Phenotypic Mutation 'capitol_reef'

• Allele: capitol_reef
• Mutation Type: critical splice acceptor site
• Chromosome: 11
• Coordinate: 34,294,170 bp (GRCm38)
• Base Change: T ⇒ G (forward strand)
• Gene: Dock2
• Gene Name: dedicator of cyto-kinesis 2
• Synonym(s): CED-5, MBC, Hch
• Chromosomal Location: 34,226,815-34,783,892 bp (-)
• MGI Phenotype: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells.
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000090884] [ENSMUSP00000098916]
• SMART Domains: Protein: ENSMUSP00000090884; Gene: ENSMUSG00000020143

Domain	Start	End	E-Value	Type
SH3	11	68	1.22e-11	SMART
Pfam:DOCK_N	71	414	2e-113	PFAM
Pfam:DOCK-C2	419	616	1e-60	PFAM
Pfam:DHR-2	1114	1614	6.3e-96	PFAM
low complexity region	1691	1706	N/A	INTRINSIC
low complexity region	1793	1800	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000098916; Gene: ENSMUSG00000020143

Domain	Start	End	E-Value	Type
SH3	11	68	1.22e-11	SMART
Pfam:DOCK_N	71	414	1.4e-113	PFAM
Pfam:DOCK-C2	419	616	5.5e-61	PFAM
low complexity region	1163	1171	N/A	INTRINSIC

• Predicted Effect: probably null
• Phenotypic Category: OVA-specific IgE - increased, total IgE level - increased
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2016-12-02 4:06 PM by Katherine Timer
• Record Created: 2016-08-26 10:47 AM
• Record Posted: 2016-11-01
• Science Writers: Anne Murray
• Illustrators: Katherine Timer

Accession Number

NCBI RefSeq: NM_033374; MGI:2149010

Alleles Listed at MGI

All Mutations and Alleles(26) : Chemically induced (ENU)(8) Chemically induced (other)(1) Gene trapped(11) Spontaneous(1) Targeted(5)

Phenotypic Description

Figure 1. Capitol_reef mice exhibited increased IgE secretion. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Capitol_reef mice exhibited increased IgE secretion after immunization with ovalbumin adminstered with aluminum hydroxide. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The capitol_reef phenotype was identified among G3 mice of the pedigree R4742, some of which showed increased secretion of total IgE (Figure 1) and ovalbumin-specific IgE after immunization with ovalbumin administered with aluminum hydroxide (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the increased OVA-specific IgE using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 49 mutations (X-axis) identified in the G1 male of pedigree R4742. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 49 mutations. Both of the above phenotypes were linked by continuous variable mapping to a mutation in Dock2: a A to C transversion at base pair 34,294,170 (v38) on chromosome 11, or base pair 489,723 in the GenBank genomic region NC_000077 within the acceptor splice site of intron 31. The strongest association was found with a recessive model of linkage to the normalized amount of OVA-specific IgE, wherein two variant homozygotes departed phenotypically from 13 homozygous reference mice and 14 heterozygous mice with a P value of 3.568 x 10^-11 (Figure 3).  

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in an in-frame skipping of the 59-nucleotide exon 32 (out of 52 total exons).

 

<--exon 31   <--intron 31 exon 32-->         exon 33-->     <--exon 52 489621 ……AAAATCCTGAATAA……ttgctccttgcag GTACGGGGACATGAGA…… GCCAGAACAAA……ACCAACATGTGA 556214 1053   ……-K--I--L--N--K                --Y--G--D--M--R-…… G--Q--N--K-……-T--N--M--*- 1828             correct                        deleted                 correct

 

Genomic numbering corresponds to NC_000077. The acceptor splice site of intron 31, which is destroyed by the capitol_reef mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 4. Domain structure of mouse DOCK2. DOCK2 contains an N-terminal SH3 domain. SH3-containing DOCK proteins have been shown to interact physically with the scaffolding proteins engulfment and cell motility protein 1 (ELMO1) and ELMO2, significantly promoting Rac activation. The DHR-1 domain shares weak homology to the C2 domain. The large DHR-2 domain interacts with the nucleotide-free form of Rac. The location of the capitol_reef mutation is indicated. Click on the image to view other mutations found in DOCK2. Click on each mututation for more specific information.

DOCK2 belongs to the DOCK180 superfamily of guanine nucleotide exchange factors (GEFs) that have been shown to activate members of the Rho family of small GTPases [Figure 4; (1-4)]. Members of the DOCK A and B groups contain an N-terminal SH3 domain. Two domains are shared amongst all DOCK proteins, the catalytic DHR-2 (DOCK homology region 2) or CZH-2 (CDM-zizimin homology 2) domain (amino acids 1114-1620 in DOCK2) and the DHR-1 or CZH-1 domain (amino acids 420-662 in DOCK2) (2;4).  Several DOCK proteins, including DOCK2, appear to be localized to the plasma membrane via interaction of the DHR-1 domain with phosphatidylinositol (3,5)-biphosphate [PtdIns(3,5)P₂] and phosphatidylinositol (3,4,5) P₃ (PIP₃) signaling lipids (5;6). The DHR-2 domains of several DOCK family members interact with the nucleotide-free form of Rac and/or Cdc42 (2;4). DOCK2 has an N-terminal SH3 domain (amino acids 8-69). The capitol_reef mutation is within the splice acceptor site of intron 31 and is predicted to result in deletion of exon 32. Exon 32 encodes amino acids 1058-1076, which is an undefined region between the DHR-1 and DHR-2 domains.

 

For more information on Dock2, see the record for frazz.

Putative Mechanism

Rho GTPases are known regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation and apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, transcription and neurite extension and retraction. Regulation of Rho GTPase activity involves the GEFs that promote the exchange of GDP for GTP, the GTPase-activating proteins (GAPs) that enhance the GTPase activity of Rho proteins, and the Rho guanine nucleotide-dissociation inhibitors (RhoGDIs) that sequester Rho GTPases in a GDP-bound state. DOCK2 functions in the polarization and migration of immune cell subsets.  DOCK2 functions downstream of chemokine receptors to regulate Rac activation and migration of B and T lymphocytes, neutrophils, plasmacytoid dendritic cells (pDCs), and hematopoietic stem cells, but not monocytes or other myeloid cell types (6-10).  The immune cells affected by DOCK2 deficiency display aberrant homing, activation, adhesion, polarization and migration. DOCK2-deficient lymphocytes fail to respond normally to the chemokines CCL21, CCL19, CXCL13, and CXCL12, resulting in impaired homing to secondary lymphoid organs and aberrant morphology of these tissues (8). Dock2 ^{-/ -}mice display a number of immunological phenotypes including lack of marginal zone B cells, reduced numbers of mature CD4⁺ T cells and the major subset of natural killer T (NKT) cells expressing the semi-invariant Vα14 T cell receptor (TCR), and aberrant TCR signaling (8;11;12).  Similar to Dock2^{-/ -} mice, the Arches mice exhibit reduced frequencies of peripheral CD4⁺ T cells, indicating loss of function in DOCK2^Arches.

Primers

PCR Primer
capitol_reef(F):5'- TTTGGGTCATCACACAGGCAC -3'
capitol_reef(R):5'- TCAGACCCTCTCCATGACTG -3'

Sequencing Primer
capitol_reef_seq(F):5'- CAGGCACAGACTGACATATGCTG -3'
capitol_reef_seq(R):5'- GCTGTGGAACAACTATTTTCATCTGG -3'

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. Cote, J. F., and Vuori, K. (2002) Identification of an Evolutionarily Conserved Superfamily of DOCK180-Related Proteins with Guanine Nucleotide Exchange Activity. J Cell Sci. 115, 4901-4913.

  3. Cote, J. F., and Vuori, K. (2007) GEF what? Dock180 and Related Proteins Help Rac to Polarize Cells in New Ways. Trends Cell Biol. 17, 383-393.

  4. Meller, N., Irani-Tehrani, M., Kiosses, W. B., Del Pozo, M. A., and Schwartz, M. A. (2002) Zizimin1, a Novel Cdc42 Activator, Reveals a New GEF Domain for Rho Proteins. Nat Cell Biol. 4, 639-647.

  5. Meller, N., Merlot, S., and Guda, C. (2005) CZH Proteins: A New Family of Rho-GEFs. J Cell Sci. 118, 4937-4946.

  6. Cote, J. F., Motoyama, A. B., Bush, J. A., and Vuori, K. (2005) A Novel and Evolutionarily Conserved PtdIns(3,4,5)P3-Binding Domain is Necessary for DOCK180 Signalling. Nat Cell Biol. 7, 797-807.

  7. Kunisaki, Y., Nishikimi, A., Tanaka, Y., Takii, R., Noda, M., Inayoshi, A., Watanabe, K., Sanematsu, F., Sasazuki, T., Sasaki, T., and Fukui, Y. (2006) DOCK2 is a Rac Activator that Regulates Motility and Polarity during Neutrophil Chemotaxis. J Cell Biol. 174, 647-652.

  8. Nishikimi, A., Fukuhara, H., Su, W., Hongu, T., Takasuga, S., Mihara, H., Cao, Q., Sanematsu, F., Kanai, M., Hasegawa, H., Tanaka, Y., Shibasaki, M., Kanaho, Y., Sasaki, T., Frohman, M. A., and Fukui, Y. (2009) Sequential Regulation of DOCK2 Dynamics by Two Phospholipids during Neutrophil Chemotaxis. Science. 324, 384-387.

  9. Fukui, Y., Hashimoto, O., Sanui, T., Oono, T., Koga, H., Abe, M., Inayoshi, A., Noda, M., Oike, M., Shirai, T., and Sasazuki, T. (2001) Haematopoietic Cell-Specific CDM Family Protein DOCK2 is Essential for Lymphocyte Migration. Nature. 412, 826-831.

  10. Kikuchi, T., Kubonishi, S., Shibakura, M., Namba, N., Matsui, T., Fukui, Y., Tanimoto, M., and Katayama, Y. (2008) Dock2 Participates in Bone Marrow Lympho-Hematopoiesis. Biochem Biophys Res Commun. 367, 90-96.

  11. Gotoh, K., Tanaka, Y., Nishikimi, A., Inayoshi, A., Enjoji, M., Takayanagi, R., Sasazuki, T., and Fukui, Y. (2008) Differential Requirement for DOCK2 in Migration of Plasmacytoid Dendritic Cells Versus Myeloid Dendritic Cells. Blood. 111, 2973-2976.

  12. Kunisaki, Y., Tanaka, Y., Sanui, T., Inayoshi, A., Noda, M., Nakayama, T., Harada, M., Taniguchi, M., Sasazuki, T., and Fukui, Y. (2006) DOCK2 is Required in T Cell Precursors for Development of Valpha14 NK T Cells. J Immunol. 176, 4640-4645.

  13. Sanui, T., Inayoshi, A., Noda, M., Iwata, E., Oike, M., Sasazuki, T., and Fukui, Y. (2003) DOCK2 is Essential for Antigen-Induced Translocation of TCR and Lipid Rafts, but Not PKC-Theta and LFA-1, in T Cells. Immunity. 19, 119-129.