Phenotypic Mutation 'swirl'

• Allele: swirl
• Mutation Type: missense
• Chromosome: 1
• Coordinate: 36,589,392 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Sema4c
• Gene Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C
• Synonym(s): M-Sema F, Semacl1, Semaf, Semai, Semacl1
• Chromosomal Location: 36,587,720-36,597,430 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a member of the semaphorin family of proteins that have diverse functions in neuronal development, heart morphogenesis, vascular growth, tumor progression and immune cell regulation. Lack of the encoded protein in some mice causes exencephaly resulting in neonatal lethality. Mice that bypass exencephaly show no obvious behavioral defects but display distinct pigmentation defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015] ; PHENOTYPE: Mice homozygous for a targeted mutation exhibit exencephaly, neonatal lethality, and abnormal cerebellum morphology. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Phenylalanine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000110643] [ENSMUSP00000142284] [ENSMUSP00000141263] [ENSMUSP00000142034] [ENSMUSP00000141527]
• AlphaFold: Q64151
• SMART Domains: Protein: ENSMUSP00000110643; Gene: ENSMUSG00000026121; AA Change: C578F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Sema	53	481	2.54e-183	SMART
PSI	499	552	4.52e-11	SMART
IG	563	647	1.77e-4	SMART
transmembrane domain	665	687	N/A	INTRINSIC
low complexity region	754	774	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000114991)
• SMART Domains: Protein: ENSMUSP00000142284; Gene: ENSMUSG00000026121; AA Change: C578F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Sema	53	481	2.54e-183	SMART
PSI	499	552	4.52e-11	SMART
IG	563	647	1.77e-4	SMART
transmembrane domain	665	687	N/A	INTRINSIC
low complexity region	754	774	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000191642)
• SMART Domains: Protein: ENSMUSP00000141263; Gene: ENSMUSG00000026121; AA Change: C578F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Sema	53	481	2.54e-183	SMART
PSI	499	552	4.52e-11	SMART
IG	563	647	1.77e-4	SMART
transmembrane domain	665	687	N/A	INTRINSIC
low complexity region	754	774	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000191677)
• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000141527; Gene: ENSMUSG00000026121; AA Change: C578F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Sema	53	481	2.54e-183	SMART
PSI	499	552	4.52e-11	SMART
IG	563	647	1.77e-4	SMART
transmembrane domain	665	687	N/A	INTRINSIC
low complexity region	754	774	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000195620)
• Meta Mutation Damage Score: 0.9401
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:42 PM by Anne Murray
• Record Created: 2016-08-19 11:01 AM by Carlos Reyna
• Record Posted: 2018-12-05
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Carlos Reyna, Jamie Russell, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001304330 (variant 1), NM_001126047 (variant 2), NM_001304329 (variant 3); MGI:109252

Alleles Listed at MGI

All Mutations and Alleles(5) : Chemically induced (other)(1) Gene trapped(2) Targeted(2)

Phenotypic Description

Figure 1. Swirl mice exhibit variable white belly spotting.

The swirl phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4944, some of which showed variable white belly spotting (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the pigmentation phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 68 mutations (X-axis) identified in the G1 male of pedigree R4944. Binary data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 68 mutations. Among these, only one affected a gene with known effects on pigmentation, Sema4c. The mutation in Sema4c was presumed to be causative because the swirl pigmentation phenotype mimics other known alleles of Sema4c (see MGI for a list of Sema4c alleles). The Sema4c mutation is a G to T transversion at base pair 36,550,311 (v38) on chromosome 1, or base pair 8,071 in the GenBank genomic region NC_000067 encoding Sema4c. Linkage was found with a recessive model of inheritance (P = 0.001097), wherein two affected mice were homozygous (N = 2) for the variant allele, and 33 unaffected mice were either heterozygous (N = 19) or homozygous for the reference allele (N = 14) (Figure 2).

The mutation corresponds to residue 2,251 in the NM_001304330 mRNA sequence in exon 16 of 16 total exons, to residue 2,136 in the NM_001126047 mRNA sequence in exon 15 of 15 total exons, and to residue 1,971 in the NM_001304329 mRNA sequence in exon 15 of 15 total exons

8055 GACCTGGTCCTACCCTGCCACCTCTCGTCCAAT 573  -D--L--V--L--P--C--H--L--S--S--N-

Genomic numbering corresponds to NC_000067. The mutated nucleotide is indicated in red. The mutation results in a cysteine (C) to phenylalanine (F) substitution at position 578 (C578F) in all isoforms of the SEMA4C protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 3. Domain organization of SEMA-4C. The swirl mutation results in a cysteine to phenylalanine substitution at position 578 within the Ig-like domain of the protein.

Sema4c encodes semaphorin 4C (SEMA4C; alternatively semaphorin F [SEMAF]). Semaphorins (SEMAs) are categorized into eight subclasses based on their structural elements and amino acid homology. Classes 3, 4, 6, and 7 are only expressed in vertebrates, class 1 and 2 are present in invertebrates, and group 8 (alternatively class V [virus]) are SEMAs encoded by viral genomes.

SEMA4C has an N-terminal signal sequence, a 484-amino acid SEMA domain, a PSI (plexin, semaphorin, integrins) domain, an immunoglobulin (Ig)-like domain, a transmembrane domain, and an 81-amino acid cytoplasmic domain with a PDZ (PSD-95/DLG/ZO-1) domain‐binding motif at the C-terminus (Figure 3) (1;2).

The SEMA domain is characterized by a conserved set of cysteine residues, which form four disulfide bonds to stabilize the structure. The SEMA domain has a seven-bladed β-propeller fold, and each blade contains a four- stranded (strands A to D) antiparallel beta sheet. he inner strand of each blade (A) lines the channel at the center of the propeller, with strands B and C of the same repeat radiating outward, and strand D of the next repeat forming the outer edge of the blade. The SEMA domain is required for SEMA4C activity and receptor specificity. The PDZ motif interacts with several proteins, including PDS-95/SAP90, PSD-93/chapsin110, and SAP97/DLG-1 in the mouse brain (3). The cytoplasmic domain contains a proline-rich region that putatively interacts with Src homology 3 (SH3)-containing proteins and/or cytoskeletal proteins. The membrane-proximal region of the SEMA4C cytoplasmic domain associates with the a neurite outgrowth-related protein SFAP75 (alternatively, Norbin) in the mouse brain (4-6).

The swirl mutation results in a cysteine (C) to phenylalanine (F) substitution at position 578 (C578F); Cys578 is within the Ig-like domain.

Expression/Localization

SEMA4C is expressed in all adult tissues examined as well as weakly in fetal brain, lung, and kidney (1). SEMA4C is expressed on follicular T helper cells (7).

SEMA4C is expressed in the brain and spinal cord of neonatal mice, with high expression levels in the primordia of the neocortex, hippocampus, thalamus, hypothalamus, tectum, pontine nuclei, spinal cord, and retina (2). SEMA4C was also highly expressed in the olfactory epithelium, epithelium of the vomeronasal organ, enamel epithelium of teeth, anterior and intermediate lobes of the pituitary, and epithelium of the inner ear as well as in the lung and kidney (2). Expression of SEMA4C in the adult mice was reduced, with low expression in the brain (2).

SEMA4C is upregulated in the early stage of C2C12 mouse skeletal myoblast differentiation into myotubes as well as during injury-induced muscle regeneration (8).

SEMA4C is anchored at the cell membrane, but can be released as a soluble form.

Background

Figure 4. SEMA4C/plexin-B2 signaling. A semaphorin homodimer binds to two plexin molecules, leading to dimerization of the plexins and activation of downstream signaling. Rho-GEFs interact with the plexins after SEMA binding, activating the small GTPase RhoA. The plexins also interact with and activate Met and ErbB-2. There is a requirement of RhoA-ROCK and TRPA1 in the pronociceptive functions of Sema4C-Plexin-B2 signaling.

SEMA4C, and other members of the SEMA family, regulate nervous system development. SEMA4C is a putative ligand for the plexin-B2 receptor, which functions in neural tube closure and cerebellar granule cell development (8). SEMA4C-Plexin-B2 signaling is pronociceptive in peripheral sensory neurons in the adult (9). After SEMA binding to the plexins, intracellular Rho-guanine exchange factors (Rho-GEF) interact with the plexins (Figure 4). The Rho-GEFs subsequently activate the small GTPase RhoA. RhoA-ROCK and TRPA1 (see the record for fear-2) are required for the pronociceptive functions associated with Sema4C-Plexin-B2 signaling. RhoA-ROCK putatively regulates the release of neurotransmitters and neuromodulators involved in sensitization. RhoA-ROCK may also modulate actin-mediated insertion of endocytic vesicles. TRPA1 is a TRP channel expressed on neuropeptide-containing sensory neurons (10). The TRP channels function by facilitating the transmembrane flow of cations (i.e. Na⁺ and Ca²⁺) down electrochemical gradients to depolarize the cell as well as to mediate signal transduction (11;12). The plexins also interact with and activate the receptor tyrosine kinases Met and ErbB-2, which stimulates the tyrosine kinase activity of the kinases, resulting in phosphorylation of the plexin and the kinases as well as cell proliferation(13;14).

SEMA4C also putatively mediates signaling through interactions with PDZ domain-containing proteins (e.g., PSD-93, PSD-95, and SAP97/DLG-1) (3). The functional significance of these interactions is unknown. PSD-95 is a postsynaptic density-enriched synapse-associated protein that associates with excitatory neurotransmitter receptors, synaptic adhesion, ion channels, and signaling proteins (15-17). PSD-95 couples the NMDA receptor to signaling pathways that mediate bi-directional synaptic plasticity and learning (18). PSD-95 binds regulatory proteins, including Src, Pyk2, nNOS, and SynGAP, putatively recruiting signaling proteins to the NMDA receptor. Inagaki and colleagues propose that the PSD-95/SEMA4C interaction may also promote synaptic plasticity and learning, and that SEMA4C putatively acts as a bi-directional transmembrane ligand through its interaction with PSD-95 (3).

SEMA4C-Plexin B2 signaling stimulates branching of the ureteric epithelium in the developing kidney through an interaction with the glial-cell-line-derived neurotrophic factor (GDNF) receptor RET receptor tyrosine kinase (19). RET is activated upon GDNF binding to GDNF-family receptor-α1 (GFRα1). RET forms a complex with GDNF-GFRα1, which leads to activation of the intracellular tyrosine kinase domain of RET and an association between RET and intracellular signaling proteins such as Src, FRS2 (fibroblast growth factor receptor substrate 2), GRB2 (growth factor receptor-bound protein 2), and Shc (Src-homologous and collagen-like protein) (20). RET stimulation leads to downstream signaling that potentiates neuronal survival and differentiation (20;21).

SEMA4C is also required for p38 MAPK activation during TGF-β1-induced epithelial-mesenchymal transition (EMT) in proximal renal tubular epithelial cells (22;23) as well as in myogenic differentiation (23). Tubular epithelial cell EMT is essential for renal tubulointerstitial fibrosis (24). During EMT, activated p38 either directly regulates the protein synthesis of α-smooth muscle cell actin (α-SMA) (25), indirectly activates the Smad pathway (26), or leads to excessive matrix deposition to induce the fibrotic process.

Plexin-B2-associated signaling is required for mitotic spindle orientation during epithelial morphogenesis and repair in the kidney (27). Loss of plexin-B2 or SEMA4C caused severe defects in epithelial architecture and function. Plexin-B2-associated signaling controls mitotic spindle orientation through the activation of the Rho GTPase Cdc42. Cdc42 is essential for correct spindle orientation in epithelial cells (28;29) as well as during neural (30) and lung (31) development.

SEMA4C expressed on follicular T helper (T_FH) cells is a receptor to germinal center (GC)-expressed plexin-B2 (32). SEMA4C-plexin-B2 signaling biases T_FH migration inwards at the GC edge to promote GC access. Loss of either SEMA4C or plexin-B2 causes T_FH accumulation along the GC border, impaired T-B cell interactions in the GC, aberrant plasma cell production, and aberrant affinity maturation.

Putative Mechanism

Sema4c-deficient (Sema4c^-/-) mice show exencephaly and subsequent neonatal lethality (23). Surviving Sema4c^-/- mice are viable and fertile, but exhibit cerebellar granule cell layer defects (e.g., gaps in rostral lobules, fusions of caudal lobules, and ectopic granule cells in the molecular layer) (33). The Sema4c^-/- mice also show ventral skin pigmentation defects (i.e., white belly spots) (33). The pigmentation defects observed in swirl and Sema4c^-/- mice is putatively caused by defects in melanocyte development (i.e., proliferation, migration, or differentiation); melanocytes are derived from the neural crest lineage (33).

Primers

PCR Primer
swirl_pcr_F: CCTGCTCCTCTGAATAGCAAC
swirl_pcr_R: ATGTGGCGAACTTGGACAC

Sequencing Primer
swirl_seq_F: TCCTCTGAATAGCAACGATAGGGTC
swirl_seq_R: CGAACTTGGACACTTCAAAGATGTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 416 nucleotides is amplified (chromosome 1, - strand):

1   atgtggcgaa cttggacact tcaaagatgt gtaaccagta tggcattaaa aaaggtgagc
61  tgttttcctt ttgttccctc attttgagga tgggcccctg gatcacagcc agagttagtt
121 tatcacctct cactgtggga cctggggttc ctgcattaac actgggttct ctctcatttc
181 tgcctctgca gtcagatcta ttcccaagaa catcaccgtt gtgtcaggca cagacctggt
241 cctaccctgc cacctctcgt ccaatttggc ccatgcccac tggaccttcg gaagccagga
301 cctgcctgca gaacaacctg gctcctttct ttatgacacg ggactccagg cgctggtggt
361 gatggccgca cagtcccgtc actctggacc ctatcgttgc tattcagagg agcagg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Simmons, A. D., Puschel, A. W., McPherson, J. D., Overhauser, J., and Lovett, M. (1998) Molecular Cloning and Mapping of Human Semaphorin F from the Cri-Du-Chat Candidate Interval. Biochem Biophys Res Commun. 242, 685-691.

  2. Inagaki, S., Furuyama, T., and Iwahashi, Y. (1995) Identification of a Member of Mouse Semaphorin Family. FEBS Lett. 370, 269-272.

  3. Inagaki, S., Ohoka, Y., Sugimoto, H., Fujioka, S., Amazaki, M., Kurinami, H., Miyazaki, N., Tohyama, M., and Furuyama, T. (2001) Sema4c, a Transmembrane Semaphorin, Interacts with a Post-Synaptic Density Protein, PSD-95. J Biol Chem. 276, 9174-9181.

  4. Ohoka, Y., Hirotani, M., Sugimoto, H., Fujioka, S., Furuyama, T., and Inagaki, S. (2001) Semaphorin 4C, a Transmembrane Semaphorin, [Corrected] Associates with a Neurite-Outgrowth-Related Protein, SFAP75. Biochem Biophys Res Commun. 280, 237-243.

  5. Shinozaki, K., Kume, H., Kuzume, H., Obata, K., and Maruyama, K. (1999) Norbin, a Neurite-Outgrowth-Related Protein, is a Cytosolic Protein Localized in the Somatodendritic Region of Neurons and Distributed Prominently in Dendritic Outgrowth in Purkinje Cells. Brain Res Mol Brain Res. 71, 364-368.

  6. Shinozaki, K., Maruyama, K., Kume, H., Kuzume, H., and Obata, K. (1997) A Novel Brain Gene, Norbin, Induced by Treatment of Tetraethylammonium in Rat Hippocampal Slice and Accompanied with Neurite-Outgrowth in Neuro 2a Cells. Biochem Biophys Res Commun. 240, 766-771.

  7. Ko, J. A., Gondo, T., Inagaki, S., and Inui, M. (2005) Requirement of the Transmembrane Semaphorin Sema4C for Myogenic Differentiation. FEBS Lett. 579, 2236-2242.

  8. Deng, S., Hirschberg, A., Worzfeld, T., Penachioni, J. Y., Korostylev, A., Swiercz, J. M., Vodrazka, P., Mauti, O., Stoeckli, E. T., Tamagnone, L., Offermanns, S., and Kuner, R. (2007) Plexin-B2, but Not Plexin-B1, Critically Modulates Neuronal Migration and Patterning of the Developing Nervous System in Vivo. J Neurosci. 27, 6333-6347.

  9. Paldy, E., Simonetti, M., Worzfeld, T., Bali, K. K., Vicuna, L., Offermanns, S., and Kuner, R. (2017) Semaphorin 4C Plexin-B2 Signaling in Peripheral Sensory Neurons is Pronociceptive in a Model of Inflammatory Pain. Nat Commun. 8, 176-017-00341-w.

  10. Kobayashi, K., Fukuoka, T., Obata, K., Yamanaka, H., Dai, Y., Tokunaga, A., and Noguchi, K. (2005) Distinct Expression of TRPM8, TRPA1, and TRPV1 mRNAs in Rat Primary Afferent Neurons with adelta/c-Fibers and Colocalization with Trk Receptors. J Comp Neurol. 493, 596-606.

  11. Vesey, D. A. (2010) Transport Pathways for Cadmium in the Intestine and Kidney Proximal Tubule: Focus on the Interaction with Essential Metals. Toxicol Lett. 198, 13-19.

  12. Ramsey, I. S., Delling, M., and Clapham, D. E. (2006) An Introduction to TRP Channels. Annu Rev Physiol. 68, 619-647.

  13. Giordano, S., Corso, S., Conrotto, P., Artigiani, S., Gilestro, G., Barberis, D., Tamagnone, L., and Comoglio, P. M. (2002) The Semaphorin 4D Receptor Controls Invasive Growth by Coupling with Met. Nat Cell Biol. 4, 720-724.

  14. Swiercz, J. M., Kuner, R., and Offermanns, S. (2004) Plexin-B1/RhoGEF-Mediated RhoA Activation Involves the Receptor Tyrosine Kinase ErbB-2. J Cell Biol. 165, 869-880.

  15. Kornau, H. C., Seeburg, P. H., and Kennedy, M. B. (1997) Interaction of Ion Channels and Receptors with PDZ Domain Proteins. Curr Opin Neurobiol. 7, 368-373.

  16. Ranganathan, R., and Ross, E. M. (1997) PDZ Domain Proteins: Scaffolds for Signaling Complexes. Curr Biol. 7, R770-3.

  17. Tsunoda, S., Sierralta, J., Sun, Y., Bodner, R., Suzuki, E., Becker, A., Socolich, M., and Zuker, C. S. (1997) A Multivalent PDZ-Domain Protein Assembles Signalling Complexes in a G-Protein-Coupled Cascade. Nature. 388, 243-249.

  18. Kim, E., Cho, K. O., Rothschild, A., and Sheng, M. (1996) Heteromultimerization and NMDA Receptor-Clustering Activity of Chapsyn-110, a Member of the PSD-95 Family of Proteins. Neuron. 17, 103-113.

  19. Perala, N., Jakobson, M., Ola, R., Fazzari, P., Penachioni, J. Y., Nymark, M., Tanninen, T., Immonen, T., Tamagnone, L., and Sariola, H. (2011) Sema4C-Plexin B2 Signalling Modulates Ureteric Branching in Developing Kidney. Differentiation. 81, 81-91.

  20. Paratcha, G., Ledda, F., Baars, L., Coulpier, M., Besset, V., Anders, J., Scott, R., and Ibanez, C. F. (2001) Released GFRalpha1 Potentiates Downstream Signaling, Neuronal Survival, and Differentiation Via a Novel Mechanism of Recruitment of c-Ret to Lipid Rafts. Neuron. 29, 171-184.

  21. Coulpier, M., Anders, J., and Ibanez, C. F. (2002) Coordinated Activation of Autophosphorylation Sites in the RET Receptor Tyrosine Kinase: Importance of Tyrosine 1062 for GDNF Mediated Neuronal Differentiation and Survival. J Biol Chem. 277, 1991-1999.

  22. Zeng, R., Han, M., Luo, Y., Li, C., Pei, G., Liao, W., Bai, S., Ge, S., Liu, X., and Xu, G. (2011) Role of Sema4C in TGF-beta1-Induced Mitogen-Activated Protein Kinase Activation and Epithelial-Mesenchymal Transition in Renal Tubular Epithelial Cells. Nephrol Dial Transplant. 26, 1149-1156.

  23. Wu, H., Wang, X., Liu, S., Wu, Y., Zhao, T., Chen, X., Zhu, L., Wu, Y., Ding, X., Peng, X., Yuan, J., Wang, X., Fan, W., and Fan, M. (2007) Sema4C Participates in Myogenic Differentiation in Vivo and in Vitro through the p38 MAPK Pathway. Eur J Cell Biol. 86, 331-344.

  24. Liu, Y. (2004) Epithelial to Mesenchymal Transition in Renal Fibrogenesis: Pathologic Significance, Molecular Mechanism, and Therapeutic Intervention. J Am Soc Nephrol. 15, 1-12.

  25. Sebe, A., Leivonen, S. K., Fintha, A., Masszi, A., Rosivall, L., Kahari, V. M., and Mucsi, I. (2008) Transforming Growth Factor-Beta-Induced Alpha-Smooth Muscle Cell Actin Expression in Renal Proximal Tubular Cells is Regulated by p38beta Mitogen-Activated Protein Kinase, Extracellular Signal-Regulated Protein kinase1,2 and the Smad Signalling during Epithelial-Myofibroblast Transdifferentiation. Nephrol Dial Transplant. 23, 1537-1545.

  26. Rhyu, D. Y., Yang, Y., Ha, H., Lee, G. T., Song, J. S., Uh, S. T., and Lee, H. B. (2005) Role of Reactive Oxygen Species in TGF-beta1-Induced Mitogen-Activated Protein Kinase Activation and Epithelial-Mesenchymal Transition in Renal Tubular Epithelial Cells. J Am Soc Nephrol. 16, 667-675.

  27. Xia, J., Swiercz, J. M., Banon-Rodriguez, I., Matkovic, I., Federico, G., Sun, T., Franz, T., Brakebusch, C. H., Kumanogoh, A., Friedel, R. H., Martin-Belmonte, F., Grone, H. J., Offermanns, S., and Worzfeld, T. (2015) Semaphorin-Plexin Signaling Controls Mitotic Spindle Orientation during Epithelial Morphogenesis and Repair. Dev Cell. 33, 299-313.

  28. Bray, K., Brakebusch, C., and Vargo-Gogola, T. (2011) The Rho GTPase Cdc42 is Required for Primary Mammary Epithelial Cell Morphogenesis in Vitro. Small GTPases. 2, 247-258.

  29. Jaffe, A. B., Kaji, N., Durgan, J., and Hall, A. (2008) Cdc42 Controls Spindle Orientation to Position the Apical Surface during Epithelial Morphogenesis. J Cell Biol. 183, 625-633.

  30. Kieserman, E. K., and Wallingford, J. B. (2009) In Vivo Imaging Reveals a Role for Cdc42 in Spindle Positioning and Planar Orientation of Cell Divisions during Vertebrate Neural Tube Closure. J Cell Sci. 122, 2481-2490.

  31. Wan, H., Liu, C., Wert, S. E., Xu, W., Liao, Y., Zheng, Y., and Whitsett, J. A. (2013) CDC42 is Required for Structural Patterning of the Lung during Development. Dev Biol. 374, 46-57.

  32. Yan, H., Wu, L., Shih, C., Hou, S., Shi, J., Mao, T., Chen, W., Melvin, B., Rigby, R. J., Chen, Y., Jiang, H., Friedel, R. H., Vinuesa, C. G., and Qi, H. (2017) Plexin B2 and Semaphorin 4C Guide T Cell Recruitment and Function in the Germinal Center. Cell Rep. 19, 995-1007.

  33. Maier, V., Jolicoeur, C., Rayburn, H., Takegahara, N., Kumanogoh, A., Kikutani, H., Tessier-Lavigne, M., Wurst, W., and Friedel, R. H. (2011) Semaphorin 4C and 4G are Ligands of Plexin-B2 Required in Cerebellar Development. Mol Cell Neurosci. 46, 419-431.