Phenotypic Mutation 'twerk' (pdf version)
List |< first << previous [record 2 of 17] next >> last >|
Alleletwerk
Mutation Type missense
Chromosome10
Coordinate60,300,851 bp (GRCm38)
Base Change T ⇒ G (forward strand)
Gene Psap
Gene Name prosaposin
Synonym(s) SGP-1
Chromosomal Location 60,277,627-60,302,597 bp (+)
MGI Phenotype FUNCTION: This gene encodes a multifunctional glycoprotein that plays a role in the intracellular metabolism of various sphingolipids or secreted into the plasma, milk or cerebrospinal fluid. The encoded protein undergoes proteolytic processing to generate four different polypeptides known as saposin A, B, C or D, that are required for the hydrolysis of certain sphingolipids by lysosomal hydrolases. Alternately, the encoded protein is secreted into body fluids where it exhibits neurotrophic and myelinotrophic activities. A complete lack of the encoded protein is fatal to mice either at the neonatal stage or within the first month due to severe leukodystrophy and sphingolipid accumulation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature saposins. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation die either neonatally or around 7 weeks. At 30 days, mutants show hypomyelination, PAS-positive material in the nervous system, and accumulation of ceramides in brain, liver, and kidney. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001146120 (variant 1), NM_011179 (variant 2), NM_001146121 (variant 3), NM_001146122 (variant 4), NM_001146123 (variant 5), NM_001146124 (variant 6); MGI:97783

Mapped Yes 
Amino Acid Change Cysteine changed to Tryptophan
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000004316] [ENSMUSP00000072973] [ENSMUSP00000101101] [ENSMUSP00000101102] [ENSMUSP00000101103] [ENSMUSP00000101104] [ENSMUSP00000101105] [ENSMUSP00000126407] [ENSMUSP00000137286] [ENSMUSP00000137476]
SMART Domains Protein: ENSMUSP00000004316
Gene: ENSMUSG00000004207
AA Change: C535W

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 272 1.2e-16 SMART
SapB 314 389 2.07e-20 SMART
low complexity region 412 430 N/A INTRINSIC
SapB 439 514 3.84e-24 SMART
SAPA 523 556 3.19e-22 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000004316)
SMART Domains Protein: ENSMUSP00000101105
Gene: ENSMUSG00000004207
AA Change: C533W

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 270 2.76e-16 SMART
SapB 312 387 2.07e-20 SMART
low complexity region 410 428 N/A INTRINSIC
SapB 437 512 3.84e-24 SMART
SAPA 521 554 3.19e-22 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000105465)
SMART Domains Protein: ENSMUSP00000126407
Gene: ENSMUSG00000004207
AA Change: C530W

DomainStartEndE-ValueType
SAPA 18 51 1.4e-18 SMART
SapB 58 135 1.87e-27 SMART
SapB 192 267 2.76e-16 SMART
SapB 309 384 2.07e-20 SMART
low complexity region 407 425 N/A INTRINSIC
SapB 434 509 3.84e-24 SMART
SAPA 518 551 3.19e-22 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000165878)
SMART Domains Protein: ENSMUSP00000137286
Gene: ENSMUSG00000004207
AA Change: C536W

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 273 2.37e-15 SMART
SapB 315 390 2.07e-20 SMART
low complexity region 413 431 N/A INTRINSIC
SapB 440 515 3.84e-24 SMART
SAPA 524 557 3.19e-22 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000177779)
SMART Domains Protein: ENSMUSP00000137476
Gene: ENSMUSG00000004207
AA Change: C536W

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 273 8.5e-17 SMART
SapB 315 390 2.07e-20 SMART
low complexity region 413 431 N/A INTRINSIC
SapB 440 515 3.84e-24 SMART
SAPA 524 557 3.19e-22 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000179238)
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological 17353235
fasting hyperglycemia
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(16) : Chemically induced (other)(1) Gene trapped(4) Radiation induced(1) Targeted(10)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Psap APN 10 60292536 missense probably damaging 1.00
IGL01100:Psap APN 10 60299929 missense probably benign 0.03
IGL01122:Psap APN 10 60299474 missense probably benign 0.04
IGL02544:Psap APN 10 60300626 splice site probably benign
R0591:Psap UTSW 10 60300855 missense possibly damaging 0.65
R0624:Psap UTSW 10 60299566 splice site probably benign
R1018:Psap UTSW 10 60300811 missense probably damaging 1.00
R1896:Psap UTSW 10 60295046 nonsense probably null
R3161:Psap UTSW 10 60277753 missense possibly damaging 0.95
R3162:Psap UTSW 10 60277753 missense possibly damaging 0.95
R3162:Psap UTSW 10 60277753 missense possibly damaging 0.95
R3615:Psap UTSW 10 60294603 missense probably benign 0.06
R3616:Psap UTSW 10 60294603 missense probably benign 0.06
R4622:Psap UTSW 10 60300851 missense probably damaging 1.00
R4623:Psap UTSW 10 60300851 missense probably damaging 1.00
R4666:Psap UTSW 10 60300545 missense probably benign
R5131:Psap UTSW 10 60299957 missense possibly damaging 0.72
R5203:Psap UTSW 10 60294975 missense probably damaging 1.00
R5251:Psap UTSW 10 60301700 missense probably damaging 0.99
R5511:Psap UTSW 10 60299180 missense possibly damaging 0.51
R5764:Psap UTSW 10 60293406 missense probably benign 0.18
R6207:Psap UTSW 10 60300538 missense probably damaging 1.00
X0019:Psap UTSW 10 60299915 missense probably damaging 0.96
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 2018-11-16 2:56 PM by Anne Murray
Record Created 2016-08-16 2:37 PM by Jamie Russell
Record Posted 2018-11-16
Phenotypic Description
Figure 1. The phenotype of the twerk mice.

The twerk phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4622, some of which exhibited ataxia (Figure 1).

 

Nature of Mutation

Figure 2. Linkage mapping of the ataxia phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 102 mutations (X-axis) identified in the G1 male of pedigree R4622. Binary data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 102 mutations. The ataxia phenotype was attributed to a mutation in Psap; mutations in Psap are known to cause ataxia (see MGI). The mutation in Psap is a T to G transversion at base pair 60,300,851 (v38) on chromosome 10, or base pair 23,224 in the GenBank genomic region NC_000076 encoding Psap. Linkage was found with a recessive model of inheritance, wherein two homozygous variant mice departed phenotypically from eight homozygous reference mice and nine heterozygous mice with a P value of 0.002881 (Figure 2).   

 

The mutation corresponds to residue 1,714 in the mRNA sequence NM_001146120 within exon 13 of 14 total exons.

 

1697 GGCCCTAGCTACTGGTGTCAGAACATGGAGACT

528  -G--P--S--Y--W--C--Q--N--M--E--T-

 

The mutated nucleotide is indicated in red. The mutation results in a cysteine to tryptophan substitution at amino acid 533 (C533W) in the PSAP protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 3. Domain organization of PSAP. The twerk mutation results in a cysteine to tryptophan substitution at amino acid 533 within in a saposin A-type domain. Domain information is from SMART and UniProt.

Psap encodes prosaposin (PSAP; alternatively, spingolipid activator protein 1 [SAP1], SAP2, or sulfated glycoprotein 1 [SGP-1]). PSAP is a precursor protein for four lysosomal activator proteins: saposin A through D (Figure 3) (1). The saposins remodel lysosomal membranes to promote the extraction of substrate lipids (i.e., sphingolipids) from the membranes for presentation to hydrolase enzymes (1-4). Each of the saposins exhibit unique substrate specificity. Saposin A and C stimulate the hydrolysis of glucosylceramide by beta-glucosylceramidase. Saposin B stimulates the hydrolysis of galactocerebroside sulfate by arylsulfatase A, GM1 (monosialotetrahexosylganglioside) gangliosides by beta-galactosidase, and globotriaosylceramide by alpha-galactosidase A. Saposin-D is a specific sphingomyelin phosphodiesterase activator.

 

The four saposins are approximately 80-amino acids in length and are structurally similar, with each sharing the placement of six cysteines, a glycosylation site, and two conserved prolines in identical positions (1;5). Each saposin is highly structured and rich in a-helical regions (5). Saposin A, C, and D putatively form triple helix structures that are stabilized by disulfide linkages (6;7). The first 24-amino acids of saposin B are putatively in a b-sheet configuration, but the comparable region in the other saposins is helical (5).

 

The twerk mutation results in a cysteine to tryptophan substitution at amino acid 533; Cys533 is within in a saposin A-type domain (SMART) following the saposin D peptide. The saposin A-type domain putatively regulates protein targeting.

Expression/Localization

PSAP can be secreted into the extracellular space; PSAP secretion is increased under conditions of injury and stress. PSAP can subsequently be re-uptaken by the same cell or by neighboring cells (8;9). Saposins are expressed in most tissues, including liver, spleen, brain, placenta, and saliva (1). The saposins are processed from PSAP in the late endosome and lysosome; mature saposins are localized to lysosomes (1;5).

Background
Figure 4. PSAP initiates pro-survival signaling pathways in neurons and glia. Secreted PSAP binds to GPR37 and GPR37L1, initiating survivial signaling. Cellular uptake of PSAP is mediated by LRP1 on the cell surface. In normal conditions, sortillin targets oligomerized PSAP for lysosomal degradation. Upon stress, PSAP is excreted from the cell via exocytosis. 

PSAP can be secreted into cerebrospinal fluid, semen, milk, pancreatic juice, and bile (10). PSAP is re-uptaken into cells by the endocytic receptor LRP-1. Secreted PSAP can function as a neurotrophic factor that promotes cell survival, neurite outgrowth, and differentiation (Figure 4) (11;12). Secreted PSAP activates G protein pathways to protect neurons and glia by stimulating two orphan G protein-coupled receptors: GPR37 and GPR37L1 (13). GPR37 and GPR37L1 are mainly expressed in neurons and glia of the nervous system where they putatively protect cells from oxidative stress and cell death (13-15).

 

PSAP stimulates ERK and Akt phosphorylation in several cell types. PSAP-stimulated ERK phosphorylation promoted proliferation, survival, migration, and invasion of cancer cells (16), prevented oxidative cell death in PC12 cells (17), and promoted cell cycle progression in PC12 cells (18). PSAP-stimulated Akt phosphorylation promoted Schwann cell survival (19), prevented oxidative cell death in PC12 cells (17), and protected prostate cancer cells from apoptosis (20).

 

Loss of (pro)saposin function is linked to several human lysosomal storage diseases including atypical Krabbe disease (OMIM:#611722; alternatively, globoid cell leukodystrophy [GLD]) (21), atypical Gaucher disease [OMIM:#610539;(22-25)], and metachromatic leukodystrophy due to saposin B deficiency [OMIM:#249900; (26-29)]. Patients with atypical Krabbe disease, atypical Gaucher disease, and metachromatic leukodystrophy show neurological defects, including transient losses of consciousness, myoclonic jerks, and generalized seizures (21;24;27). Mutations in PSAP are also linked to combined saposin deficiency (OMIM:#611721; alternatively, posaposin deficiency; (30-32)). Patients with combined saposin deficiency showed respiratory insufficiency, hepatosplenomegaly, and neurological disease as well as storage cells in the bone marrow and elevated levels of glucosylceramide and ceramide in the liver (30;31).

 

PSAP-deficient (PSAP-/-) mice exhibit increased rates of embryonic and neonatal lethality (33-35). Surviving mice showed smaller body sizes than wild-type littermates, head tremors, and weakness/ataxia of the hind legs (33;36). The mice showed intermittent seizures by postnatal day 30 that progressed to continual tonic status epilepticus. The PSAP-/- mice showed reduced hearing at postnatal day 19, but deafness by postnatal day 25 due to a loss of outer hair cells from the cochlear apex, vacuolization of the outer hair cells, and cellular hypertrophy in the region of the inner hair cells (37). The mice had dystrophic axons, neuronal storage, hypomyelination, and myelin degeneration. The mice died by approximately postnatal day 35 (33;36). The brains, liver, and kidneys from the PSAP-/- brain showed lactosylceramide accumulation. The PSAP-/- testis size was decreased with reduced spermiogenesis, and the prostate, seminal vesicle, and epididymis of the PSAP-/- mice were involuted (35). Several groups have knocked out one or more of the individual saposin proteins. The models showed variable phenotypes, but all exhibited neurological defects, hindlimb weakness, tremors, and motor neuron deterioration (38-40).

 

Table 1. Phenotypes of saposin knockout mice.

Saposin knockout

Primary phenotypes

References

A

Survived up to five months of age; progressive hind limb paralysis; chronic form of globoid cell leukodystrophy

(34;41)

B

Progressive neuromotor deterioration and hear tremor by 15 months of age; increased levels of fatty acid sulfatides in the brain and kidney; sulfatide storage cells in the brain, spinal cord, and kidney

(38)

A and B

Later-onset (>61 days) neuromotor deterioration, abnormal locomotor activity, and tremor; storage materials in Schwann cells and neuronal processes; increased levels of lactosylceramide in the liver

(39)

C

Weakness of the hind limbs and progressive ataxia by one year of age; neuromotor activity and impaired hippocampal long-term potentiation; storage cells in dorsal root ganglion; progressive loss of cerebellar Purkinje cells; atrophy of cerebellar granule cells

(42)

D

Progressive polyuria and ataxia; renal tubular degeneration and hydronephrosis; nervous system showed progressive loss of Purkinje cells; accumulation of ceramides in the kidney and brain

(43)

C and D

Ataxia, kyphosis, and hind limb paralysis; loss of Purkinje cells, the presence of storage bodies in neurons of the spinal cord, brain, and dorsal root ganglion, and accumulation of glucosylceramides and alpha-hydroxy ceramides were present in brain and kidney

(44)

Putative Mechanism

The functions of each of the indvidual saposins in the twerk mice were not examined. The overt neurological phenotype observed in the twerk mice mimics that of the PSAP-/- and individual saposin knockout mice, indicating loss of PSAP-associated function.

Primers PCR Primer
twerk(F):5'- AACAGCCAGACCTCTGTCAG -3'
twerk(R):5'- AGGTTTGGTGCAATCCCTGG -3'

Sequencing Primer
twerk_seq(F):5'- CTCTGTCAGGGGCTGGAAG -3'
twerk_seq(R):5'- CTGTGCATGAAGCTGGTAAGAC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsLauren Prince, Sara Ludwig, Jamie Russell, and Bruce Beutler
List |< first << previous [record 2 of 17] next >> last >|