Phenotypic Mutation 'Polished' (pdf version)
List |< first << previous [record 15 of 18] next >> last >|
AllelePolished
Mutation Type missense
Chromosome11
Coordinate100,012,611 bp (GRCm38)
Base Change A ⇒ C (forward strand)
Gene Krt33a
Gene Name keratin 33A
Synonym(s) 2310015J09Rik
Chromosomal Location 100,011,195-100,016,212 bp (-)
MGI Phenotype PHENOTYPE: Mutations of this gene cause the hair coat to appear either shiny, reflective and "polished" or greasy looking, disheveled and "spikey." [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_027983, MGI: 1919138

Mapped Yes 
Amino Acid Change Tyrosine changed to Aspartic acid
Institutional SourceBeutler Lab
Ref Sequences
Y232D in Ensembl: ENSMUSP00000018399 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:Filament 55 366 1.9e-102 PFAM
internal_repeat_1 368 385 6.11e-5 PROSPERO
internal_repeat_1 384 399 6.11e-5 PROSPERO
Predicted Effect probably damaging

PolyPhen 2 Score 0.997 (Sensitivity: 0.40; Specificity: 0.98)
(Using Ensembl: ENSMUSP00000018399)
Phenotypic Category
Phenotypequestion? Literature verified References
skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI
All alleles(5) : Targeted, other(2) Chemically induced(3)
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Krt33a APN 11 100012017 missense probably benign 0.35
IGL02412:Krt33a APN 11 100011979 missense probably benign 0.01
IGL02523:Krt33a APN 11 100011692 missense probably benign 0.02
Polished2 UTSW 11 100015850 missense probably benign 0.15
Spikey UTSW 11 100011939 missense probably damaging 1.00
R0492:Krt33a UTSW 11 100016083 missense probably benign 0.02
R0496:Krt33a UTSW 11 100012329 splice site probably benign
R0691:Krt33a UTSW 11 100012715 missense probably damaging 1.00
R1077:Krt33a UTSW 11 100015937 missense probably benign
R1624:Krt33a UTSW 11 100014246 missense probably damaging 1.00
R1911:Krt33a UTSW 11 100012349 missense probably benign 0.35
R1944:Krt33a UTSW 11 100012709 missense probably benign 0.10
R1945:Krt33a UTSW 11 100012709 missense probably benign 0.10
R2254:Krt33a UTSW 11 100014178 missense possibly damaging 0.95
R2255:Krt33a UTSW 11 100014178 missense possibly damaging 0.95
R3716:Krt33a UTSW 11 100014165 missense probably benign 0.01
R4377:Krt33a UTSW 11 100012427 missense possibly damaging 0.46
R5233:Krt33a UTSW 11 100014135 missense probably damaging 1.00
R6029:Krt33a UTSW 11 100012463 missense probably benign 0.01
R6316:Krt33a UTSW 11 100014201 missense probably damaging 0.98
R6807:Krt33a UTSW 11 100012383 missense possibly damaging 0.61
Mode of Inheritance Autosomal Dominant
Local Stock Sperm, gDNA
Repository

none

Last Updated 2016-05-13 3:09 PM by Stephen Lyon
Record Created unknown
Record Posted 2008-07-25
Phenotypic Description

The dominant Polished mutation was identified in N-ethyl-N-nitrosourea (ENU)-induced G1 mutant mice.  Heterozygous animals have a shiny, reflective, “polished” looking coat.  Polished mice appear identical to allelic Polished2 mice.

Nature of Mutation
The Polished mutation was mapped to Chromosome 11, and corresponds to a T to G transversion at position 759 of the Krt33a transcript, in exon 4 of 7 total exons. 
 
744  GAGACCAGGTGTCAGTACGAGGCCCTGGTGGAA
227 -E--T--R--C--Q--Y--E--A--L--V--E-
 
The mutated nucleotide is indicated in red lettering, and causes a tyrosine to aspartic acid change at residue 232 of the Keratin 33a (K33a) protein.
Protein Prediction
The mouse K33a protein has 404 residues, and is 89% identical to the 405 amino acid human protein (1;2).  K33a is a hair or hard α-keratin that belongs to the type I (acidic) keratin family (2).
 
Figure 1. Keratin domain structure showing the α-helical domain, linker regions and head/tail domains. The Polished mutation causes a tyrosine to aspartic acid change at residue 232 of the Keratin 33a protein. This image is interactive. Click on the image to view other mutations found in Krt33a (red). Click on the mutations for more specific information. 
Keratins are intermediate filament (IF) proteins that are primarily involved in the mechanical and structural functions of epithelial tissue.  Keratin proteins are composed of an α-helical rod domain divided into four subdomains: 1A (residues 57-91 for K33a), 1B (residues 103-203 for K33a), 2A (residues 220-238 for K33a), and 2B (residues 247-367 for K33a).  These domains are interrupted by non-helical linkers and flanked by non-helical head and tail domains (2).  The N- and C-termini of the α-helical rod domain are highly conserved and known as the helix initiation motif (HIM) and the helix termination motif (HTM), respectively.  The HTM motif of most keratins contains the consensus sequence of EIATYRXLLEGEE (3).  A similar sequence of EINTYRXLLESED is found near the end of the 2B domain in both mouse and human K33a (1;2).  The α-helical rod domains, particularly the HIM and HTM motifs, are necessary for interactions with other keratin molecules in order to assemble into IFs (4).  The head and tail domains are sometimes classified into subdomains known as the high homology or H subdomains, regions with sequence variation or V subdomains, and highly charged ends or E subdomains (Figure 1).
 
In order to form intermediate filaments, the α-helical chains of two keratin molecules dimerize to form a coiled-coil structure.  Keratin dimers then associate via their HIM and HTM motifs in a head-to-tail fashion to form linear arrays, four of which associate in an antiparallel, half-staggered manner to produce protofibrils.  Three to four protofibrils intertwine to produce an apolar intermediate filament 10 nm in diameter (Figure 2).  The assembly equilibrium is heavily in favor of polymer formation (5).  Keratins contain a high proportion of the small amino acids glycine and alanine, which facilitates the assembly of individual keratin molecules into IFs and allows sterically unhindered hydrogen bonding between the amino and carboxyl groups of peptide bonds on adjacent protein chains, facilitating their close alignment and strong cohesion (4;6).  Hair keratins in particular also have large amounts of the sulfur-containing amino acid cysteine, required for the disulfide bridges that confer additional strength and rigidity to the IFs formed from keratin proteins (5).  
 
The Polished mutation results in the substitution of an aspartic acid for a tyrosine at amino acid 232 of Keratin 33a.  This residue is located in the 2A α-helical rod subdomain.
Expression/Localization
Using RT-PCR, human KRT33A was found to be expressed in the hair follicle (2).  A subsequent in situ hybridization study localized expression of Krt33a to the mid cortex of the hair shaft with the onset of expression occurring after the expression of Krt31 (7).
 
Krt33a cDNA has been found in adult mouse skin, salivary gland, and tongue as well as in late-stage embryos (1;8).  In situ hybridization studies found Krt33a mRNA to be expressed in sagittal sections of the mouse brain with highest levels in the cerebellum and hippocampus (please see the Allen Brain Atlas).
Background
Keratins are cytoplasmic proteins that form the intermediate filaments (IFs) of epithelia including cells of the skin, lung, esophagus, gut and hair.  IFs are intermediate in diameter between actin (microfilaments) and microtubules.  Keratins are expressed in a cell type and differentiation specific manner, and are subdivided into the type I (acidic) and type II (basic) keratins.  The genes of the type I and type II keratin subfamilies are clustered in the genomes of mice and humans with the type I keratins localized to mouse Chromosome 11 and Chromosome 17q21.2 in humans, and the type II keratins localized to mouse Chromosome 15 and Chromosome 12q13.13 in humans.  In humans, there are 54 keratin proteins, 28 type I and 26 type II (9;10).  Keratins form obligate heterodimers between one type I and one type II keratin (4).  Although all type I keratins can pair with all type II keratins in vitro, in vivo this pairing is much more selective, even when multiple keratins are expressed in the same tissue. 
 
The primary function of keratins is to form a resilient yet adaptable scaffold allowing epithelial cells to sustain mechanical stresses.  However, increasing evidence suggests they may be involved in nonmechanical roles such as apoptosis and protein targeting.  In order to achieve both mechanical and nonmechanical functions, keratins associate with keratin-associated proteins (KAPs) that result in keratin phosphorylation, glycosylation, transglutamination, proteolytic cleavage, ubiquitination, or association with other cytoplasmic or cytoskeletal elements.  KAPs have many functions and include the linker proteins plectin, plakophilin 1 and desmoplakin that connect keratin IFs to cytoskeletal elements, the bundling proteins filaggrin and tichohyalin, adaptor/signaling molecules including 14-3-3 proteins and TNF (tumor necrosis factor) receptor type 2, as well as various kinases, chaperones, and enzymes (11). 
 
Figure 3. Keratin expression in the hair follicle. A, Fully-developed hair follicle. B, Cross-section of hair follicle. Keratins expressed in the layers of the (human) follicle are indicated. Type I keratins are shown in purple, and type II keratins are shown in green. K33a is expressed in the cortex of the human hair shaft.
The hair follicle has eight functionally and structurally different epithelial layers: the outer root sheath (ORS) that is continuous with the epidermis, the companion layer (CL), the inner root sheath (IRS) consisting of three layers (Henle’s, Huxley’s and cuticle) and the hair shaft, which also consists of three layers (cuticle, cortex and medulla) (Figure 3).  Unlike mouse hair, not all human hair has a medulla (12;13).  While the ORS is derived from proliferating cells in the outermost layer, the other layers of the hair follicle are derived from progenitor cells in the matrix of the hair bulb.  The morphology of the hair follicle varies with periods of growth (anagen), regression (catagen) and rest (telogen) (14).  During anagen, the ORS grows downwards as the CL, IRS, and hair shaft grow upwards.  The signaling pathways controlling the differentiation of each layer is poorly understood.
 
Numerous keratins are expressed in the hair follicle and hair shaft with specific expression patterns in the various epithelial layers.  In the cortex of the human hair shaft, seven type I hair keratins (K31, K33a, K33b, K34, K36, K38, K40) and three type II hair keratins are expressed (K81, K83, K86).  The cuticle of the hair shaft expresses four type I hair keratins (K32, K35, K39, K40) and only one type II hair keratin (K82).  The medulla of the hair shaft expresses the type I hair keratin K40 (K37 is expressed in the medulla of sexual hairs) (10).  For the most part, the expression of hair keratins is very similar in humans and mice. 
 
There are no known disease-causing mouse or human mutations in K33a, but human mutations in keratins expressed in the hair shaft do cause disease.  Mutations in the type II keratin genes KRT81, KRT83 and KRT86, cause monilethrix (OMIM #158000) an autosomal dominant hair disorder characterized clinically by alopecia and follicular papules.  Affected hairs have uniform elliptical nodes of normal thickness and intermittent constrictions, internodes at which the hair easily breaks.  A mutation in another type II gene KRT85, which is expressed very early in the lower most matrix and cuticle of the hair forming compartment of the hair follicle, causes ectodermal dysplasia of hair and nail type (OMIM #602032) (10).
Putative Mechanism
The Polished mutation alters a highly conserved amino acid in the 2A α-helical domain of the K33a protein.  As the α-helical domain is important for heterodimerization of keratin molecules and also participates in inter and intramolecular bonds, it is likely that the Polished mutation disrupts the proper formation of IF assembly resulting in the hair phenotypes seen in mutant animals.  Keratins are known to undergo phosphorylation (11), but the only predicted phosphorylation site in K33a occurs at amino acid T278 (see phospho.elm.eu.org).  It is unknown if this is an actual phosphorylation site or whether the tyrosine altered by the Polished mutation is also involved in phosphorylation or other critical functions.
 
A large number of autosomal dominantly transmitted diseases of the skin, hair, and various internal epithelia have been found to be caused by mutations in keratin genes. The resulting autosomal dominant pathologies are primarily due to the inability of the mutated keratin protein to form stable IFs with its intact endogenous partner of the opposite type.  This leads to an accumulation of disorganized IF bundles that eventually result in failure of tissue integrity, in particular on exposure to mechanical stress.  In the majority of cases, the mutations result in inappropriate amino acid substitutions at the beginning of subdomain 1A or at the end of subdomain 2B of the α-helical rod of either type I or type II keratins (10).  Although mutations can occur in other domains, disease-causing mutations in the 2A helical subdomain are very rare (please see the intermediate filament database at www.interfil.org).
Primers Primers cannot be located by automatic search.
Genotyping
Polished genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  
 
Primers for PCR amplification
Pol(F): 5’- CAGCTCTGGTACTAAACCATGACATCC -3’
Pol(R): 5’- GGTTTCTGCATGACTTCCAGAGAAGTC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Pol_seq(F): 5’- GATTCAGCGCACCAGATGC -3’
Pol_seq(R): 5’- TTGACTGTGCGTCTCAGCTC -3’
 
The following sequence of 805 nucleotides (from Genbank genomic region NC_000077 for linear DNA sequence of Krt33a) is amplified:
 
3241  cagctctgg tactaaacca tgacatccct ctaaatagaa agtgttatat ttagcatgaa
3301 gggcagagtg gggtatgggc ttgaaggtgc tttgagaaag gaatcagttt atcactgacc
3361 acagggaaaa ggatgctggg aaggaacaga atggagactg tagaaggatt cagcgcacca
3421 gatgcccaaa agcatcctct caaggagagc atcaagatcc attgtgatgt tttgaatttt
3481 ccctttcccc tgccaggaag tcaacaccct gcgctgccag cttggagacc gcctcaacgt
3541 ggaggtggac gctgctccca ccgtggacct gaaccgagta ctcaacgaga ccaggtgtca
3601 gtacgaggcc ctggtggaaa ccaaccgccg ggaagtggag gaatggtaca ccacacaggt
3661 gggcatctga gcccatggta actcaggaac cgagtcccca ggactgtaag gcagggtctg
3721 atcctgtccc tccccttgcc tattgcagac agaggagttg aacaagcagg tggtgtccag
3781 ctcagagcag ctgcagtcct gccaggccga gatcatcgag ctgagacgca cagtcaatgc
3841 cctggagatc gagctgcagg cccagcatga actggtgtgt agtgtctaga ctgctgctga
3901 gcagtgtgga gttgggaggc agagtcactg gggtgtcctt ggggcttctc tgtctctgtc
3961 tctgtctctg tctctgtctc tgtctctgtc tgtctctctt cttagctctt gaagcctgtg
4021 acttctctgg aagtcatgca gaaacc
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
References
   1.  Kawai, J., Shinagawa, A., Shibata, K., Yoshino, M., Itoh, M., Ishii, Y., Arakawa, T., Hara, A., Fukunishi, Y., Konno, H., Adachi, J., Fukuda, S., Aizawa, K., Izawa, M., Nishi, K., Kiyosawa, H., Kondo, S., Yamanaka, I., Saito, T., Okazaki, Y., Gojobori, T., Bono, H., Kasukawa, T., Saito, R., Kadota, K., Matsuda, H., Ashburner, M., Batalov, S., Casavant, T., Fleischmann, W., Gaasterland, T., Gissi, C., King, B., Kochiwa, H., Kuehl, P., Lewis, S., Matsuo, Y., Nikaido, I., Pesole, G., Quackenbush, J., Schriml, L. M., Staubli, F., Suzuki, R., Tomita, M., Wagner, L., Washio, T., Sakai, K., Okido, T., Furuno, M., Aono, H., Baldarelli, R., Barsh, G., Blake, J., Boffelli, D., Bojunga, N., Carninci, P., de Bonaldo, M. F., Brownstein, M. J., Bult, C., Fletcher, C., Fujita, M., Gariboldi, M., Gustincich, S., Hill, D., Hofmann, M., Hume, D. A., Kamiya, M., Lee, N. H., Lyons, P., Marchionni, L., Mashima, J., Mazzarelli, J., Mombaerts, P., Nordone, P., Ring, B., Ringwald, M., Rodriguez, I., Sakamoto, N., Sasaki, H., Sato, K., Schonbach, C., Seya, T., Shibata, Y., Storch, K. F., Suzuki, H., Toyo-oka, K., Wang, K. H., Weitz, C., Whittaker, C., Wilming, L., Wynshaw-Boris, A., Yoshida, K., Hasegawa, Y., Kawaji, H., Kohtsuki, S., and Hayashizaki, Y. (2001) Functional annotation of a full-length mouse cDNA collection, Nature 409, 685-690.
   8.  Okazaki, Y., Furuno, M., Kasukawa, T., Adachi, J., Bono, H., Kondo, S., Nikaido, I., Osato, N., Saito, R., Suzuki, H., Yamanaka, I., Kiyosawa, H., Yagi, K., Tomaru, Y., Hasegawa, Y., Nogami, A., Schonbach, C., Gojobori, T., Baldarelli, R., Hill, D. P., Bult, C., Hume, D. A., Quackenbush, J., Schriml, L. M., Kanapin, A., Matsuda, H., Batalov, S., Beisel, K. W., Blake, J. A., Bradt, D., Brusic, V., Chothia, C., Corbani, L. E., Cousins, S., Dalla, E., Dragani, T. A., Fletcher, C. F., Forrest, A., Frazer, K. S., Gaasterland, T., Gariboldi, M., Gissi, C., Godzik, A., Gough, J., Grimmond, S., Gustincich, S., Hirokawa, N., Jackson, I. J., Jarvis, E. D., Kanai, A., Kawaji, H., Kawasawa, Y., Kedzierski, R. M., King, B. L., Konagaya, A., Kurochkin, I. V., Lee, Y., Lenhard, B., Lyons, P. A., Maglott, D. R., Maltais, L., Marchionni, L., McKenzie, L., Miki, H., Nagashima, T., Numata, K., Okido, T., Pavan, W. J., Pertea, G., Pesole, G., Petrovsky, N., Pillai, R., Pontius, J. U., Qi, D., Ramachandran, S., Ravasi, T., Reed, J. C., Reed, D. J., Reid, J., Ring, B. Z., Ringwald, M., Sandelin, A., Schneider, C., Semple, C. A., Setou, M., Shimada, K., Sultana, R., Takenaka, Y., Taylor, M. S., Teasdale, R. D., Tomita, M., Verardo, R., Wagner, L., Wahlestedt, C., Wang, Y., Watanabe, Y., Wells, C., Wilming, L. G., Wynshaw-Boris, A., Yanagisawa, M., Yang, I., Yang, L., Yuan, Z., Zavolan, M., Zhu, Y., Zimmer, A., Carninci, P., Hayatsu, N., Hirozane-Kishikawa, T., Konno, H., Nakamura, M., Sakazume, N., Sato, K., Shiraki, T., Waki, K., Kawai, J., Aizawa, K., Arakawa, T., Fukuda, S., Hara, A., Hashizume, W., Imotani, K., Ishii, Y., Itoh, M., Kagawa, I., Miyazaki, A., Sakai, K., Sasaki, D., Shibata, K., Shinagawa, A., Yasunishi, A., Yoshino, M., Waterston, R., Lander, E. S., Rogers, J., Birney, E., and Hayashizaki, Y. (2002) Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs, Nature 420, 563-573.
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsAmanda L. Blasius, Bruce Beutler
List |< first << previous [record 15 of 18] next >> last >|
Edit History
2011-01-07 9:32 AM (current)
2010-11-08 11:03 AM
2010-08-26 8:15 AM
2010-08-24 8:33 AM
2010-08-23 2:38 PM
2010-08-23 2:36 PM
2010-02-03 10:21 AM