Mutagenetix > Phenotypic Mutation

Phenotypic Mutation 'dorian_gray' (pdf version)

Allele

dorian_gray

Mutation Type

unclassified

Chromosome

Coordinate

46,784,145 bp (GRCm38)

Base Change

T ⇒ A (forward strand)

Gene

Hps5

Gene Name

HPS5, biogenesis of lysosomal organelles complex 2 subunit 2

Synonym(s)

Hermansky-Pudlak syndrome 5, ru-2, ru2, ruby eye 2

Chromosomal Location

46,409,890-46,445,488 bp (-) (GRCm39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 6 protein and may interact with the cytoplasmic domain of integrin, alpha-3. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 5. Multiple transcript variants encoding two distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes have hypopigmented eyes and hair, impaired secretion of lysosomal enzymes by renal proximal tubules and reduced clotting due to a platelet dense granule defect. Homozygotes for one allele are less susceptible to diet-induced atherosclerosis. [provided by MGI curators]

Accession Number

NCBI RefSeq: NM_001005247; MGI: 2180307

Mapped

Yes

Amino Acid Change

Institutional Source

Beutler Lab

Gene Model

not available

AlphaFold

P59438

SMART Domains

Protein: ENSMUSP00000014562
Gene: ENSMUSG00000014418

Domain	Start	End	E-Value	Type
SCOP:d1jjub_	44	192	3e-8	SMART
Blast:WD40	63	103	7e-21	BLAST
Blast:WD40	111	151	1e-19	BLAST
low complexity region	429	449	N/A	INTRINSIC
low complexity region	775	786	N/A	INTRINSIC
low complexity region	989	998	N/A	INTRINSIC
low complexity region	1021	1033	N/A	INTRINSIC

Predicted Effect

probably benign

SMART Domains

Protein: ENSMUSP00000103280
Gene: ENSMUSG00000014418

Domain	Start	End	E-Value	Type
SCOP:d1jjub_	44	192	3e-8	SMART
Blast:WD40	63	103	6e-21	BLAST
Blast:WD40	111	151	1e-19	BLAST
low complexity region	396	416	N/A	INTRINSIC
low complexity region	742	753	N/A	INTRINSIC
low complexity region	956	965	N/A	INTRINSIC
low complexity region	988	1000	N/A	INTRINSIC

Predicted Effect

probably benign

SMART Domains

Protein: ENSMUSP00000103281
Gene: ENSMUSG00000014418

Domain	Start	End	E-Value	Type
SCOP:d1jjub_	44	192	3e-8	SMART
Blast:WD40	63	103	7e-21	BLAST
Blast:WD40	111	151	1e-19	BLAST
low complexity region	429	449	N/A	INTRINSIC
low complexity region	775	786	N/A	INTRINSIC
low complexity region	989	998	N/A	INTRINSIC
low complexity region	1021	1033	N/A	INTRINSIC

Predicted Effect

probably benign

SMART Domains

Protein: ENSMUSP00000116770
Gene: ENSMUSG00000014418

Domain	Start	End	E-Value	Type
SCOP:d1tbga_	24	107	5e-4	SMART
Blast:WD40	63	103	1e-22	BLAST

Predicted Effect

probably benign

SMART Domains

Protein: ENSMUSP00000122887
Gene: ENSMUSG00000014418

Domain	Start	End	E-Value	Type
SCOP:d1jjub_	44	192	8e-8	SMART
Blast:WD40	63	103	9e-20	BLAST
Blast:WD40	111	151	2e-19	BLAST
low complexity region	429	449	N/A	INTRINSIC

Predicted Effect

probably benign

SMART Domains

Protein: ENSMUSP00000115786
Gene: ENSMUSG00000014418

Domain	Start	End	E-Value	Type
SCOP:d1jjub_	44	192	2e-8	SMART
Blast:WD40	63	103	1e-21	BLAST
Blast:WD40	111	151	2e-20	BLAST

Predicted Effect

probably benign

Predicted Effect

probably benign

Predicted Effect

probably benign

Meta Mutation Damage Score

Not available question?

Is this an essential gene?

Probably nonessential (E-score: 0.113) question?

Phenotypic Category

Autosomal Recessive

Candidate Explorer Status

loading ...

Single pedigree
Linkage Analysis Data

Penetrance

100%

Alleles Listed at MGI

All alleles(62) : Gene trapped(53) Spontaneous(6) Chemically induced(3)

Lab Alleles

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Hps5	APN	7	46425362	missense	probably damaging	1.00
IGL00543:Hps5	APN	7	46427497	missense	probably benign	0.37
IGL01090:Hps5	APN	7	46437751	missense	probably benign	0.02
IGL01351:Hps5	APN	7	46410856	missense	probably damaging	1.00
IGL01479:Hps5	APN	7	46412366	critical splice donor site	probably null
IGL02056:Hps5	APN	7	46437606	missense	probably damaging	1.00
IGL02117:Hps5	APN	7	46432940	missense	probably damaging	1.00
IGL02210:Hps5	APN	7	46435994	missense	probably benign	0.03
IGL02967:Hps5	APN	7	46418804	missense	possibly damaging	0.69
IGL03046:Hps5	APN	7	46426463	splice site	probably benign
IGL03187:Hps5	APN	7	46422631	missense	probably damaging	1.00
IGL03259:Hps5	APN	7	46412526	missense	probably damaging	0.99
smoky	UTSW	7	46418775	nonsense	probably null
Titan	UTSW	7	46432893	critical splice donor site	probably null
toffee	UTSW	7	46777075	intron	probably benign
wombat	UTSW	7	46433058	missense	probably damaging	1.00
R0068:Hps5	UTSW	7	46426466	splice site	probably benign
R0068:Hps5	UTSW	7	46426466	splice site	probably benign
R0141:Hps5	UTSW	7	46438605	missense	probably damaging	1.00
R0383:Hps5	UTSW	7	46418712	splice site	probably null
R0402:Hps5	UTSW	7	46440333	splice site	probably benign
R0684:Hps5	UTSW	7	46432893	critical splice donor site	probably null
R1159:Hps5	UTSW	7	46421978	splice site	probably null
R1938:Hps5	UTSW	7	46422691	missense	probably damaging	1.00
R2058:Hps5	UTSW	7	46417475	missense	probably damaging	1.00
R3613:Hps5	UTSW	7	46426298	critical splice donor site	probably null
R3881:Hps5	UTSW	7	46421420	missense	possibly damaging	0.54
R3882:Hps5	UTSW	7	46421420	missense	possibly damaging	0.54
R3914:Hps5	UTSW	7	46432950	missense	probably damaging	1.00
R4095:Hps5	UTSW	7	46425218	missense	probably benign	0.01
R4457:Hps5	UTSW	7	46433037	missense	probably benign	0.00
R4739:Hps5	UTSW	7	46436013	missense	probably benign
R4838:Hps5	UTSW	7	46437778	missense	probably damaging	1.00
R4934:Hps5	UTSW	7	46418775	nonsense	probably null
R5876:Hps5	UTSW	7	46438620	missense	probably damaging	1.00
R6056:Hps5	UTSW	7	46416521	missense	probably benign	0.00
R6129:Hps5	UTSW	7	46421198	missense	probably benign
R6878:Hps5	UTSW	7	46433058	missense	probably damaging	1.00
R7912:Hps5	UTSW	7	46418826	missense	probably benign	0.15
R7977:Hps5	UTSW	7	46418475	missense	probably benign	0.03
R7987:Hps5	UTSW	7	46418475	missense	probably benign	0.03
R8131:Hps5	UTSW	7	46421312	missense	probably benign	0.00
R8243:Hps5	UTSW	7	46436066	missense	probably damaging	1.00
R8245:Hps5	UTSW	7	46418485	nonsense	probably null
R8878:Hps5	UTSW	7	46421345	missense	probably benign	0.07
R9050:Hps5	UTSW	7	46422607	missense	probably benign	0.00
R9186:Hps5	UTSW	7	46438370	missense	probably damaging	1.00
R9278:Hps5	UTSW	7	46440397	missense	probably benign	0.00
R9290:Hps5	UTSW	7	46424331	missense	probably damaging	0.97
R9303:Hps5	UTSW	7	46438619	missense	possibly damaging	0.94
R9305:Hps5	UTSW	7	46438619	missense	possibly damaging	0.94
R9650:Hps5	UTSW	7	46425354	missense	probably damaging	1.00
X0021:Hps5	UTSW	7	46412517	missense	probably damaging	1.00

Mode of Inheritance

Autosomal Recessive

Local Stock

Sperm, gDNA

Repository

none

Last Updated

2019-06-25 6:42 PM by Diantha La Vine

Record Created

unknown

Record Posted

2008-06-03

Phenotypic Description

The dorian gray phenotype was identified among ENU-mutagenized G3 mutant mice by their hypopigmented fur (Figure 1). Dorian gray is allelic to toffee and to the ruby-eye 2 strain (1;2).

Unlike susceptible toffee mice, dorian gray animals have not been tested for susceptibility to mouse cytomegalovirus (MCMV; MCMV Susceptibility and Resistance Screen) or Listeria monocytogenes.

Nature of Mutation

The dorian gray mutation was mapped to Chromosome 7, and corresponds to an A to T transversion at position 2337 of the Hps5 transcript, in exon 16 of 23 total exons.

2322 GGTGAGACAGAAAAGAGAGTATTAGATGAAGAG

675 -G--E--T--E--K--R--V--L--D--E--E-

The mutated nucleotide is indicated in red lettering, and changes the arginine at codon 680 to a stop codon.

Illustration of Mutations in
Gene & Protein

Protein Prediction

Figure 1. A, Predicted domains of HPS5. HPS5 contains two putative WD40 domains located at amino acids 65-105 and 113-153. The dorian gray mutation changes the arginine at codon 680 to a stop codon. Click on the image to view other mutations found in HPS5. Click on each mututation for more specific information. B, Components of the biogenesis of lysosomal-related organelle complex 2 (BLOC-2). All three proteins have been shown to co-immunoprecipitate, but only HSP5 and HSP6 bind together in two-hybrid studies suggesting the presence of unknown components of the complex (?). Figure is adapted from (34). This image is interactive.

The dorian gray mutation results in protein truncation in exon 16. It is unknown whether normal levels of the altered HPS5 protein exist in dorian gray mice or whether this protein is localized appropriately. HSP5 is a component of the biogenesis of lysosome-related organelle complex 2 (BLOC-2; see Figure 2).

Please see the record for toffee for information about Hps5.

Putative Mechanism

The dorian gray mutation causes premature truncation of the HPS5 protein in exon 16 leaving more than half of the protein intact. The truncated protein may localize appropriately and retain some function, but this possibility has not been tested. The hypopigmentation of dorian gray mutants is consistent with the putative role of HPS5 in the trafficking of the melanogenic enzyme tyrosinase-related protein 1 (Tyrp1) (3,4).

For a further explanation of the dorian gray mutant phenotype, please refer to the record for toffee.

Primers

Primers cannot be located by automatic search.

Genotyping

Dorian gray genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.

Primers for PCR amplification

Dor (F): 5’- TAATGCTGTCTGGCCTGTCAGCTC -3’

Dor(R): 5’- CGAAGATGCCATGATGAAACCCCTTAC -3’

PCR program

1) 95°C 2:00

2) 95°C 0:30

3) 56°C 0:30

4) 72°C 1:00

5) repeat steps (2-4) 29X

6) 72°C 7:00

7) 4°C ∞

Primers for sequencing

Dor_seq(F): 5’- TAGGACCAAGTTATTGGACCCTC -3’

Dor_seq(R): 5’- CATGATGAAACCCCTTACTTTCTATG -3’

The following sequence of 1443 nucleotides (from Genbank genomic region NC_000073 for linear genomic sequence of Hps5) is amplified:

22873 taatgctg tctggcctgt cagctctagg atgtgctatt gcttgatgaa
22921 ttagaacaga atatttaatg aagatacggg ttgatgggga gtgacaggga gactctttaa
22981 ggcaatgcaa catgaaacat acttgccatt tagtaagtac tagaagtctt ggtcttaaga
23041 aagctttgaa caaacaaaaa aaaagacaaa ataagaaagc tttggttgcc cctattgcct
23101 gtgagtagga ttctttcttt ttcatgcttt tctagggaga aagaaattca tcaacctcct
23161 aaagaagaca ggcttcaaga actcacagca gcgacagcag aagcaatgtg agtgtggaag
23221 gtctacagtg cgtgggggtg gcctttgcac tgcatctgca ctggtcttga ctgtctaggt
23281 cagaggtagc ctcatttgca atggatgttc caaaattagt aacgtgctcc agggtcagtg
23341 ttgtctgcct tgtaggcttg caggaaaatt gtcatttaaa atgctcaaaa gcaacattta
23401 ttctatatga gtatgcttta atcagttaag tttgtttaaa ttgtttaaaa aaaaaaaaaa
23461 caaatgaaac aactttacat tcatctcttt tatataggac caagttattg gaccctctgg
23521 ttctgtttga gcccaaggtg ctaagaatgg ttttacttga gtggctttca cagttagaga
23581 aaacatttgc catgaaagac ttccccggca tttccaatac cagcagtcca accgtgaaat
23641 caaacttggg tgcacacctc ctcggtgaga cagaaaagag agtattagat gaagagagtg
23701 gagaaggaag aagggtctct ttagtcactg aagaagctgg aggtcagata acctgtgacc
23761 ctgtaagcaa cctcagtgag ccctcggctg accgttttcg agtatgctct ccatacgcca
23821 tcacaaacag ccttcagagg gacctggcgg aattgacaac gttgtgcttg gaactgaatg
23881 tgttgacttc agcaatggaa agcgtaggtg ggcatgtgga ccgggcttca cagcagctct
23941 ctccagaaat cctggcttgt cgtttcctaa agaagtactt ttttcttctg gacttgaaaa
24001 gagcaaagga gagtatcaag ctcacttacg acagcccttg cgtttgggac acttttgtcg
24061 aaggactaaa aggtaactat caggtggcat tgccaaatgt agaggtattt tataatgtgg
24121 gcacttgaca aaagatttgg ctagaactct ctgtctggcc agactctctt ctgttttcta
24181 ctcaactctt ttaaaaaaat acgtatttgt atgtatgtgt gtatgcctct gatacatgaa
24241 aatacacact aatcataaat gaagttactt tttacattaa catagaaagt aaggggtttc
24301 atcatggcat cttcg

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red.

References

1. Eicher, E. M. (1970) The Position of ru-2 and qv with Respect to the FLECKED Translocation in the Mouse, Genetics 64, 495-510.

2. Lilly, F. (1966) The genetic basis of susceptibility and resistance of mice to the Gross and Friend leukemia viruses, Mouse News Lett 34, 14.

3. Di Pietro, S. M., Falcon-Perez, J. M., Tenza, D., Setty, S. R., Marks, M. S., Raposo, G., and Dell'angelica, E. C. (2006) BLOC-1 interacts with BLOC-2 and the AP-3 complex to facilitate protein trafficking on endosomes, Mol. Biol. Cell 17, 4027-4038.

4. Setty, S. R., Tenza, D., Truschel, S. T., Chou, E., Sviderskaya, E. V., Theos, A. C., Lamoreux, M. L., Di Pietro, S. M., Starcevic, M., Bennett, D. C., Dell'angelica, E. C., Raposo, G., and Marks, M. S. (2007) BLOC-1 is required for cargo-specific sorting from vacuolar early endosomes toward lysosome-related organelles, Mol. Biol. Cell 18, 768-780.

5. Wei, M. L. (2006) Hermansky-Pudlak syndrome: a disease of protein trafficking and organelle function, Pigment Cell Res. 19, 19-42.

Science Writers

Nora G. Smart

Illustrators

Diantha La Vine

Authors

Amanda L. Blasius, Bruce Beutler

Edit History

	Diantha La Vine	2011-08-08 3:13 PM (current)
	Eva Marie Y. Moresco	2011-01-07 9:04 AM
	Diantha La Vine	2010-10-05 4:04 PM
	Diantha La Vine	2010-10-05 4:04 PM
	Diantha La Vine	2010-10-05 2:38 PM
	Eva Marie Y. Moresco	2010-02-03 5:29 PM