Allele | taz | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 170,986,379 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | C ⇒ T (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Mpz | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | myelin protein zero | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Mpp, P0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 170,978,282-170,988,699 bp (+) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: This gene is specifically expressed in Schwann cells of the peripheral nervous system and encodes a type I transmembrane glycoprotein that is a major structural protein of the peripheral myelin sheath. The encoded protein contains a large hydrophobic extracellular domain and a smaller basic intracellular domain, which are essential for the formation and stabilization of the multilamellar structure of the compact myelin. Mutations in the orthologous gene in human are associated with myelinating neuropathies. A recent study showed that two isoforms are produced from the same mRNA by use of alternative in-frame translation termination codons via a stop codon readthrough mechanism. Alternatively spliced transcript variants have also been found for this gene. [provided by RefSeq, Oct 2015] PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit premature death, infertility, neurological behavior defects, and demyelination. Mice homozygous for a knock-out allele exhibit abnormal myelination and neurological behavior defects. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_001315499 (variant 1), NM_001315500 (variant 1), NM_008623 (variant 2); MGI:103177 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Arginine changed to Cysteine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000066701] [ENSMUSP00000106966] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | no structure available at present | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000066701 Gene: ENSMUSG00000056569 AA Change: R98C
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000106966 Gene: ENSMUSG00000056569 AA Change: R98C
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.9623 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Probably nonessential (E-score: 0.088) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(23) : Chemically induced (ENU)(1) Chemically induced (other)(2) Endonuclease-mediated(2) Gene trapped(6) Spontaneous(1) Targeted(2) Transgenic(9) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Live Mice | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:42 PM by Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2016-09-14 2:14 PM by Jamie Russell | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2018-04-11 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The taz phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4857, some of which showed ataxia. Some mice also pulled their hind legs together close to their bodies when picked up they their tail (Figure 1). |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 111 mutations. The behavioral phenotype was linked to a mutation in Mpz: a C to T transition at base pair 171,158,810 (v38) on chromosome 1, or base pair 8,098 in the GenBank genomic region NC_000067 encoding Mpz. Linkage was found with a recessive model of inheritance (P = 2.32 x 10-4), wherein four affected mice were homozygous for the variant allele, and 15 unaffected mice were either heterozygous (n = 8) or homozygous (n = 7) for the reference allele (Figure 2). The mutation corresponds to residue 458 in the NM_008623 mRNA sequence in exon 5 of 8 total exons and residue 356 in the NM_001315499 and NM_001315500 mRNA sequences in exon 3 of 6 total exons.
The mutated nucleotide is indicated in red. The mutation results in an arginine (R) to cysteine (C) substitution at position 98 (R98C) in both variants of the MPZ protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Mpz encodes myelin protein zero (MPZ), a member of the immunoglobulin supergene family. MPZ has a 29-amino acid signal peptide that is cleaved prior the insertion of the remaining protein into the myelin sheath (1). The mature MPZ protein is a single-pass transmembrane protein (Figure 3). The extracellular domain of MPZ is similar to an immunoglobulin variable region (Ig-like V-type) domain (2). The extracellular domain of rat MPZ forms a compact sandwich of beta-sheets held together by a disulfide bridge [PDB:1NEU; (3)]. Four MPZ extracellular domains can form cis interactions, which promote the formation of a doughnut-like structure around a large central hole (3). The MPZ homotetramers can subsequently interact in trans with the extracellular domains of MPZ tetramers from the opposing myelin wrap to form the intraperiod line of compact myelin (3). The intracellular domain of MPZ promotes MPZ-mediated homotypic adhesion. The intracellular domain also mediates compaction of the Schwann cell cytoplasm and formation of the major dense line in peripheral nervous system myelin. MPZ undergoes several posttranslational modifications necessary for its adhesion function. Mouse MPZ is phosphorylated by PKC at Ser210 and Ser233 (UniProt). MPZ is also phosphorylated at Ser226, Ser228, Ser237, and Ser243 [UniProt; (4)]. MPZ is acylated at Cys153 (5), forms a disulfide bond between Cys50 and Cys127 (locations in mouse MPZ) (6), and is glycosylated at Asn93 (Asn122 in mouse) (7). The taz mutation results in an arginine (R) to cysteine (C) substitution at position 98 (R98C); residue 98 is within the Ig-like V-type domain | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | MPZ is expressed only in myelinating Schwann cells of the peripheral nervous system. MPZ is normally targeted to the compact region of the mature myelin sheath. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
Most axons are insulated with myelin sheaths, which allows for the rapid propagation of nerve impulses.The myelin sheath is essential for the proper function of the nervous system. Myelin is a multilamellar membrane formed by oligodendrocytes in the central nervous system and by Schwann cells in the peripheral nervous system. During myelination, a glial process wraps around the axon, forming multiple layers of myelin and elongating along the axon. The myelinating glial cells organize the axons into segments: the nodes of Ranvier, paranode, and juxtaparanode (Figure 4). MPZ, peripheral myelin protein-22 (PMP22), connexin32 (CX32), and myelin basic protein (MBP) within the compact region of the mature myelin sheath participate in forming the myelin sheath and in reducing capacitance of the internode. Mpz-deficient (Mpz-/-) mice exhibit tremors, occasional convulsions, and defects in normal motor coordination (8). Mpz-/- mice exhibit loss of intraperiod lines and widening of the intraperiod spaces of the myelin sheath (8). In addition, Schwann cell loops were completely uncompacted and axon-Schwann cell units without myelin were observed (8;9). Mpz-/- mice exhibit severe hypomeylination with myelin decompaction (8;10;11). With age, myelin degeneration and onion bulb formation was observed. Axon degeneration was also observed in the Mpz-/- mice (8;12). Heterozygous (Mpz+/-) mice exhibited a less severe phenotype: myelin sheaths of the heterozygous mice were comparable to that in wild-type mice until four weeks of age (10). Mpz+/- mice exhibited myelin degeneration, onion bulb formation, and remyelination (10). Invading CD4+ and CD8+ lymphocytes were observed in the Mpz+/- mice (13;14). Also, an influx of macrophages were observed in close association with demyelinating or demyelinated axons (15). An ENU-induced mutation in Mpz resulted in an Asp to Gly substitution at amino acid 121. The Mpz mutation caused tremor and hypermetric gait (16). Mpz transgenic mice that overexpressed Mpz exhibited a dose-dependent, demyelinating neuropathy (17). Several of the Mpz transgenic founders exhibited ataxia, tremor, reduced weight, atrophy of the paraspinal and hindlimb musculature, and reduced lifespan (17). When bred onto the Mpz-/- genetic background, myelination was restored. Patients with hereditary motor and sensory neuropathies often show disruption of peripheral nervous system myelination, while patients with multiple sclerosis show disrupted myelination in the central nervous system [reviewed in (18)]. Mutations in human MPZ disrupt myelination during development or disrupt axo-glial interactions in adulthood. Mutations in MPZ are linked to demyelinating neuropathies, including several variants of Charcot-Marie-Tooth disease: Charcot-Marie-Tooth disease, dominant intermediate D (OMIM: #607791), Charcot-Marie-Tooth disease, type 1B (CMT1B; OMIM: #118200), Charcot-Marie-Tooth disease, type 2I (OMIM: #607677), and Charcot-Marie-Tooth disease, type 2J (OMIM: #607736) (19-23). In general, patients with CMT can exhibit tonic pupils, deafness, and late-onset sensorimotor neuropathy, weakness and sensory loss of lower limbs, and gait disturbances. CMT1B is characterized by progressive slowing of nerve conduction and hypertrophy of Schwann cells. Mutations in MPZ are also linked to more severe polyneuropathies, including Dejerine-Sottas disease [DSS; OMIM: #145900; (24;25)], congential hypomyelinating neuropathy [CHN; OMIM: #605253; (26)], and Roussy-Levy syndrome [OMIM# 180800; (27)]. A mutation in MPZ was also linked to chronic cough (28). The coughing spasms were attributed to autonomic neuropathy. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | Mutations in MPZ are proposed to cause neuropathy by altering protein–protein interactions and inhibiting homotypic adhesion. The phenotype observed in the taz mice indicates loss of MPZtaz function. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer taz_pcr_F: TGTCCTGGGGTTAGACAACAG taz_pcr_R: TTTGAAATGCCTCCCAGAACC Sequencing Primer taz_seq_F: GCTACAGAAGGGAAAATGTTTTATGC taz_seq_R: ATGCCTCCCAGAACCCTGTC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 447 nucleotides is amplified (chromosome 1, + strand): 1 tgtcctgggg ttagacaaca gataggtact taaaacaacg gaaaagagaa cctgggctac Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Katherine Timer | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Lauren Prince, Jamie Russell, and Bruce Beutler |