Phenotypic Mutation 'capitol_reef' (pdf version)
List |< first << previous [record 53 of 511] next >> last >|
Allelecapitol_reef
Mutation Type critical splice acceptor site
Chromosome11
Coordinate34,294,170 bp (GRCm38)
Base Change T ⇒ G (forward strand)
Gene Dock2
Gene Name dedicator of cyto-kinesis 2
Synonym(s) CED-5, MBC, Hch
Chromosomal Location 34,226,815-34,783,892 bp (-)
MGI Phenotype Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells.
Accession Number

NCBI RefSeq: NM_033374; MGI:2149010

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000090884] [ENSMUSP00000098916]
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000098916
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 1.4e-113 PFAM
Pfam:DOCK-C2 419 616 5.5e-61 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category increase in OVA-specific IgE, increase in total IgE level
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(26) : Chemically induced (ENU)(8) Chemically induced (other)(1) Gene trapped(11) Spontaneous(1) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dock2 APN 11 34704661 missense probably damaging 1.00
IGL00469:Dock2 APN 11 34229603 unclassified noncoding transcript
IGL01061:Dock2 APN 11 34705826 missense probably damaging 1.00
IGL01319:Dock2 APN 11 34698790 missense possibly damaging 0.61
IGL01451:Dock2 APN 11 34310390 missense probably damaging 1.00
IGL01490:Dock2 APN 11 34705781 missense probably damaging 0.97
IGL01601:Dock2 APN 11 34239528 unclassified probably null
IGL01800:Dock2 APN 11 34756273 missense probably damaging 1.00
IGL01804:Dock2 APN 11 34262433 missense probably benign 0.01
IGL01823:Dock2 APN 11 34262391 missense probably damaging 1.00
IGL01829:Dock2 APN 11 34705841 missense probably damaging 0.98
IGL01830:Dock2 APN 11 34691917 nonsense probably null
IGL01835:Dock2 APN 11 34310435 missense possibly damaging 0.51
IGL01845:Dock2 APN 11 34708865 missense probably benign 0.02
IGL01953:Dock2 APN 11 34732356 missense probably benign 0.28
IGL01989:Dock2 APN 11 34268053 missense probably benign
IGL02081:Dock2 APN 11 34254355 missense probably benign
IGL02105:Dock2 APN 11 34714525 missense probably damaging 1.00
IGL02153:Dock2 APN 11 34230670 missense probably benign 0.01
IGL02170:Dock2 APN 11 34267949 unclassified probably damaging 1.00
IGL02344:Dock2 APN 11 34731510 missense probably damaging 0.98
IGL02389:Dock2 APN 11 34698740 unclassified noncoding transcript
IGL02409:Dock2 APN 11 34501204 missense probably benign 0.00
IGL02472:Dock2 APN 11 34249801 missense probably benign 0.00
IGL02625:Dock2 APN 11 34501168 unclassified probably null
IGL02929:Dock2 APN 11 34268048 missense probably damaging 1.00
IGL02951:Dock2 APN 11 34310448 unclassified noncoding transcript
IGL02999:Dock2 APN 11 34692259 missense probably damaging 0.99
IGL03165:Dock2 APN 11 34687533 missense probably damaging 0.99
Arches UTSW 11 34689760 missense probably damaging 1.00
denali UTSW 11 34229472 critical splice donor site probably null
dew UTSW 11 34248636 nonsense
frazz UTSW 11 34248572 critical splice donor site
frizz UTSW 11 34258184 splice acceptor site
liaoning UTSW 11 34708793 missense probably damaging 1.00
IGL03052:Dock2 UTSW 11 34232853 missense probably benign 0.01
R0006:Dock2 UTSW 11 34312453 splice donor site noncoding transcript
R0012:Dock2 UTSW 11 34783795 missense possibly damaging 0.51
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0116:Dock2 UTSW 11 34688565 splice acceptor site noncoding transcript
R0149:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0361:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0462:Dock2 UTSW 11 34268052 missense possibly damaging 0.74
R0471:Dock2 UTSW 11 34688553 missense probably benign 0.30
R0538:Dock2 UTSW 11 34704718 splice acceptor site noncoding transcript
R0543:Dock2 UTSW 11 34294325 missense probably damaging 1.00
R0660:Dock2 UTSW 11 34248621 missense probably damaging 1.00
R0676:Dock2 UTSW 11 34695236 missense probably damaging 0.99
R0722:Dock2 UTSW 11 34464970 splice acceptor site noncoding transcript
R0801:Dock2 UTSW 11 34708793 missense probably damaging 1.00
R1110:Dock2 UTSW 11 34256535 missense possibly damaging 0.78
R1121:Dock2 UTSW 11 34756291 splice acceptor site noncoding transcript
R1171:Dock2 UTSW 11 34695241 missense probably damaging 1.00
R1387:Dock2 UTSW 11 34273309 splice acceptor site
R1435:Dock2 UTSW 11 34718836 splice donor site noncoding transcript
R1445:Dock2 UTSW 11 34239705 missense probably benign
R1494:Dock2 UTSW 11 34282761 nonsense probably null
R1589:Dock2 UTSW 11 34706461 missense probably damaging 0.99
R1597:Dock2 UTSW 11 34704647 missense probably benign 0.00
R1616:Dock2 UTSW 11 34363848 splice donor site
R1629:Dock2 UTSW 11 34262480 splice acceptor site probably null
R1749:Dock2 UTSW 11 34232767 critical splice donor site probably null
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1899:Dock2 UTSW 11 34294286 missense probably benign 0.25
R1924:Dock2 UTSW 11 34464934 missense possibly damaging 0.69
R2031:Dock2 UTSW 11 34727470 splice acceptor site noncoding transcript
R2045:Dock2 UTSW 11 34294106 splice donor site
R2098:Dock2 UTSW 11 34266279 missense probably benign 0.16
R2098:Dock2 UTSW 11 34719005 missense probably damaging 0.99
R2129:Dock2 UTSW 11 34727415 missense probably damaging 1.00
R2147:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2149:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2150:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2176:Dock2 UTSW 11 34695217 missense probably benign 0.00
R2185:Dock2 UTSW 11 34227740 splice acceptor site noncoding transcript
R2230:Dock2 UTSW 11 34294323 missense probably damaging 0.99
R2508:Dock2 UTSW 11 34312485 missense probably benign 0.04
R2875:Dock2 UTSW 11 34718885 missense probably damaging 1.00
R2885:Dock2 UTSW 11 34689766 missense probably damaging 1.00
R2910:Dock2 UTSW 11 34232910 unclassified noncoding transcript
R3081:Dock2 UTSW 11 34231610 missense probably benign
R3418:Dock2 UTSW 11 34689760 missense probably damaging 1.00
R3552:Dock2 UTSW 11 34720960 missense probably benign 0.22
R3731:Dock2 UTSW 11 34708895 missense probably damaging 1.00
R3846:Dock2 UTSW 11 34732371 missense possibly damaging 0.81
R4135:Dock2 UTSW 11 34714501 missense possibly damaging 0.83
R4598:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4599:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4715:Dock2 UTSW 11 34294118 missense probably damaging 1.00
R4722:Dock2 UTSW 11 34695471 missense probably damaging 1.00
R4742:Dock2 UTSW 11 34294170 unclassified probably null
R4830:Dock2 UTSW 11 34273767 splice site probably null
R4884:Dock2 UTSW 11 34266248 missense probably damaging 1.00
R4990:Dock2 UTSW 11 34695251 missense probably damaging 1.00
R5334:Dock2 UTSW 11 34228643 missense probably benign 0.00
R5570:Dock2 UTSW 11 34727406 missense probably damaging 1.00
R5602:Dock2 UTSW 11 34254391 missense probably benign 0.16
R5809:Dock2 UTSW 11 34262445 missense probably benign
R5860:Dock2 UTSW 11 34256562 missense probably damaging 1.00
R6111:Dock2 UTSW 11 34708787 missense probably damaging 0.99
R6155:Dock2 UTSW 11 34294123 missense probably benign 0.06
R6156:Dock2 UTSW 11 34247789 missense possibly damaging 0.51
R6173:Dock2 UTSW 11 34262388 missense probably null 0.80
R6182:Dock2 UTSW 11 34229476 missense probably damaging 0.97
X0017:Dock2 UTSW 11 34266271 missense probably benign 0.08
X0018:Dock2 UTSW 11 34232833 missense possibly damaging 0.65
X0022:Dock2 UTSW 11 34261564 splice acceptor site probably benign
X0058:Dock2 UTSW 11 34256564 missense probably damaging 1.00
X0066:Dock2 UTSW 11 34310357 missense possibly damaging 0.95
Z1088:Dock2 UTSW 11 34438300 missense probably benign 0.14
Z1088:Dock2 UTSW 11 34692382 missense probably damaging 1.00
Z1088:Dock2 UTSW 11 34695212 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 12/02/2016 4:06 PM by Katherine Timer
Record Created 08/26/2016 10:47 AM
Record Posted 11/01/2016
Phenotypic Description

Figure 1. Capitol_reef mice exhibited increased IgE secretion. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Capitol_reef mice exhibited increased IgE secretion after immunization with ovalbumin adminstered with aluminum hydroxide. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The capitol_reef phenotype was identified among G3 mice of the pedigree R4742, some of which showed increased secretion of total IgE (Figure 1) and ovalbumin-specific IgE after immunization with ovalbumin administered with aluminum hydroxide (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the increased OVA-specific IgE using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 49 mutations (X-axis) identified in the G1 male of pedigree R4742. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 49 mutations. Both of the above phenotypes were linked by continuous variable mapping to a mutation in Dock2: a A to C transversion at base pair 34,294,170 (v38) on chromosome 11, or base pair 489,723 in the GenBank genomic region NC_000077 within the acceptor splice site of intron 31. The strongest association was found with a recessive model of linkage to the normalized amount of OVA-specific IgE, wherein two variant homozygotes departed phenotypically from 13 homozygous reference mice and 14 heterozygous mice with a P value of 3.568 x 10-11 (Figure 3).  

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in an in-frame skipping of the 59-nucleotide exon 32 (out of 52 total exons).

 

             <--exon 31   <--intron 31 exon 32-->         exon 33-->     <--exon 52

489621 ……AAAATCCTGAATAA……ttgctccttgcag GTACGGGGACATGAGA…… GCCAGAACAAA……ACCAACATGTGA 556214
1053   ……-K--I--L--N--K                --Y--G--D--M--R-…… G--Q--N--K-……-T--N--M--*- 1828

            correct                        deleted                 correct

 

Genomic numbering corresponds to NC_000077. The acceptor splice site of intron 31, which is destroyed by the capitol_reef mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 4. Domain structure of mouse DOCK2. DOCK2 contains an N-terminal SH3 domain. SH3-containing DOCK proteins have been shown to interact physically with the scaffolding proteins engulfment and cell motility protein 1 (ELMO1) and ELMO2, significantly promoting Rac activation. The DHR-1 domain shares weak homology to the C2 domain. The large DHR-2 domain interacts with the nucleotide-free form of Rac. The location of the capitol_reef mutation is indicated. Click on the image to view other mutations found in DOCK2. Click on each mututation for more specific information.

DOCK2 belongs to the DOCK180 superfamily of guanine nucleotide exchange factors (GEFs) that have been shown to activate members of the Rho family of small GTPases [Figure 4; (1-4)]. Members of the DOCK A and B groups contain an N-terminal SH3 domain. Two domains are shared amongst all DOCK proteins, the catalytic DHR-2 (DOCK homology region 2) or CZH-2 (CDM-zizimin homology 2) domain (amino acids 1114-1620 in DOCK2) and the DHR-1 or CZH-1 domain (amino acids 420-662 in DOCK2) (2;4).  Several DOCK proteins, including DOCK2, appear to be localized to the plasma membrane via interaction of the DHR-1 domain with phosphatidylinositol (3,5)-biphosphate [PtdIns(3,5)P2] and phosphatidylinositol (3,4,5) P3 (PIP3) signaling lipids (5;6). The DHR-2 domains of several DOCK family members interact with the nucleotide-free form of Rac and/or Cdc42 (2;4). DOCK2 has an N-terminal SH3 domain (amino acids 8-69). The capitol_reef mutation is within the splice acceptor site of intron 31 and is predicted to result in deletion of exon 32. Exon 32 encodes amino acids 1058-1076, which is an undefined region between the DHR-1 and DHR-2 domains.

 

For more information on Dock2, see the record for frazz.

Putative Mechanism

Rho GTPases are known regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation and apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, transcription and neurite extension and retraction. Regulation of Rho GTPase activity involves the GEFs that promote the exchange of GDP for GTP, the GTPase-activating proteins (GAPs) that enhance the GTPase activity of Rho proteins, and the Rho guanine nucleotide-dissociation inhibitors (RhoGDIs) that sequester Rho GTPases in a GDP-bound state. DOCK2 functions in the polarization and migration of immune cell subsets.  DOCK2 functions downstream of chemokine receptors to regulate Rac activation and migration of B and T lymphocytes, neutrophils, plasmacytoid dendritic cells (pDCs), and hematopoietic stem cells, but not monocytes or other myeloid cell types (6-10).  The immune cells affected by DOCK2 deficiency display aberrant homing, activation, adhesion, polarization and migration. DOCK2-deficient lymphocytes fail to respond normally to the chemokines CCL21, CCL19, CXCL13, and CXCL12, resulting in impaired homing to secondary lymphoid organs and aberrant morphology of these tissues (8)Dock2 -/ -mice display a number of immunological phenotypes including lack of marginal zone B cells, reduced numbers of mature CD4+ T cells and the major subset of natural killer T (NKT) cells expressing the semi-invariant Vα14 T cell receptor (TCR), and aberrant TCR signaling (8;11;12).  Similar to Dock2-/ - mice, the Arches mice exhibit reduced frequencies of peripheral CD4+ T cells, indicating loss of function in DOCK2Arches.

Primers PCR Primer
capitol_reef(F):5'- TTTGGGTCATCACACAGGCAC -3'
capitol_reef(R):5'- TCAGACCCTCTCCATGACTG -3'

Sequencing Primer
capitol_reef_seq(F):5'- CAGGCACAGACTGACATATGCTG -3'
capitol_reef_seq(R):5'- GCTGTGGAACAACTATTTTCATCTGG -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
List |< first << previous [record 53 of 511] next >> last >|