounts of CNGA1 were found in the rod photoreceptor cell outer segment (12). Electroretinograms (ERGs) of the Cngb1^-/- mice showed a complete loss of rod-mediated responses (12;40). The rod photoreceptors exhibited a slow-progressing degeneration due to apoptosis and retinal gliosis (12). Zhang and colleagues observed a complete loss of rod photoreceptors by three to four months of age in the Cngb1^-/- mice (41). The rod photoreceptor outer segments of the Cngb1^-/- mice showed misalignment and elongated discs (41). The Cngb1^-/- cone photoreceptor cells were primarily unaffected and exhibited normal ERG responses up to six months, but started to degenerate at later ages (12). At one year of age, the Cngb1^-/- retina showed a complete loss of both rod and cone cells (12;41). Rod photoreceptor cell loss is proposed to be due to the increased influx of calcium into the cell (42).

The retina phenotype observed in the stevie mice indicates loss of CNGB1b^stevie function. Reduced body weights were not observed in the stevie mice indicating that some olfactory function may be intact, and that the mutation in stevie may only be affecting the CNGB1a isoform.

Primers

PCR Primer
stevie_pcr_F: CTAACATCAGTAGTCTCTGGATCAG
stevie_pcr_R: TGCCCTGACTATTCTGACTGAG

Sequencing Primer
stevie_seq_F: TCAGAGTCTAATGAGAAATGTCCCC
stevie_seq_R: TCTGACTGAGCTCTCTAGTAGATAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 8, - strand):

1   tgccctgact attctgactg agctctctag tagatagagc catgccccct tagccctcct
61  acccatgagt tctgtgtctt atcccctgcg atgcctgttg ggattttaga tggacctgct
121 ctgcctcctg cccttggact ttctctactt gaaacttggc atcaaccctc tccttcgcct
181 gccccgctgc ctgaaggtaa gattggcagg tccccaaaga cttcggttcc tctgtgcttg
241 acctgaacgc tgccagctgg ggaagggaga gtgtccccaa gaggagaccc tggggaggtg
301 ggtgttctgc aagcatgcct tactaagaag tccattataa ttactggtaa tttgggggac
361 atttctcatt agactctgat ccagagacta ctgatgttag 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Zhong, H., Molday, L. L., Molday, R. S., and Yau, K. W. (2002) The Heteromeric Cyclic Nucleotide-Gated Channel Adopts a 3A:1B Stoichiometry. Nature. 420, 193-198.

  2. Shuart, N. G., Haitin, Y., Camp, S. S., Black, K. D., and Zagotta, W. N. (2011) Molecular Mechanism for 3:1 Subunit Stoichiometry of Rod Cyclic Nucleotide-Gated Ion Channels. Nat Commun. 2, 457.

  3. Zheng, J., Trudeau, M. C., and Zagotta, W. N. (2002) Rod Cyclic Nucleotide-Gated Channels have a Stoichiometry of Three CNGA1 Subunits and One CNGB1 Subunit. Neuron. 36, 891-896.

  4. Weitz, D., Ficek, N., Kremmer, E., Bauer, P. J., and Kaupp, U. B. (2002) Subunit Stoichiometry of the CNG Channel of Rod Photoreceptors. Neuron. 36, 881-889.

  5. Liman, E. R., and Buck, L. B. (1994) A Second Subunit of the Olfactory Cyclic Nucleotide-Gated Channel Confers High Sensitivity to cAMP. Neuron. 13, 611-621.

  6. Sautter, A., Zong, X., Hofmann, F., and Biel, M. (1998) An Isoform of the Rod Photoreceptor Cyclic Nucleotide-Gated Channel Beta Subunit Expressed in Olfactory Neurons. Proc Natl Acad Sci U S A. 95, 4696-4701.

  7. Bonigk, W., Bradley, J., Muller, F., Sesti, F., Boekhoff, I., Ronnett, G. V., Kaupp, U. B., and Frings, S. (1999) The Native Rat Olfactory Cyclic Nucleotide-Gated Channel is Composed of Three Distinct Subunits. J Neurosci. 19, 5332-5347.

  8. Finn, J. T., Grunwald, M. E., and Yau, K. W. (1996) Cyclic Nucleotide-Gated Ion Channels: An Extended Family with Diverse Functions. Annu Rev Physiol. 58, 395-426.

  9. Zagotta, W. N., and Siegelbaum, S. A. (1996) Structure and Function of Cyclic Nucleotide-Gated Channels. Annu Rev Neurosci. 19, 235-263.

  10. Biel, M., Zong, X., Ludwig, A., Sautter, A., and Hofmann, F. (1999) Structure and Function of Cyclic Nucleotide-Gated Channels. Rev Physiol Biochem Pharmacol. 135, 151-171.

  11. Kaupp, U. B., and Seifert, R. (2002) Cyclic Nucleotide-Gated Ion Channels. Physiol Rev. 82, 769-824.

  12. Huttl, S., Michalakis, S., Seeliger, M., Luo, D. G., Acar, N., Geiger, H., Hudl, K., Mader, R., Haverkamp, S., Moser, M., Pfeifer, A., Gerstner, A., Yau, K. W., and Biel, M. (2005) Impaired Channel Targeting and Retinal Degeneration in Mice Lacking the Cyclic Nucleotide-Gated Channel Subunit CNGB1. J Neurosci. 25, 130-138.

  13. Colville, C. A., and Molday, R. S. (1996) Primary Structure and Expression of the Human Beta-Subunit and Related Proteins of the Rod Photoreceptor cGMP-Gated Channel. J Biol Chem. 271, 32968-32974.

  14. Korschen, H. G., Beyermann, M., Muller, F., Heck, M., Vantler, M., Koch, K. W., Kellner, R., Wolfrum, U., Bode, C., Hofmann, K. P., and Kaupp, U. B. (1999) Interaction of Glutamic-Acid-Rich Proteins with the cGMP Signalling Pathway in Rod Photoreceptors. Nature. 400, 761-766.

  15. Grunwald, M. E., Yu, W. P., Yu, H. H., and Yau, K. W. (1998) Identification of a Domain on the Beta-Subunit of the Rod cGMP-Gated Cation Channel that Mediates Inhibition by Calcium-Calmodulin. J Biol Chem. 273, 9148-9157.

  16. Weitz, D., Zoche, M., Muller, F., Beyermann, M., Korschen, H. G., Kaupp, U. B., and Koch, K. W. (1998) Calmodulin Controls the Rod Photoreceptor CNG Channel through an Unconventional Binding Site in the N-Terminus of the Beta-Subunit. EMBO J. 17, 2273-2284.

  17. Trudeau, M. C., and Zagotta, W. N. (2002) An Intersubunit Interaction Regulates Trafficking of Rod Cyclic Nucleotide-Gated Channels and is Disrupted in an Inherited Form of Blindness. Neuron. 34, 197-207.

  18. Krajewski, J. L., Luetje, C. W., and Kramer, R. H. (2003) Tyrosine Phosphorylation of Rod Cyclic Nucleotide-Gated Channels Switches Off Ca2+/calmodulin Inhibition. J Neurosci. 23, 10100-10106.

  19. Chen, T. Y., Peng, Y. W., Dhallan, R. S., Ahamed, B., Reed, R. R., and Yau, K. W. (1993) A New Subunit of the Cyclic Nucleotide-Gated Cation Channel in Retinal Rods. Nature. 362, 764-767.

  20. Korschen, H. G., Illing, M., Seifert, R., Sesti, F., Williams, A., Gotzes, S., Colville, C., Muller, F., Dose, A., and Godde, M. (1995) A 240 kDa Protein Represents the Complete Beta Subunit of the Cyclic Nucleotide-Gated Channel from Rod Photoreceptor. Neuron. 15, 627-636.

  21. Biel, M., Zong, X., Ludwig, A., Sautter, A., and Hofmann, F. (1996) Molecular Cloning and Expression of the Modulatory Subunit of the Cyclic Nucleotide-Gated Cation Channel. J Biol Chem. 271, 6349-6355.

  22. Wiesner, B., Weiner, J., Middendorff, R., Hagen, V., Kaupp, U. B., and Weyand, I. (1998) Cyclic Nucleotide-Gated Channels on the Flagellum Control Ca2+ Entry into Sperm. J Cell Biol. 142, 473-484.

  23. Pentia, D. C., Hosier, S., and Cote, R. H. (2006) The Glutamic Acid-Rich Protein-2 (GARP2) is a High Affinity Rod Photoreceptor Phosphodiesterase (PDE6)-Binding Protein that Modulates its Catalytic Properties. J Biol Chem. 281, 5500-5505.

  24. Poetsch, A., Molday, L. L., and Molday, R. S. (2001) The cGMP-Gated Channel and Related Glutamic Acid-Rich Proteins Interact with Peripherin-2 at the Rim Region of Rod Photoreceptor Disc Membranes. J Biol Chem. 276, 48009-48016.

  25. Trudeau, M. C., and Zagotta, W. N. (2002) Mechanism of calcium/calmodulin Inhibition of Rod Cyclic Nucleotide-Gated Channels. Proc Natl Acad Sci U S A. 99, 8424-8429.

  26. Trudeau, M. C., and Zagotta, W. N. (2003) Calcium/calmodulin Modulation of Olfactory and Rod Cyclic Nucleotide-Gated Ion Channels. J Biol Chem. 278, 18705-18708.

  27. Molokanova, E., Maddox, F., Luetje, C. W., and Kramer, R. H. (1999) Activity-Dependent Modulation of Rod Photoreceptor Cyclic Nucleotide-Gated Channels Mediated by Phosphorylation of a Specific Tyrosine Residue. J Neurosci. 19, 4786-4795.

  28. Molokanova, E., Trivedi, B., Savchenko, A., and Kramer, R. H. (1997) Modulation of Rod Photoreceptor Cyclic Nucleotide-Gated Channels by Tyrosine Phosphorylation. J Neurosci. 17, 9068-9076.

  29. Molokanova, E., Krajewski, J. L., Satpaev, D., Luetje, C. W., and Kramer, R. H. (2003) Subunit Contributions to Phosphorylation-Dependent Modulation of Bovine Rod Cyclic Nucleotide-Gated Channels. J Physiol. 552, 345-356.

  30. Ardell, M. D., Aragon, I., Oliveira, L., Porche, G. E., Burke, E., and Pittler, S. J. (1996) The Beta Subunit of Human Rod Photoreceptor cGMP-Gated Cation Channel is Generated from a Complex Transcription Unit. FEBS Lett. 389, 213-218.

  31. Ridge, K. D., and Palczewski, K. (2007) Visual Rhodopsin Sees the Light: Structure and Mechanism of G Protein Signaling. J Biol Chem. 282, 9297-9301.

  32. Ridge, K. D., Abdulaev, N. G., Sousa, M., and Palczewski, K. (2003) Phototransduction: Crystal Clear. Trends Biochem Sci. 28, 479-487.

  33. Cai, X., Conley, S. M., and Naash, M. I. (2009) RPE65: Role in the Visual Cycle, Human Retinal Disease, and Gene Therapy. Ophthalmic Genet. 30, 57-62.

  34. Bareil, C., Hamel, C. P., Delague, V., Arnaud, B., Demaille, J., and Claustres, M. (2001) Segregation of a Mutation in CNGB1 Encoding the Beta-Subunit of the Rod cGMP-Gated Channel in a Family with Autosomal Recessive Retinitis Pigmentosa. Hum Genet. 108, 328-334.

  35. Hims, M. M., Diager, S. P., and Inglehearn, C. F. (2003) Retinitis Pigmentosa: Genes, Proteins and Prospects. Dev Ophthalmol. 37, 109-125.

  36. Sancho-Pelluz, J., Arango-Gonzalez, B., Kustermann, S., Romero, F. J., van Veen, T., Zrenner, E., Ekstrom, P., and Paquet-Durand, F. (2008) Photoreceptor Cell Death Mechanisms in Inherited Retinal Degeneration. Mol Neurobiol. 38, 253-269.

  37. Matulef, K., and Zagotta, W. N. (2003) Cyclic Nucleotide-Gated Ion Channels. Annu Rev Cell Dev Biol. 19, 23-44.

  38. Zufall, F., and Munger, S. D. (2001) From Odor and Pheromone Transduction to the Organization of the Sense of Smell. Trends Neurosci. 24, 191-193.

  39. Michalakis, S., Reisert, J., Geiger, H., Wetzel, C., Zong, X., Bradley, J., Spehr, M., Huttl, S., Gerstner, A., Pfeifer, A., Hatt, H., Yau, K. W., and Biel, M. (2006) Loss of CNGB1 Protein Leads to Olfactory Dysfunction and Subciliary Cyclic Nucleotide-Gated Channel Trapping. J Biol Chem. 281, 35156-35166.

  40. Zhang, Y., Rubin, G. R., Fineberg, N., Huisingh, C., McGwin, G., Pittler, S. J., and Kraft, T. W. (2012) Age-Related Changes in Cngb1-X1 Knockout Mice: Prolonged Cone Survival. Doc Ophthalmol. 124, 163-175.

  41. Zhang, Y., Molday, L. L., Molday, R. S., Sarfare, S. S., Woodruff, M. L., Fain, G. L., Kraft, T. W., and Pittler, S. J. (2009) Knockout of GARPs and the Beta-Subunit of the Rod cGMP-Gated Channel Disrupts Disk Morphogenesis and Rod Outer Segment Structural Integrity. J Cell Sci. 122, 1192-1200.

  42. Paquet-Durand, F., Beck, S., Michalakis, S., Goldmann, T., Huber, G., Muhlfriedel, R., Trifunovic, D., Fischer, M. D., Fahl, E., Duetsch, G., Becirovic, E., Wolfrum, U., van Veen, T., Biel, M., Tanimoto, N., and Seeliger, M. W. (2011) A Key Role for Cyclic Nucleotide Gated (CNG) Channels in cGMP-Related Retinitis Pigmentosa. Hum Mol Genet. 20, 941-947.