Phenotypic Mutation 'sooni'

• Allele: sooni
• Mutation Type: missense
• Chromosome: 19
• Coordinate: 41,316,348 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Pik3ap1
• Gene Name: phosphoinositide-3-kinase adaptor protein 1
• Synonym(s): BCAP, 1810044J04Rik
• Chromosomal Location: 41,260,980-41,373,541 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in B cell maturation. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 41274218 - 41385070 bp
• Amino Acid Change: Serine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000052777]
• AlphaFold: Q9EQ32
• SMART Domains: Protein: ENSMUSP00000052777; Gene: ENSMUSG00000025017; AA Change: S305P

Domain	Start	End	E-Value	Type
DBB	180	319	8.55e-75	SMART
SCOP:d1bd8__	331	396	8e-5	SMART
Blast:ANK	336	365	1e-7	BLAST
low complexity region	533	552	N/A	INTRINSIC
low complexity region	716	740	N/A	INTRINSIC
low complexity region	802	808	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000059672)
• Meta Mutation Damage Score: 0.9099
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm
• Last Updated: 2019-09-04 9:42 PM by Diantha La Vine
• Record Created: 2016-08-26 6:27 PM by Jin Huk Choi
• Record Posted: 2016-12-13
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Jin Huk Choi, James Butler, Bruce Beutler

Accession Number

NCBI Refseq: NM_031376.3; MGI:1933177

Alleles Listed at MGI

All Mutations and Alleles(6) :  Chemically induced (ENU)(2) Targeted(4)

Phenotypic Description

Figure 1. Sooni mice exhibit diminished T-independent IgM responses to NP-Ficoll. IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The sooni phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4654, some of which exhibited a diminished T-independent antibody (IgM) response to NP-Ficoll (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced T-independent response to NP-Ficoll using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 97 mutations (X-axis) identified in the G1 male of pedigree R4654. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 97 mutations. The diminished T-independent antibody (IgM) response to NP-Ficoll was linked to a mutation in Pik3ap1: a T to C transition at base pair 41,327,909 (v38) on chromosome 19, or base pair 57,162 in the GenBank genomic region NC_000085 encoding Pik3ap1. Linkage was found with a recessive model of inheritance, wherein seven variant homozygotes departed phenotypically from 11 homozygous reference mice and 19 heterozygous mice with a P value of 2.4 x 10^-5 (Figure 2). A substantial semidominant effect was also observed (P = 4.06 x 10^-5).

The mutation corresponds to residue 1,014 in the NM_031376.3 mRNA sequence in exon 6 of 17 total exons. 

999 AAACTGCTCACCGAGTCCCTGAAGAACAACATC 300 -K--L--L--T--E--S--L--K--N--N--I-

The mutated nucleotide is indicated in red.  The mutation results in a serine (S) to proline (P) substitution at position 305 (S305P) in the B cell adaptor protein (BCAP) protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999).

Protein Prediction

Figure 3. The domain structure of BCAP.  BCAP has a Dof/BCAP/BANK (DBB) domain (aa 182-318), an ankyrin repeat-like sequence (aa 333-401), a coiled-coil sequence (aa 636-669), and proline-rich sequences (aa 530-552, 760-808).  Tyrosinses within YxNx (Y387), YxxV (Y513) and YxxM (Y264, Y420, Y445 and Y460) sequences are phosphorylated upon B-cell receptor activation and facilitate the binding of BCAP to Grb2, SHP-2 and BTK/Syk, respectively.  The sooni mutation is a serine (S) to proline (P) substitution at position 305 (S305P). This image is interactive. Other mutations found in BCAP are noted in red. Click on each mutation for more information.

BCAP shares several structural features with other adaptor proteins including BANK (B-cell scaffold protein with ankyrin repeats), an adaptor for CD40, a protein present on antigen presenting cells (see walla, a mutation in CD40 ligand) and with the Drosophila protein Dof (Downstream of FGF receptor), an adaptor that is essential in FGF-mediated signaling (1;2). The domains of BCAP include:  an ankyrin repeat-like sequence (aa 333-401), a predicted coiled-coil forming sequence (aa 636-669), proline-rich sequences (3 in mouse; aa 530-552, 760-808) and a region designated the Dof/BCAP/BANK (DBB) domain (aa 182-318) (3-6) (Figure 3). The proline-rich region at the C-terminus of BCAP facilitates interaction between BCAP and the N-terminal SH3 domains of Src protein tyrosine kinases (PTKs), PLC-γ, and Grb2 (7).  Tyrosine motifs (YxNx, YxxV, and YxxM) facilitate the binding of BCAP to Grb2, SHP-2 and BTK/Syk, respectively.  Following B cell activation, BCAP is phosphorylated at four tyrosine residues (Y264, Y420, Y445 and Y460) within 4 respective YxxM motifs by BTK and Syk activation (3;8;9). 

The sooni mutation results in a serine (S) to proline (P) substitution at position 305 (S305P); residue 305 is within the DBB domain. The function DBB domain remains unknown. The DBB domain may be important for the subcellular localization of BCAP through interactions with other proteins (7).  In Drosophila development, the DBB domain of Dof was required for FGF-dependent signal transduction (4). In yeast two-hybrid assays, the DBB domain was required for Dof to interact with the Drosophila FGF receptor, Heartless, and for Dof to homodimerize (3). 

For more information about Pik3ap1, please see the record for sothe.

Putative Mechanism

In B cell receptor (BCR)-mediated signaling, either transmembrane (i.e. CD19) or cytosolic adaptors (i.e. TC21, Cbl, Gab, B-cell linker (BLNK (see busy) or SLP-65), and BCAP are tyrosine phosphorylated on their YxxM motifs by protein tyrosine kinases (i.e. Btk, Syk and/or Lyn) and subsequently associate with PI3K to amplify and integrate several signaling pathways (6;7;10-13).  Upon activation of BCR-mediated signaling, Syk initiates BCAP phosphorylation, while Btk sustains it.  Lyn negatively regulates BCAP phosphorylation by initiating the phosphorylation of immunoreceptor tyrosine-based inhibition motifs (ITIMS) on inhibitory receptor proteins CD22 and PIRB (7;14).  BCAP and CD19 have a complementary role in P13K activation:  upon BCAP binding to PI3K, there is an upregulation in PI3K activity and PI3K translocates to CD19-bearing lipid rafts rich in PI(4,5)P₂ (15;16). 

The canonical Pik3ap1 variant, negatively regulates interleukin (IL)-6 (a pro-inflammatory cytokine) and IL-10 (an anti-inflammatory cytokine) production mediated by lipopolysaccharides in T cell-independent B cell immune responses (8). Similar to sothe and BCAP deficient mice, the sooni mice are unable to mount a T-independent B cell response (6). Similarity between the sooni and BCAP-deficient phenotypes is consistent with a strongly hypomorphic or null effect of S305P.

Primers

PCR Primer
sooni_pcr_F: TGTGTCATGGCAGCAGCATC
sooni_pcr_R: AGGAGAAGACCCGAGCTTTC

Sequencing Primer
sooni_seq_F: ATGGCAGCAGCATCCTCCTATG
sooni_seq_R: AAGACCCGAGCTTTCTGGACATG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 408 nucleotides is amplified (chromosome 19, - strand):

1   aggagaagac ccgagctttc tggacatggg aattgtacat ggggctattc agctttaacc
61  ttgactggca ggcgctagct ggatttgaaa cctgaccgtc ttcactgttt tatgtaggcc
121 tttaaaatcg tgccctacaa cacagagact ctcgataaac tgctcaccga gtccctgaag
181 aacaacatcc ccgcaagtgg actgcacctc tttgggatca accaactgga agaagacgat
241 atgatgacaa gtatgtcagc ggtcatttca gtcgtagatg gtgtggcctg ccacacaact
301 gggccatgtg atctggggag ggcatagctt catccgccag caccaaggtg aaccgaaaga
361 caggattaaa ctaagcaaca cataggagga tgctgctgcc atgacaca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Aiba, Y., Yamazaki, T., Okada, T., Gotoh, K., Sanjo, H., Ogata, M., and Kurosaki, T. (2006) BANK Negatively Regulates Akt Activation and Subsequent B Cell Responses. Immunity. 24, 259-268.

  2. Yokoyama, K., Su Ih, I. H., Tezuka, T., Yasuda, T., Mikoshiba, K., Tarakhovsky, A., and Yamamoto, T. (2002) BANK Regulates BCR-Induced Calcium Mobilization by Promoting Tyrosine Phosphorylation of IP(3) Receptor. EMBO J. 21, 83-92.

  3. Battersby, A., Csiszar, A., Leptin, M., and Wilson, R. (2003) Isolation of Proteins that Interact with the Signal Transduction Molecule Dof and Identification of a Functional Domain Conserved between Dof and Vertebrate BCAP. J Mol Biol. 329, 479-493.

  4. Wilson, R., Battersby, A., Csiszar, A., Vogelsang, E., and Leptin, M. (2004) A Functional Domain of Dof that is Required for Fibroblast Growth Factor Signaling. Mol Cell Biol. 24, 2263-2276.

  5. Yamazaki, T., and Kurosaki, T. (2003) Contribution of BCAP to Maintenance of Mature B Cells through c-Rel. Nat Immunol. 4, 780-786.

  6. Yamazaki, T., Takeda, K., Gotoh, K., Takeshima, H., Akira, S., and Kurosaki, T. (2002) Essential Immunoregulatory Role for BCAP in B Cell Development and Function. J Exp Med. 195, 535-545.

  7. Okada, T., Maeda, A., Iwamatsu, A., Gotoh, K., and Kurosaki, T. (2000) BCAP: The Tyrosine Kinase Substrate that Connects B Cell Receptor to Phosphoinositide 3-Kinase Activation. Immunity. 13, 817-827.

  8. Matsumura, T., Oyama, M., Kozuka-Hata, H., Ishikawa, K., Inoue, T., Muta, T., Semba, K., and Inoue, J. (2010) Identification of BCAP-(L) as a Negative Regulator of the TLR Signaling-Induced Production of IL-6 and IL-10 in Macrophages by Tyrosine Phosphoproteomics. Biochem Biophys Res Commun. 400, 265-270.

  9. Inabe, K., and Kurosaki, T. (2002) Tyrosine Phosphorylation of B-Cell Adaptor for Phosphoinositide 3-Kinase is Required for Akt Activation in Response to CD19 Engagement. Blood. 99, 584-589.

  10. MacFarlane, A. W.,4th, Yamazaki, T., Fang, M., Sigal, L. J., Kurosaki, T., and Campbell, K. S. (2008) Enhanced NK-Cell Development and Function in BCAP-Deficient Mice. Blood. 112, 131-140.

  11. Baracho, G. V., Miletic, A. V., Omori, S. A., Cato, M. H., and Rickert, R. C. (2011) Emergence of the PI3-Kinase Pathway as a Central Modulator of Normal and Aberrant B Cell Differentiation. Curr Opin Immunol. 23, 178-183.

  12. Qin, S., and Chock, P. B. (2003) Implication of Phosphatidylinositol 3-Kinase Membrane Recruitment in Hydrogen Peroxide-Induced Activation of PI3K and Akt. Biochemistry. 42, 2995-3003.

  13. Gupta, N., Delrow, J., Drawid, A., Sengupta, A. M., Fan, G., and Gelinas, C. (2008) Repression of B-Cell Linker (BLNK) and B-Cell Adaptor for Phosphoinositide 3-Kinase (BCAP) is Important for Lymphocyte Transformation by Rel Proteins. Cancer Res. 68, 808-814.

  14. Kurosaki, T., and Kurosaki, M. (1997) Transphosphorylation of Bruton's Tyrosine Kinase on Tyrosine 551 is Critical for B Cell Antigen Receptor Function. J Biol Chem. 272, 15595-15598.

  15. Aiba, Y., Kameyama, M., Yamazaki, T., Tedder, T. F., and Kurosaki, T. (2008) Regulation of B-Cell Development by BCAP and CD19 through their Binding to Phosphoinositide 3-Kinase. Blood. 111, 1497-1503.

  16. Uinuk-Ool, T., Mayer, W. E., Sato, A., Dongak, R., Cooper, M. D., and Klein, J. (2002) Lamprey Lymphocyte-Like Cells Express Homologs of Genes Involved in Immunologically Relevant Activities of Mammalian Lymphocytes. Proc Natl Acad Sci U S A. 99, 14356-14361.