Phenotypic Mutation 'twerk'

• Allele: twerk
• Mutation Type: missense
• Chromosome: 10
• Coordinate: 60,136,630 bp (GRCm39)
• Base Change: T ⇒ G (forward strand)
• Gene: Psap
• Gene Name: prosaposin
• Synonym(s): SGP-1
• Chromosomal Location: 60,113,449-60,138,376 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a multifunctional glycoprotein that plays a role in the intracellular metabolism of various sphingolipids or secreted into the plasma, milk or cerebrospinal fluid. The encoded protein undergoes proteolytic processing to generate four different polypeptides known as saposin A, B, C or D, that are required for the hydrolysis of certain sphingolipids by lysosomal hydrolases. Alternately, the encoded protein is secreted into body fluids where it exhibits neurotrophic and myelinotrophic activities. A complete lack of the encoded protein is fatal to mice either at the neonatal stage or within the first month due to severe leukodystrophy and sphingolipid accumulation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature saposins. [provided by RefSeq, Sep 2015] ; PHENOTYPE: Homozygotes for a targeted null mutation die either neonatally or around 7 weeks. At 30 days, mutants show hypomyelination, PAS-positive material in the nervous system, and accumulation of ceramides in brain, liver, and kidney. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Tryptophan
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000004316] [ENSMUSP00000101105] [ENSMUSP00000126407] [ENSMUSP00000137286] [ENSMUSP00000137476]
• AlphaFold: Q61207
• SMART Domains: Protein: ENSMUSP00000004316; Gene: ENSMUSG00000004207; AA Change: C535W

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	272	1.2e-16	SMART
SapB	314	389	2.07e-20	SMART
low complexity region	412	430	N/A	INTRINSIC
SapB	439	514	3.84e-24	SMART
SAPA	523	556	3.19e-22	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000004316)
• SMART Domains: Protein: ENSMUSP00000101105; Gene: ENSMUSG00000004207; AA Change: C533W

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	270	2.76e-16	SMART
SapB	312	387	2.07e-20	SMART
low complexity region	410	428	N/A	INTRINSIC
SapB	437	512	3.84e-24	SMART
SAPA	521	554	3.19e-22	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000105465)
• SMART Domains: Protein: ENSMUSP00000126407; Gene: ENSMUSG00000004207; AA Change: C530W

Domain	Start	End	E-Value	Type
SAPA	18	51	1.4e-18	SMART
SapB	58	135	1.87e-27	SMART
SapB	192	267	2.76e-16	SMART
SapB	309	384	2.07e-20	SMART
low complexity region	407	425	N/A	INTRINSIC
SapB	434	509	3.84e-24	SMART
SAPA	518	551	3.19e-22	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000165878)
• SMART Domains: Protein: ENSMUSP00000137286; Gene: ENSMUSG00000004207; AA Change: C536W

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	273	2.37e-15	SMART
SapB	315	390	2.07e-20	SMART
low complexity region	413	431	N/A	INTRINSIC
SapB	440	515	3.84e-24	SMART
SAPA	524	557	3.19e-22	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000177779)
• SMART Domains: Protein: ENSMUSP00000137476; Gene: ENSMUSG00000004207; AA Change: C536W

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	273	8.5e-17	SMART
SapB	315	390	2.07e-20	SMART
low complexity region	413	431	N/A	INTRINSIC
SapB	440	515	3.84e-24	SMART
SAPA	524	557	3.19e-22	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000179238)
• Meta Mutation Damage Score: 0.6467
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• Last Updated: 2019-09-04 9:42 PM by Anne Murray
• Record Created: 2016-08-16 2:37 PM by Jamie Russell
• Record Posted: 2018-11-16
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Lauren Prince, Sara Ludwig, Jamie Russell, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001146120 (variant 1), NM_011179 (variant 2), NM_001146121 (variant 3), NM_001146122 (variant 4), NM_001146123 (variant 5), NM_001146124 (variant 6); MGI:97783

Alleles Listed at MGI

All Mutations and Alleles(16) : Chemically induced (other)(1) Gene trapped(4) Radiation induced(1) Targeted(10)

Phenotypic Description

Figure 1. The phenotype of the twerk mice.

The twerk phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4622, some of which exhibited ataxia (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the ataxia phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 102 mutations (X-axis) identified in the G1 male of pedigree R4622. Binary data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 102 mutations. The ataxia phenotype was attributed to a mutation in Psap; mutations in Psap are known to cause ataxia (see MGI). The mutation in Psap is a T to G transversion at base pair 60,300,851 (v38) on chromosome 10, or base pair 23,224 in the GenBank genomic region NC_000076 encoding Psap. Linkage was found with a recessive model of inheritance, wherein two homozygous variant mice departed phenotypically from eight homozygous reference mice and nine heterozygous mice with a P value of 0.002881 (Figure 2).   

The mutation corresponds to residue 1,714 in the mRNA sequence NM_001146120 within exon 13 of 14 total exons.

1697 GGCCCTAGCTACTGGTGTCAGAACATGGAGACT 528  -G--P--S--Y--W--C--Q--N--M--E--T-

The mutated nucleotide is indicated in red. The mutation results in a cysteine to tryptophan substitution at amino acid 533 (C533W) in the PSAP protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 3. Domain organization of PSAP. The twerk mutation results in a cysteine to tryptophan substitution at amino acid 533 within in a saposin A-type domain. Domain information is from SMART and UniProt.

Psap encodes prosaposin (PSAP; alternatively, spingolipid activator protein 1 [SAP1], SAP2, or sulfated glycoprotein 1 [SGP-1]). PSAP is a precursor protein for four lysosomal activator proteins: saposin A through D (Figure 3) (1). The saposins remodel lysosomal membranes to promote the extraction of substrate lipids (i.e., sphingolipids) from the membranes for presentation to hydrolase enzymes (1-4). Each of the saposins exhibit unique substrate specificity. Saposin A and C stimulate the hydrolysis of glucosylceramide by beta-glucosylceramidase. Saposin B stimulates the hydrolysis of galactocerebroside sulfate by arylsulfatase A, GM1 (monosialotetrahexosylganglioside) gangliosides by beta-galactosidase, and globotriaosylceramide by alpha-galactosidase A. Saposin-D is a specific sphingomyelin phosphodiesterase activator.

The four saposins are approximately 80-amino acids in length and are structurally similar, with each sharing the placement of six cysteines, a glycosylation site, and two conserved prolines in identical positions (1;5). Each saposin is highly structured and rich in a-helical regions (5). Saposin A, C, and D putatively form triple helix structures that are stabilized by disulfide linkages (6;7). The first 24-amino acids of saposin B are putatively in a b-sheet configuration, but the comparable region in the other saposins is helical (5).

The twerk mutation results in a cysteine to tryptophan substitution at amino acid 533; Cys533 is within in a saposin A-type domain (SMART) following the saposin D peptide. The saposin A-type domain putatively regulates protein targeting.

Expression/Localization

PSAP can be secreted into the extracellular space; PSAP secretion is increased under conditions of injury and stress. PSAP can subsequently be re-uptaken by the same cell or by neighboring cells (8;9). Saposins are expressed in most tissues, including liver, spleen, brain, placenta, and saliva (1). The saposins are processed from PSAP in the late endosome and lysosome; mature saposins are localized to lysosomes (1;5).

Background

Figure 4. PSAP initiates pro-survival signaling pathways in neurons and glia. Secreted PSAP binds to GPR37 and GPR37L1, initiating survivial signaling. Cellular uptake of PSAP is mediated by LRP1 on the cell surface. In normal conditions, sortillin targets oligomerized PSAP for lysosomal degradation. Upon stress, PSAP is excreted from the cell via exocytosis.

PSAP can be secreted into cerebrospinal fluid, semen, milk, pancreatic juice, and bile (10). PSAP is re-uptaken into cells by the endocytic receptor LRP-1. Secreted PSAP can function as a neurotrophic factor that promotes cell survival, neurite outgrowth, and differentiation (Figure 4) (11;12). Secreted PSAP activates G protein pathways to protect neurons and glia by stimulating two orphan G protein-coupled receptors: GPR37 and GPR37L1 (13). GPR37 and GPR37L1 are mainly expressed in neurons and glia of the nervous system where they putatively protect cells from oxidative stress and cell death (13-15).

PSAP stimulates ERK and Akt phosphorylation in several cell types. PSAP-stimulated ERK phosphorylation promoted proliferation, survival, migration, and invasion of cancer cells (16), prevented oxidative cell death in PC12 cells (17), and promoted cell cycle progression in PC12 cells (18). PSAP-stimulated Akt phosphorylation promoted Schwann cell survival (19), prevented oxidative cell death in PC12 cells (17), and protected prostate cancer cells from apoptosis (20).

Loss of (pro)saposin function is linked to several human lysosomal storage diseases including atypical Krabbe disease (OMIM:#611722; alternatively, globoid cell leukodystrophy [GLD]) (21), atypical Gaucher disease [OMIM:#610539;(22-25)], and metachromatic leukodystrophy due to saposin B deficiency [OMIM:#249900; (26-29)]. Patients with atypical Krabbe disease, atypical Gaucher disease, and metachromatic leukodystrophy show neurological defects, including transient losses of consciousness, myoclonic jerks, and generalized seizures (21;24;27). Mutations in PSAP are also linked to combined saposin deficiency (OMIM:#611721; alternatively, posaposin deficiency; (30-32)). Patients with combined saposin deficiency showed respiratory insufficiency, hepatosplenomegaly, and neurological disease as well as storage cells in the bone marrow and elevated levels of glucosylceramide and ceramide in the liver (30;31).

PSAP-deficient (PSAP^-/-) mice exhibit increased rates of embryonic and neonatal lethality (33-35). Surviving mice showed smaller body sizes than wild-type littermates, head tremors, and weakness/ataxia of the hind legs (33;36). The mice showed intermittent seizures by postnatal day 30 that progressed to continual tonic status epilepticus. The PSAP^-/- mice showed reduced hearing at postnatal day 19, but deafness by postnatal day 25 due to a loss of outer hair cells from the cochlear apex, vacuolization of the outer hair cells, and cellular hypertrophy in the region of the inner hair cells (37). The mice had dystrophic axons, neuronal storage, hypomyelination, and myelin degeneration. The mice died by approximately postnatal day 35 (33;36). The brains, liver, and kidneys from the PSAP^-/- brain showed lactosylceramide accumulation. The PSAP^-/- testis size was decreased with reduced spermiogenesis, and the prostate, seminal vesicle, and epididymis of the PSAP^-/- mice were involuted (35). Several groups have knocked out one or more of the individual saposin proteins. The models showed variable phenotypes, but all exhibited neurological defects, hindlimb weakness, tremors, and motor neuron deterioration (38-40).

Table 1. Phenotypes of saposin knockout mice.

Saposin knockout	Primary phenotypes	References
A	Survived up to five months of age; progressive hind limb paralysis; chronic form of globoid cell leukodystrophy	(34;41)
B	Progressive neuromotor deterioration and hear tremor by 15 months of age; increased levels of fatty acid sulfatides in the brain and kidney; sulfatide storage cells in the brain, spinal cord, and kidney	(38)
A and B	Later-onset (>61 days) neuromotor deterioration, abnormal locomotor activity, and tremor; storage materials in Schwann cells and neuronal processes; increased levels of lactosylceramide in the liver	(39)
C	Weakness of the hind limbs and progressive ataxia by one year of age; neuromotor activity and impaired hippocampal long-term potentiation; storage cells in dorsal root ganglion; progressive loss of cerebellar Purkinje cells; atrophy of cerebellar granule cells	(42)
D	Progressive polyuria and ataxia; renal tubular degeneration and hydronephrosis; nervous system showed progressive loss of Purkinje cells; accumulation of ceramides in the kidney and brain	(43)
C and D	Ataxia, kyphosis, and hind limb paralysis; loss of Purkinje cells, the presence of storage bodies in neurons of the spinal cord, brain, and dorsal root ganglion, and accumulation of glucosylceramides and alpha-hydroxy ceramides were present in brain and kidney	(44)

Putative Mechanism

The functions of each of the indvidual saposins in the twerk mice were not examined. The overt neurological phenotype observed in the twerk mice mimics that of the PSAP^-/- and individual saposin knockout mice, indicating loss of PSAP-associated function.

Primers

PCR Primer
twerk_pcr_F: AACAGCCAGACCTCTGTCAG
twerk_pcr_R: AGGTTTGGTGCAATCCCTGG

Sequencing Primer
twerk_seq_F: CTCTGTCAGGGGCTGGAAG
twerk_seq_R: CTGTGCATGAAGCTGGTAAGAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 422 nucleotides is amplified (chromosome 10, + strand):

1   aacagccaga cctctgtcag gggctggaag tgcttcggtc tcagctctga atggggcctg
61  gcagggcagc tcatttctcg tcatttgtca tacagaaaat tggagtttgc ccttctgcct
121 ataagctgct gctgggaacc gagaagtgtg tctggggccc tagctactgg tgtcagaaca
181 tggagactgc cgcccgatgc aatgtgagta tcctgactgc tcctacagcg tgctgggggg
241 tggatcacct catgggaaca ggaggctcta actgtgcctc taacaagtca tcttgtcggg
301 gatgactgag ctcagggcat taggcctgcg tggctatgct ttttgtcttt tgagccatct
361 ctgtgtcccc tggtattgtc ttaccagctt catgcacagc caccagggat tgcaccaaac
421 ct

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Kishimoto, Y., Hiraiwa, M., and O'Brien, J. S. (1992) Saposins: Structure, Function, Distribution, and Molecular Genetics. J Lipid Res. 33, 1255-1267.

  2. Wenger, D. A., Sattler, M., and Roth, S. (1982) A Protein Activator of Galactosylceramide Beta-Galactosidase. Biochim Biophys Acta. 712, 639-649.

  3. Hiraiwa, M., Soeda, S., Kishimoto, Y., and O'Brien, J. S. (1992) Binding and Transport of Gangliosides by Prosaposin. Proc Natl Acad Sci U S A. 89, 11254-11258.

  4. Alattia, J. R., Shaw, J. E., Yip, C. M., and Prive, G. G. (2006) Direct Visualization of Saposin Remodelling of Lipid Bilayers. J Mol Biol. 362, 943-953.

  5. O'Brien, J. S., and Kishimoto, Y. (1991) Saposin Proteins: Structure, Function, and Role in Human Lysosomal Storage Disorders. FASEB J. 5, 301-308.

  6. Morimoto, S., Martin, B. M., Yamamoto, Y., Kretz, K. A., O'Brien, J. S., and Kishimoto, Y. (1989) Saposin A: Second Cerebrosidase Activator Protein. Proc Natl Acad Sci U S A. 86, 3389-3393.

  7. O'Brien, J. S., Kretz, K. A., Dewji, N., Wenger, D. A., Esch, F., and Fluharty, A. L. (1988) Coding of Two Sphingolipid Activator Proteins (SAP-1 and SAP-2) by Same Genetic Locus. Science. 241, 1098-1101.

  8. Hiesberger, T., Huttler, S., Rohlmann, A., Schneider, W., Sandhoff, K., and Herz, J. (1998) Cellular Uptake of Saposin (SAP) Precursor and Lysosomal Delivery by the Low Density Lipoprotein Receptor-Related Protein (LRP). EMBO J. 17, 4617-4625.

  9. Vielhaber, G., Hurwitz, R., and Sandhoff, K. (1996) Biosynthesis, Processing, and Targeting of Sphingolipid Activator Protein (SAP )Precursor in Cultured Human Fibroblasts. Mannose 6-Phosphate Receptor-Independent Endocytosis of SAP Precursor. J Biol Chem. 271, 32438-32446.

  10. Hineno, T., Sano, A., Kondoh, K., Ueno, S., Kakimoto, Y., and Yoshida, K. (1991) Secretion of Sphingolipid Hydrolase Activator Precursor, Prosaposin. Biochem Biophys Res Commun. 176, 668-674.

  11. O'Brien, J. S., Carson, G. S., Seo, H. C., Hiraiwa, M., Weiler, S., Tomich, J. M., Barranger, J. A., Kahn, M., Azuma, N., and Kishimoto, Y. (1995) Identification of the Neurotrophic Factor Sequence of Prosaposin. FASEB J. 9, 681-685.

  12. O'Brien, J. S., Carson, G. S., Seo, H. C., Hiraiwa, M., and Kishimoto, Y. (1994) Identification of Prosaposin as a Neurotrophic Factor. Proc Natl Acad Sci U S A. 91, 9593-9596.

  13. Meyer, R. C., Giddens, M. M., Schaefer, S. A., and Hall, R. A. (2013) GPR37 and GPR37L1 are Receptors for the Neuroprotective and Glioprotective Factors Prosaptide and Prosaposin. Proc Natl Acad Sci U S A. 110, 9529-9534.

  14. Lundius, E. G., Stroth, N., Vukojevic, V., Terenius, L., and Svenningsson, P. (2013) Functional GPR37 Trafficking Protects Against Toxicity Induced by 6-OHDA, MPP+ Or Rotenone in a Catecholaminergic Cell Line. J Neurochem. 124, 410-417.

  15. Lundius, E. G., Vukojevic, V., Hertz, E., Stroth, N., Cederlund, A., Hiraiwa, M., Terenius, L., and Svenningsson, P. (2014) GPR37 Protein Trafficking to the Plasma Membrane Regulated by Prosaposin and GM1 Gangliosides Promotes Cell Viability. J Biol Chem. 289, 4660-4673.

  16. Koochekpour, S., Sartor, O., Lee, T. J., Zieske, A., Patten, D. Y., Hiraiwa, M., Sandhoff, K., Remmel, N., and Minokadeh, A. (2004) Prosaptide TX14A Stimulates Growth, Migration, and Invasion and Activates the Raf-MEK-ERK-RSK-Elk-1 Signaling Pathway in Prostate Cancer Cells. Prostate. 61, 114-123.

  17. Ochiai, T., Takenaka, Y., Kuramoto, Y., Kasuya, M., Fukuda, K., Kimura, M., Shimeno, H., Misasi, R., Hiraiwa, M., and Soeda, S. (2008) Molecular Mechanism for Neuro-Protective Effect of Prosaposin Against Oxidative Stress: Its Regulation of Dimeric Transcription Factor Formation. Biochim Biophys Acta. 1780, 1441-1447.

  18. Misasi, R., Sorice, M., Di Marzio, L., Campana, W. M., Molinari, S., Cifone, M. G., Pavan, A., Pontieri, G. M., and O'Brien, J. S. (2001) Prosaposin Treatment Induces PC12 Entry in the S Phase of the Cell Cycle and Prevents Apoptosis: Activation of ERKs and Sphingosine Kinase. FASEB J. 15, 467-474.

  19. Campana, W. M., Darin, S. J., and O'Brien, J. S. (1999) Phosphatidylinositol 3-Kinase and Akt Protein Kinase Mediate IGF-I- and Prosaptide-Induced Survival in Schwann Cells. J Neurosci Res. 57, 332-341.

  20. Lee, T. J., Sartor, O., Luftig, R. B., and Koochekpour, S. (2004) Saposin C Promotes Survival and Prevents Apoptosis Via PI3K/Akt-Dependent Pathway in Prostate Cancer Cells. Mol Cancer. 3, 31-4598-3-31.

  21. Spiegel, R., Bach, G., Sury, V., Mengistu, G., Meidan, B., Shalev, S., Shneor, Y., Mandel, H., and Zeigler, M. (2005) A Mutation in the Saposin A Coding Region of the Prosaposin Gene in an Infant Presenting as Krabbe Disease: First Report of Saposin A Deficiency in Humans. Mol Genet Metab. 84, 160-166.

  22. Schnabel, D., Schroder, M., and Sandhoff, K. (1991) Mutation in the Sphingolipid Activator Protein 2 in a Patient with a Variant of Gaucher Disease. FEBS Lett. 284, 57-59.

  23. Diaz-Font, A., Cormand, B., Santamaria, R., Vilageliu, L., Grinberg, D., and Chabas, A. (2005) A Mutation within the Saposin D Domain in a Gaucher Disease Patient with Normal Glucocerebrosidase Activity. Hum Genet. 117, 275-277.

  24. Christomanou, H., Aignesberger, A., and Linke, R. P. (1986) Immunochemical Characterization of Two Activator Proteins Stimulating Enzymic Sphingomyelin Degradation in Vitro. Absence of One of them in a Human Gaucher Disease Variant. Biol Chem Hoppe Seyler. 367, 879-890.

  25. Tylki-Szymanska, A., Czartoryska, B., Vanier, M. T., Poorthuis, B. J., Groener, J. A., Lugowska, A., Millat, G., Vaccaro, A. M., and Jurkiewicz, E. (2007) Non-Neuronopathic Gaucher Disease due to Saposin C Deficiency. Clin Genet. 72, 538-542.

  26. Kretz, K. A., Carson, G. S., Morimoto, S., Kishimoto, Y., Fluharty, A. L., and O'Brien, J. S. (1990) Characterization of a Mutation in a Family with Saposin B Deficiency: A Glycosylation Site Defect. Proc Natl Acad Sci U S A. 87, 2541-2544.

  27. Henseler, M., Klein, A., Reber, M., Vanier, M. T., Landrieu, P., and Sandhoff, K. (1996) Analysis of a Splice-Site Mutation in the Sap-Precursor Gene of a Patient with Metachromatic Leukodystrophy. Am J Hum Genet. 58, 65-74.

  28. Hahn, A. F., Gordon, B. A., Hinton, G. G., and Gilbert, J. J. (1982) A Variant Form of Metachromatic Leukodystrophy without Arylsulfatase Deficiency. Ann Neurol. 12, 33-36.

  29. Shapiro, L. J., Aleck, K. A., Kaback, M. M., Itabashi, H., Desnick, R. J., Brand, N., Stevens, R. L., Fluharty, A. L., and Kihara, H. (1979) Metachromatic Leukodystrophy without Arylsulfatase A Deficiency. Pediatr Res. 13, 1179-1181.

  30. Harzer, K., Paton, B. C., Poulos, A., Kustermann-Kuhn, B., Roggendorf, W., Grisar, T., and Popp, M. (1989) Sphingolipid Activator Protein Deficiency in a 16-Week-Old Atypical Gaucher Disease Patient and His Fetal Sibling: Biochemical Signs of Combined Sphingolipidoses. Eur J Pediatr. 149, 31-39.

  31. Hulkova, H., Cervenkova, M., Ledvinova, J., Tochackova, M., Hrebicek, M., Poupetova, H., Befekadu, A., Berna, L., Paton, B. C., Harzer, K., Boor, A., Smid, F., and Elleder, M. (2001) A Novel Mutation in the Coding Region of the Prosaposin Gene Leads to a Complete Deficiency of Prosaposin and Saposins, and is Associated with a Complex Sphingolipidosis Dominated by Lactosylceramide Accumulation. Hum Mol Genet. 10, 927-940.

  32. Schnabel, D., Schroder, M., Furst, W., Klein, A., Hurwitz, R., Zenk, T., Weber, J., Harzer, K., Paton, B. C., and Poulos, A. (1992) Simultaneous Deficiency of Sphingolipid Activator Proteins 1 and 2 is Caused by a Mutation in the Initiation Codon of their Common Gene. J Biol Chem. 267, 3312-3315.

  33. Fujita, N., Suzuki, K., Vanier, M. T., Popko, B., Maeda, N., Klein, A., Henseler, M., Sandhoff, K., Nakayasu, H., and Suzuki, K. (1996) Targeted Disruption of the Mouse Sphingolipid Activator Protein Gene: A Complex Phenotype, Including Severe Leukodystrophy and Wide-Spread Storage of Multiple Sphingolipids. Hum Mol Genet. 5, 711-725.

  34. Tadano-Aritomi, K., Matsuda, J., Fujimoto, H., Suzuki, K., and Ishizuka, I. (2003) Seminolipid and its precursor/degradative Product, Galactosylalkylacylglycerol, in the Testis of Saposin A- and Prosaposin-Deficient Mice. J Lipid Res. 44, 1737-1743.

  35. Morales, C. R., Zhao, Q., El-Alfy, M., and Suzuki, K. (2000) Targeted Disruption of the Mouse Prosaposin Gene Affects the Development of the Prostate Gland and Other Male Reproductive Organs. J Androl. 21, 765-775.

  36. Oya, Y., Nakayasu, H., Fujita, N., Suzuki, K., and Suzuki, K. (1998) Pathological Study of Mice with Total Deficiency of Sphingolipid Activator Proteins (SAP Knockout Mice). Acta Neuropathol. 96, 29-40.

  37. Akil, O., Chang, J., Hiel, H., Kong, J. H., Yi, E., Glowatzki, E., and Lustig, L. R. (2006) Progressive Deafness and Altered Cochlear Innervation in Knock-Out Mice Lacking Prosaposin. J Neurosci. 26, 13076-13088.

  38. Sun, Y., Witte, D. P., Ran, H., Zamzow, M., Barnes, S., Cheng, H., Han, X., Williams, M. T., Skelton, M. R., Vorhees, C. V., and Grabowski, G. A. (2008) Neurological Deficits and Glycosphingolipid Accumulation in Saposin B Deficient Mice. Hum Mol Genet. 17, 2345-2356.

  39. Sun, Y., Zamzow, M., Ran, H., Zhang, W., Quinn, B., Barnes, S., Witte, D. P., Setchell, K. D., Williams, M. T., Vorhees, C. V., and Grabowski, G. A. (2013) Tissue-Specific Effects of Saposin A and Saposin B on Glycosphingolipid Degradation in Mutant Mice. Hum Mol Genet. 22, 2435-2450.

  40. Sun, Y., Liou, B., Ran, H., Skelton, M. R., Williams, M. T., Vorhees, C. V., Kitatani, K., Hannun, Y. A., Witte, D. P., Xu, Y. H., and Grabowski, G. A. (2010) Neuronopathic Gaucher Disease in the Mouse: Viable Combined Selective Saposin C Deficiency and Mutant Glucocerebrosidase (V394L) Mice with Glucosylsphingosine and Glucosylceramide Accumulation and Progressive Neurological Deficits. Hum Mol Genet. 19, 1088-1097.

  41. Matsuda, J., Vanier, M. T., Saito, Y., Tohyama, J., Suzuki, K., and Suzuki, K. (2001) A Mutation in the Saposin A Domain of the Sphingolipid Activator Protein (Prosaposin) Gene Results in a Late-Onset, Chronic Form of Globoid Cell Leukodystrophy in the Mouse. Hum Mol Genet. 10, 1191-1199.

  42. Sun, Y., Ran, H., Zamzow, M., Kitatani, K., Skelton, M. R., Williams, M. T., Vorhees, C. V., Witte, D. P., Hannun, Y. A., and Grabowski, G. A. (2010) Specific Saposin C Deficiency: CNS Impairment and Acid Beta-Glucosidase Effects in the Mouse. Hum Mol Genet. 19, 634-647.

  43. Matsuda, J., Kido, M., Tadano-Aritomi, K., Ishizuka, I., Tominaga, K., Toida, K., Takeda, E., Suzuki, K., and Kuroda, Y. (2004) Mutation in Saposin D Domain of Sphingolipid Activator Protein Gene Causes Urinary System Defects and Cerebellar Purkinje Cell Degeneration with Accumulation of Hydroxy Fatty Acid-Containing Ceramide in Mouse. Hum Mol Genet. 13, 2709-2723.

  44. Sun, Y., Witte, D. P., Zamzow, M., Ran, H., Quinn, B., Matsuda, J., and Grabowski, G. A. (2007) Combined Saposin C and D Deficiencies in Mice Lead to a Neuronopathic Phenotype, Glucosylceramide and Alpha-Hydroxy Ceramide Accumulation, and Altered Prosaposin Trafficking. Hum Mol Genet. 16, 957-971.