Phenotypic Mutation 'posey' (pdf version)
Alleleposey
Mutation Type missense
Chromosome8
Coordinate9,972,955 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Lig4
Gene Name ligase IV, DNA, ATP-dependent
Synonym(s) DNA ligase IV, 5830471N16Rik, tiny
Chromosomal Location 9,969,049-9,977,686 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA ligase that joins single-strand breaks in a double-stranded polydeoxynucleotide in an ATP-dependent reaction. This protein is essential for V(D)J recombination and DNA double-strand break (DSB) repair through nonhomologous end joining (NHEJ). This protein forms a complex with the X-ray repair cross complementing protein 4 (XRCC4), and further interacts with the DNA-dependent protein kinase (DNA-PK). Both XRCC4 and DNA-PK are known to be required for NHEJ. The crystal structure of the complex formed by this protein and XRCC4 has been resolved. Defects in this gene are the cause of LIG4 syndrome. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes die late in gestation with extensive CNS apoptosis, blocked lymphopoeiesis and failure of V(D)J joining. Carrier fibroblasts show elevated chromosome breaks. ~40% of homozygous hypomorphs survive, with retarded growth, reduced PBL and progressive loss of hematopoietic stem cells. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_176953; MGI:1335098

Mapped Yes 
Limits of the Critical Region 9970020 - 9970020 bp
Amino Acid Change Aspartic acid changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000036730] [ENSMUSP00000093130] [ENSMUSP00000116130] [ENSMUSP00000130807]
SMART Domains Protein: ENSMUSP00000093130
Gene: ENSMUSG00000049717
AA Change: D275G

DomainStartEndE-ValueType
Pfam:DNA_ligase_A_N 14 209 1.3e-43 PFAM
Pfam:DNA_ligase_A_M 248 451 2e-50 PFAM
Pfam:DNA_ligase_A_C 476 588 3.3e-16 PFAM
BRCT 656 733 2.8e-14 SMART
Pfam:DNA_ligase_IV 749 784 7.3e-21 PFAM
BRCT 816 901 1.6e-5 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000095476)
SMART Domains Protein: ENSMUSP00000130807
Gene: ENSMUSG00000049717
AA Change: D275G

DomainStartEndE-ValueType
Pfam:DNA_ligase_A_N 15 208 8.8e-39 PFAM
Pfam:DNA_ligase_A_M 248 451 2.3e-52 PFAM
Pfam:DNA_ligase_A_C 476 588 4.8e-18 PFAM
BRCT 656 733 2.9e-14 SMART
Pfam:DNA_ligase_IV 750 783 5.5e-17 PFAM
BRCT 816 901 1.6e-5 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000170033)
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased 17554302 20133615
FACS CD4:CD8 - decreased
FACS CD4+ T cells - decreased
FACS CD4+ T cells in CD3+ T cells - decreased 20133615
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD4 T cells - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ CD8 T cells - increased
FACS CD44+ T cells - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased
FACS CD8+ T cells in CD3+ T cells - increased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS IgD MFI - decreased
FACS IgD+ B cell percentage - decreased 17554302 20133615
FACS IgM MFI - decreased
FACS IgM+ B cells - decreased 17554302 20133615
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS NK cells - increased
FACS T cells - decreased
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization 20133615
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(11) Chemically induced (ENU)(1) Gene trapped(4) Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lig4 APN 8 9972775 missense probably damaging 1.00
IGL00655:Lig4 APN 8 9973305 missense probably benign 0.09
IGL01388:Lig4 APN 8 9973586 missense probably damaging 1.00
IGL01669:Lig4 APN 8 9973673 missense probably benign 0.01
IGL01757:Lig4 APN 8 9971185 missense probably benign 0.10
IGL02115:Lig4 APN 8 9973247 missense possibly damaging 0.58
IGL02167:Lig4 APN 8 9971821 missense probably benign 0.06
IGL02239:Lig4 APN 8 9972473 missense probably damaging 1.00
IGL02576:Lig4 APN 8 9971116 missense probably damaging 1.00
IGL02955:Lig4 APN 8 9972103 missense possibly damaging 0.95
IGL03056:Lig4 APN 8 9972580 missense possibly damaging 0.90
posey2 UTSW 8 9971585 missense probably benign
R0791:Lig4 UTSW 8 9973012 missense possibly damaging 0.70
R1208:Lig4 UTSW 8 9971062 missense probably damaging 1.00
R1208:Lig4 UTSW 8 9971062 missense probably damaging 1.00
R1368:Lig4 UTSW 8 9971176 missense possibly damaging 0.89
R1522:Lig4 UTSW 8 9973012 missense possibly damaging 0.70
R1566:Lig4 UTSW 8 9973650 missense probably benign 0.41
R1674:Lig4 UTSW 8 9971692 missense probably benign 0.01
R2024:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2025:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2026:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2155:Lig4 UTSW 8 9972766 missense probably benign 0.00
R2243:Lig4 UTSW 8 9972161 missense possibly damaging 0.81
R2917:Lig4 UTSW 8 9971596 missense possibly damaging 0.56
R4763:Lig4 UTSW 8 9972955 missense probably damaging 1.00
R4819:Lig4 UTSW 8 9971885 missense probably benign
R5153:Lig4 UTSW 8 9973003 missense possibly damaging 0.95
R5397:Lig4 UTSW 8 9972644 missense probably benign 0.01
R5618:Lig4 UTSW 8 9972021 missense probably benign
R6102:Lig4 UTSW 8 9972872 missense probably damaging 1.00
R6210:Lig4 UTSW 8 9971585 missense probably benign
R6312:Lig4 UTSW 8 9971739 missense probably benign
R6955:Lig4 UTSW 8 9973384 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-12-18 11:01 AM by Anne Murray
Record Created 2016-09-14 11:21 PM by Jin Huk Choi
Record Posted 2018-12-18
Phenotypic Description
Figure 1. Posey mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Posey mice exhibit decreased frequencies of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Posey mice exhibit decreased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Posey mice exhibit reduced expression of IgD on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Posey mice exhibit a reduced CD4 to CD8 T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Posey mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Posey mice exhibit decreased frequencies of peripheral naive CD4+ T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Posey mice exhibit decreased frequencies of peripheral naive CD8+ T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Posey mice exhibit increased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Posey mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Posey mice exhibit increased frequencies of peripheral central memory CD8+ T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Posey mice exhibit increased frequencies of peripheral effector memory CD4+ T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Posey mice exhibit increased CD44 expression on T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Posey mice exhibit increased CD44 expression on CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Posey mice exhibit increased CD44 expression on CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Posey mice exhibit increased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 17. Homozygous posey mice exhibit diminished T-dependent IgG responses to OVA/alum. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The posey phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4763, some of which showed a reduced frequency of B cells (Figure 1), IgD+ B cells (Figure 2), and IgM+ B cells (Figure 3) as well as reduced IgD expression on B cells (Figure 4), all in the peripheral blood. Some mice showed a reduced CD4 to CD8 T cell ratio (Figure 5) due to reduced frequencies of CD4+ T cells in CD3+ T cells (Figure 6), naïve CD4+ T cells in CD4+ T cells (Figure 7), and naïve CD8+ T cells in CD8+ T cells (Figure 8) with concomitant increased frequencies of CD44+ CD8 T cells (Figure 9), CD8+ T cells in CD3+ T cells (Figure 10), central memory CD8+ T cells in CD8+ T cells (Figure 11), effector memory CD4+ T cells in CD4+ T cells (Figure 12). Some mice also showed increased CD44 expression on T cells (Figure 13), CD4 T cells (Figure 14), and CD8+ T cells (Figure 15) in the peripheral blood. Some mice showed increased frequencies of natural killer cells in the peripheral blood (Figure 16). The T-dependent antibody response to ovalbumin administered with aluminum hydroxide was also diminished (Figure 17).

Nature of Mutation
Figure 18. Linkage mapping of the effector memory CD4 T cell phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 73 mutations (X-axis) identified in the G1 male of pedigree R4763. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 73 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Lig4: an A to G transition at base pair 9,972,955 (v38) on chromosome 8, or base pair 4,711 in the GenBank genomic region NC_000074 encoding Lig4. The strongest association was found with a recessive model of inheritance to the frequency of effector memory CD4 T cells in CD4 T cells wherein four variant homozygotes departed phenotypically from 12 homozygous reference mice and 10 heterozygous mice with a P value of 3.164 x 10-5 (Figure 18).  

 

The mutation corresponds to residue 1,146 in the mRNA sequence NM_176953 within exon 2 of 2 total exons.

 

1130 ATCGAAACTAAGCTTGATGGTGAGCGCATGCAG

270  -I--E--T--K--L--D--G--E--R--M--Q-

 

The mutated nucleotide is indicated in red. The mutation results in an aspartic acid (D) to glycine (G) substitution at amino acid 275 (D275G) in the LIG4 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 19. Domain structure of LIG4. The posey mutation results in an aspartic acid to glycine substitution at amino acid 275. Other mutations found in LIG4 are noted. Click on each mutation for more information.
Figure 20. Structure of human LIG4 (aa 1-609). Domains are colored as in Figure 19. Figure generated by UCSF Chimera and is based on PDB:3W1B.

Lig4 encodes DNA ligase IV, a member of the ATP-dependent DNA ligase family. DNA ligase IV has a DNA-binding domain (DBD), a catalytic domain that includes nucleotidyltransferase (NTase) and oligonucleotide binding-fold (OBD) domains, a nuclear localization sequence (NLS), two BRCT domains (BRCT I and BRCT II), and an XRCC4-interacting region (XIR) (Figure 19) (1;2).

 

The crystal structure of the human DNA ligase IV DBD has been solved [Figure 20; PDB:4HTP; (3) and PDB:3W1B; (4)]. The DBD has two helical subdomains that are connected by two long loops (designated L1 [amino acids 71 to 86] and L2 [amino acids 191 to 201]). Subdomain one is comprised of helices α1, α2, α3, α10, and α11, while subdomain is comprised of helices α4, α5, α6, α7, α8, and α9. The α2 helix interacts with the C-terminal region of Artemis.

 

Within the catalytic domain, Asp271, Arg278, Arg293, Lys432, Arg443, and Lys449 are ATP-binding sites. Lys273 is the active site, and Asp331 and Asp427 organize magnesium binding. NTase and OBD domains are found in DNA and RNA ligases as well as RNA-capping enzymes (5). The NTase domain engages the nicked DNA strand, and the OBD inserts into the minor groove of the DNA duplex opposite the nick, securing the DNA within the active site of the NTase domain (6).

 

The BRCT domains mediate protein-protein interactions. BRCT repeats are composed of four central β-sheets surrounded by three α-helices. The BRCT I α2 helix is required for adenovirus-mediated degradation of DNA ligase IV (7). The C-terminal region encompassing the two BRCT domains and the XIR is required for the regulation of the nuclear localization and stability of the DNA ligase IV co-factor XRCC4 as well as binding of the XRCC4/DNA ligase IV complex to chromatin (8-10). Mutations within the BRCT domains (Trp725Arg and Trp893Arg) allow DNA ligase IV binding, but do not allow for the chromatin binding of XRCC4.

 

Human DNA ligase IV is phosphorylated at Thr650 and putatively at Ser668 or Ser672 (11). DNA ligase IV phosphorylation contributes to its stability, but not to its DNA end joining activity (11). Phosphorylation of mouse DNA ligase IV has not been documented.

 

The posey mutation results in an aspartic acid (D) to glycine (G) substitution at amino acid 275 (D275G) in DNA ligase IV; amino acid 275 is within the catalytic domain in proximity to two ATP-binding sites and the active site.

Expression/Localization

LIG4 is ubiquitously expressed (NCBI).

Background
Figure 21. Schematic overview of NHEJ DNA DSB repair. Selected steps in nonhomologous end joining (NEHJ) repair (see the text for details): (1) Ku associates to DSBs to promote NHEJ and (2) the recruitment of DNA-PKcs to (3) form the catalytically active DNA-PK complex that protects the DNA ends needed for ligation. (4) Autophosphorylation of DNA-PKcs allows for ARTEMIS and DNA pol x family members to access the DNA termini.  ARTEMIS and DNA-PKcs form a complex that cleaves 5’ and 3’ overhangs during NHEJ. DNA pol x family members fill in the gaps with several nucleotides, if necessary, prior to relegation. Nucleases can remove base nucleotides, if necessary (not shown). (5) XRCC4/LIG4 is recruited to the site and the broken ends are religated with the help of XLF.  (6) Repair resolution of the DSB following NHEJ.  Abbreviations: HR, homologous recombination; NHEJ, nonhomologous end joining; DSB, double strand break; PARP; poly(ADP)ribose polymerase; MRN, MRE11-RAD50-NBS1; MRE11, meiotic recombination 11, NBS1, Nibrin or Nijmega breakage syndrome protein 1; ssDNA, single-stranded DNA; BRCA1, breast cancer 1, early onset; RPA, replication protein A; XRCC3, X-ray repair complementing defective repair in Chinese hamster cells 3; SDSA, synthesis-dependent strand annealing; XRCC4, X-ray repair cross-complementing 4; LIG4, DNA ligase IV; XLF, XRCC4-like factor. Figure modified from images found in Ciccia and Elledge. Mol Cell. (2010) 40:179-204Heyer et al. Annu. Rev. Genet. (2010) 44:113-139, and Neal and Meek. Mutat. Res.(2011) 711:73-86
Figure 22.  Schematic overview of V(D)J Recombination.  The two DNA coding segments to be joined are shown as blue and red DNA strands.  (1) The RAG1/2 complex (see maladaptive and huckle) binds to a recombination signal sequence (RSS) that flanks each variable (V), diversity (D), and joining (J) encoding gene segment.  Binding of RAG1/2 and nicking of a single RSS as well as the formation of a paired complex (not shown). (2) The RAG1/2 introduce DNA DSB within the synaptic complex between the gene segments and the RSSs. (3) Cleavage by the RAG complex results in a hairpin-sealed coding end and a blunt signaling end.  (4a) Formation of the signal joint occurs after blunt end ligation of signal ends by the XRCC4-ligase IV (Lig IV) complex.  (4b-7b) Formation of the coding joint.  (4b) The NEHJ factors arrive at the hairpin and the hairpin structures on the coding ends are nicked by DNA-PKcs and Artemis.  (5b)  Addition of non-templated nucleotides by terminal deoxynucleotidyl transfers (TdT) occurs during coding end processing.  (6b) Joining of the coding end occurs upon ligation by the XRCC4-ligase IV (Lig IV) complex to (7b) form a coding joint.   Figure adapted from Schatz and Swanson. Annu. Rev. Genet. 2011. 45:167-202 and Schatz and Ji. Nat. Reviews Immunology. 2011. 11:251-263.

DNA ligase IV is responsible for the ligation step in nonhomologous DNA end joining (NHEJ) (Figure 21) and in V(D)J recombination (Figure 22) (12). In NHEJ, the DNA break is recognized by the Ku heterodimer composed of Ku70 and Ku80, which encircles the DNA and cups the DNA termini into an accessible binding pocket (13). The Ku dimer can recognize blunt ends, hairpin ends, and 5’ or 3’ overhangs; two in vitro studies using purified oligonucleotides containing hairpin ends found that the Ku heterodimer (and DNA-PKCS; see the record for clover) can bind hairpin ends but the kinase could not be activated (14;15). The Ku heterodimer recruits and activates DNA-PKCS, forming the Ku/DNA-PKCS complex known as DNA-PK. The Ku/DNA-PKCS interaction not only assists in localizing the complex to the DNA ends, it also protects DNA ends from nuclease digestion prior to re-ligation (16;17). Following recruitment of DNA-PKCS to the Ku-DNA complex, Ku translocates inward ~10 bp from the DNA ends, allowing DNA-PKCS to bind to the DNA termini (18). Two adjacent DNA-PKCS molecules interact across the DSB, holding the DNA ends in close proximity within a synaptic complex. Crystallographic studies have shown that the synaptic complex in NHEJ consists of two DNA ends, two Ku heterodimers, and two DNA-PKCS proteins (17;19). The formation of a synaptic complex is essential for the activation of DNA-PKCS (17). Nucleases (e.g. 5’: FEN1, EXO1, and Sep1 (20-22); 3’: MRE11 (23)) and polymerases (e.g. polβ, polε, and polδ) are often required to remove several nucleotides or to fill in gaps of several nucleotides, respectively, to facilitate the proper conformation for ligation (24). The colocalization of DNA polymerase X family members (e.g. terminal deoxynucleotidyl transferase (TdT), pol μ, pol λ, and polβ) with DNA-PKCS as well as the interactions of DNA pol X with both Ku and the DNA ligase IV-XRCC4 complex suggest that the DNA polymerase X family participates in the filling in of short gaps prior to re-ligation (25;26). To protect the DNA termini of a DSB from degradation or premature and incorrect ligation, DNA-PKCS is positioned as a “cap” on the DNA ends (27;28). Before re-ligation of the DNA ends and finalization of the DSB repair, the DNA-PKCS cap must be removed or altered. Autophosphorylation of DNA-PKCS results in release of the cap and accessibility of the termini to enzymes and ligases needed to complete the repair (e.g. Artemis, DNA polymerase X family members and the DNA ligase IV-XRCC4 dimer)(17;25;29). Artemis and DNA-PKCS form a complex with endonuclease activity that cleaves 5’ and 3’ overhangs during NHEJ, and opens hairpins generated by the RAG complex during V(D)J recombination [(30); reviewed in (29)]. In order to activate its nuclease activity, Artemis is phosphorylated by DNA-PKCS (31). The DNA ligase IV-XRCC4 dimer rejoins the DNA ends, with XRCC4 both interacting with and catalytically stimulating DNA ligase IV (29).  XLF functions to stimulate the ability of XRCC4-DNA ligase IV to ligate in the presence of Mg2+ (32)

 

During lymphoid cell development, the process of V(D)J recombination generates a variable region exon to which is subsequently joined a constant region gene, together encoding either an immunoglobulin or T cell receptor chain. In V(D)J recombination, a trans-esterification reaction mediated by RAG1/RAG2 produces an excised DNA fragment with blunt signal ends and two covalently closed hairpins at each end of the coding regions that must be joined (16;25). Artemis is essential to opening hairpins for V(D)J recombination following phosphorylation by DNA-PKCS.  To process the DNA ends and ligate coding regions, the cell uses the NHEJ pathway. In cells lacking DNA-PKCS, V(D)J recombination intermediates cannot be completely processed and ligated, leading to an accumulation of hairpin intermediates (33). This indicates that DNA-PKCS may be necessary for cleavage of hairpin intermediates as well as for the final end joining step (25).

 

Mutations in human LIG4 are linked to LIG4 syndrome [alternatively, DNA ligase IV deficiency; OMIM: #606593; (34;35)] and resistance to multiple myeloma [OMIM: #254500; (36)]. Patients with LIG4 syndrome exhibit immunodeficiency as well as delays in development and growth (34). Patients also often display unusual facial features, microcephaly, growth and/or developmental delay, pancytopenia, and various skin abnormalities. 

 

Lig4-deficient mice are embryonic lethal, and the mice exhibited neuronal apoptosis, arrested lymphogenesis, reduced body size, and various cellular defects (37-41). The embryonic lethality, neuronal apoptosis, and fibroblast proliferation/senescence defects observed in the Lig4-deficient mice could be rescued with p53 deficiency; lymphocyte development defects were not rescued (42). K.M. Frank and colleagues propose that most of the phenotypes observed in the Lig4-deficient mice are due to a p53-dependent response to unrepaired DNA damage. The embryonic lethality in the Lig4-deficient mice could also be rescued by deletion of Ku86 (43). Z.E. Karanjawala and colleagues propose that in the case of Lig4 deficiency alone that the lethality phenotype is due the presence of the Artemis:DNA-PKCS  nuclease. The loss of Ku86 results in a less severe phenotype, because Ku86 is less efficient than Artemis:DNA-PKCS.  

 

The Arg278His mutation in humans is linked to Lig4 syndrome. Homozygous Lig4R278H/R278H knock-in mice exhibited a reduced life span, reduced body weights compared to wild-type controls, reduced fertility, reduced numbers of B220+ cells in the bone marrow, reduced B220+ IgM+ B cells in the spleen, reduced numbers of CD4-CD8- double negative T cells, CD4+CD8+ double positive T cells, B cells, CD4+ T cells, and CD8+ T cells (44). The Lig4R278H/R278H mice also had reduced IgA, IgG, and IgM in the serum.

 

Homozygous Lig4 mutant mice (Tyr288Cys) was viable, but showed high levels of endogenous DSBs, immunodeficiency, growth retardation, and reduced brain sizes compared to wild-type mice as well as increased apoptosis in the forebrain, intermediate zone/cortical plate, and ventricular/subventricular zones (45;46). The mice showed impaired V(D)J recombination, B cell class switch recombination, and peripheral lymphocyte survival and proliferation (46). The Tyr288Cys mutant mice also showed a high incidence of thymic tumors.

 

Homozygous mice (Lig4tiny/tiny) with an ENU-induced mutation exhibited prenatal lethality (born at 40% of the expected frequency), reduced body sizes, reduced B cell numbers, and lack of CD8+ T cells (MGI:3714853 and (47)). Mouse embryonic fibroblasts from the Lig4tiny/tiny mice exhibited reduced ability to repair DNA damage from gamma radiation.

Putative Mechanism

The phenotype of the posey mice indicates loss of LIG4posey function in NHEJ and/or V(D)J recombination.

Primers PCR Primer
posey(F):5'- CCCCTTCTGCATGAAAGTCTG -3'
posey(R):5'- GTTGCACAACGTCACCACAG -3'

Sequencing Primer
posey_seq(F):5'- GGGTTGTAGGCCATCATCTCAC -3'
posey_seq(R):5'- GTCACCACAGATCTGGAAAAGGTC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, Xue Zhong, James Butler, Zhao Zhang, Xiaoyu Wang, and Bruce Beutler