Phenotypic Mutation 'Big_boned' (pdf version)
List |< first << previous [record 34 of 511] next >> last >|
AlleleBig_boned
Mutation Type missense
Chromosome18
Coordinate66,859,488 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Mc4r
Gene Name melanocortin 4 receptor
Synonym(s) Fatboy
Chromosomal Location 66,857,715-66,860,472 bp (-)
MGI Phenotype Mutations in this gene result in hyperglycemia and weight gain.
Accession Number

NCBI RefSeq: NM_016977; MGI:99457

Mapped Yes 
Amino Acid Change Isoleucine changed to Phenylalanine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000054776]
SMART Domains Protein: ENSMUSP00000054776
Gene: ENSMUSG00000047259
AA Change: I185F

DomainStartEndE-ValueType
Pfam:7tm_4 51 228 8.1e-11 PFAM
Pfam:7TM_GPCR_Srsx 55 317 6e-12 PFAM
Pfam:7tm_1 61 302 2.7e-31 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000057942)
Phenotypic Category growth/size, increase in body weight
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles: 16; Chemically induced (ENU): 7; Targeted: 9

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Mc4r APN 18 66859158 missense probably benign 0.00
IGL01382:Mc4r APN 18 66859793 missense probably damaging 0.99
IGL01820:Mc4r APN 18 66859155 missense probably benign 0.00
IGL02749:Mc4r APN 18 66859662 missense probably damaging 1.00
IGL02812:Mc4r APN 18 66859247 missense probably damaging 1.00
IGL03403:Mc4r APN 18 66859526 missense probably benign 0.06
chubby UTSW 18 66859847 missense probably damaging 1.00
halloween UTSW 18 66859821 missense probably damaging 1.00
Southbeach UTSW 18 66859142 missense probably damaging 1.00
R1552:Mc4r UTSW 18 66859695 missense probably benign 0.00
R1623:Mc4r UTSW 18 66859997 missense probably benign 0.03
R1666:Mc4r UTSW 18 66859409 missense probably damaging 1.00
R1668:Mc4r UTSW 18 66859409 missense probably damaging 1.00
R1873:Mc4r UTSW 18 66859460 missense probably damaging 1.00
R2105:Mc4r UTSW 18 66859598 missense probably damaging 1.00
R2210:Mc4r UTSW 18 66859395 missense probably damaging 1.00
R3714:Mc4r UTSW 18 66859821 missense probably damaging 1.00
R3715:Mc4r UTSW 18 66859821 missense probably damaging 1.00
R4115:Mc4r UTSW 18 66859979 missense probably benign
R4322:Mc4r UTSW 18 66859050 missense probably benign 0.00
R4492:Mc4r UTSW 18 66859640 missense probably benign 0.00
R4806:Mc4r UTSW 18 66859488 missense probably damaging 1.00
R4877:Mc4r UTSW 18 66859338 missense probably benign 0.00
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 12/08/2016 11:14 AM by Katherine Timer
Record Created 09/16/2016 9:17 PM
Record Posted 09/22/2016
Phenotypic Description

Figure 1. Big_boned mice exhibited increased body weights compared to wild-type littermates. Scaled body weight data are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Big_boned phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4806, some of which showed increased body weights compared to wild-type mice (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased body weight phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 63 mutations (X-axis) identified in the G1 male of pedigree R4806. Scaled body weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 63 mutations. The increased body weight phenotype was linked to two genes: Mc4r and Psmg2. The mutation in Mc4r is presumed to be causative as the phenotype of the Big­_boned mice mimics that of other Mc4r alleles (see MGI for a list of Mc4r alleles as well as the record for Southbeach). The Mc4r mutation is an A to T transversion at base pair 66,859,488 (v38) on chromosome 18, or base pair 1,000 in the GenBank genomic region NC_000084 for the Mc4r gene. Linkage was found with an additive model of inheritance (P = 6.809 x 10-6), wherein one variant homozygote and seven heterozygotes departed phenotypically from three homozygous reference mice (Figure 2).

 

The mutation corresponds to residue 1000 in the mRNA sequence NM_016977 within exon 1 of 1 total exons. 

 

985 TCAGGCGTCCTCTTCATCATTTACTCGGACAGC

180 -S--G--V--L--F--I--I--Y--S--D--S-

 

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine (I) to phenylalanine (F) substitution at position 185 (I185F) in the MC4R protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.00) (1).

Protein Prediction
Figure 4. Domain structure and topography of mouse MC4R. The locations of the transmembrane (TM) domains are indicated. The Big_boned mutation causes a conversion of isoleucine 185 to a phenylalanine in the MC4R protein. The image is interactive; click to view other MC4R mutations.

Figure 5. 3D model of MC4R. The locations of the Big_bonedchubby, Southbeach, and halloween mutations are indicated. UCSF Chimera model is based on PDB:2IQR. Click on the 3D structure to view it rotate.

MC4R belongs to the family of melanocortin receptors, which are seven transmembrane (TM) spanning G-protein coupled receptors (GPCRs) (Figure 3 & 4). MC4R activates the heterotrimeric G-protein Gs, which stimulates adenylyl cyclase production of cAMP from ATP (2). GPCRs have seven transmembrane helices connected by loops, and ligand binding occurs at extracellular loops facilitated by specific transmembrane helices. Based on a pure modeling approach modeled upon the crystal structure of bovine rhodopsin, another GPCR, residues in transmembrane domain (TM)3, TM4, TM5 and TM6 were predicted to flank the ligand binding site. Extracellular loops 2 and 3 also participate in docking of ligand (3). Interestingly, TM1 and TM7 were not predicted to contribute to ligand binding, although F284 was found at the edge of the ligand-binding pocket (3). The third intracellular loop of MC4R is predicted to form an α-helical segment, and play an important role in coupling the receptor to Gs. The Big_boned mutation results in an isoleucine (I) to phenylalanine (F) substitution at position 185 in TM4, two amino acids from the extracellular loop connecting TM4 and TM5.

 

Please see the record for Southbeach for more information about Mc4r.

Putative Mechanism

A main mechanism of energy balance regulation involves the control of signaling by the central melanocortin receptors (MCRs) MC3R and MC4R within a defined hypothalamic neural network. Two sets of neurons in the arcuate nucleus (a region surrounding the third ventricle in the most ventral portion of the hypothalamus) act as sensors of whole-body energy status and initiate signals to maintain energy stores at a constant level. The Agrp/Npy neurons (producing Agrp and neuropeptide Y) are inhibited by the leptin peptide (see the record for Potbelly) by signaling through the leptin receptor (see the record for Business_class), while Pomc/Cart neurons (producing Pomc; its proteolytic products and cocaine- and amphetamine-regulated transcript) are stimulated by leptin (4-6). Both Agrp/Npy and Pomc/Cart neurons synapse onto MC4R-expressing neurons (4;7). Thus, when leptin levels are low, Agrp/Npy neurons are activated and Pomc/Cart neurons are inhibited, producing Agrp but not Pomc, and resulting in inhibition of MC4R and increased food intake.

 

In humans, mutations in MC4R are associated with obesity (OMIM #601665). Human patients with MC4R mutations exhibit increased body mass index, increased appetite, increased height, increased lean mass, increased bone mineral density and hyperinsulinemia (8). With the exception of increased bone mineral density, these phenotypes are recapitulated in Mc4r null mice (9).

 

The obesity phenotype observed in the Big_boned mice mirrored that of other ENU-induced mutations attributed to Mc4r, including Southbeach and Fatboy (MGI:2671841) (10), confirming that the Mc4r mutation in Big_boned was causative. The localization, expression, and function of the MC4RBig_boned protein have not been determined; however, the obesity phenotype of the Big_boned mice indicates that the mutation results in loss of MC4R function.

Primers PCR Primer
Big_boned(F):5'- ATGGTCAAGGTAATCGCCCC -3'
Big_boned(R):5'- GAGCTTCACCGTGAACATTG -3'

Sequencing Primer
Big_boned_seq(F):5'- AAGGTAATCGCCCCCTTCATG -3'
Big_boned_seq(R):5'- GAGCTTCACCGTGAACATTGATAATG -3'
References
Science Writers
Illustrators Katherine Timer
AuthorsEmre Turer and Bruce Beutler
List |< first << previous [record 34 of 511] next >> last >|