Phenotypic Mutation 'hazelnut'

• Allele: hazelnut
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 142,395,181 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Gys2
• Gene Name: glycogen synthase 2
• Synonym(s): glycogen synthase, liver, LGS
• Chromosomal Location: 142,368,339-142,418,835 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, liver glycogen synthase, catalyzes the rate-limiting step in the synthesis of glycogen - the transfer of a glucose molecule from UDP-glucose to a terminal branch of the glycogen molecule. Mutations in this gene cause glycogen storage disease type 0 (GSD-0) - a rare type of early childhood fasting hypoglycemia with decreased liver glycogen content. [provided by RefSeq, Dec 2009] ; PHENOTYPE: Mice homozygous for a conditional allele knocked out in the liver results in abnormal glycogen homeostasis, altered glucose homeostasis, decreased exercise endurance, and a phenotype similar to patients with glycogen storage disease 0. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Methionine changed to Threonine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000032371]
• AlphaFold: Q8VCB3
• SMART Domains: Protein: ENSMUSP00000032371; Gene: ENSMUSG00000030244; AA Change: M428T

Domain	Start	End	E-Value	Type
Pfam:Glycogen_syn	32	667	N/A	PFAM

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
  (Using ENSMUST00000032371)
• Meta Mutation Damage Score: 0.8271
• Is this an essential gene?: Possibly nonessential (E-score: 0.347)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:42 PM by Anne Murray
• Record Created: 2016-09-23 10:15 PM
• Record Posted: 2018-08-29
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_145572; MGI:2385254

Alleles Listed at MGI

All Mutations and Alleles(3) Targeted(3)

Phenotypic Description

Figure 1. Hazelnut mice exhibited fasting hypoglycemia. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The hazelnut phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4588, some of which showed fasting hypoglycemia (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the fasting hypoglycemia phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 50 mutations (X-axis) identified in the G1 male of pedigree R4588. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 50 mutations. The hypoglycemia phenotype was linked by continuous variable mapping to three genes on chromosome 6: Atf7ip, Gys2, and Itpr2. The mutation in Gys2 was presumed causative as aberrant glucose levels have been observed in other Gys2 alleles (see candy_corn and embittered). The Gys2 mutation is a T to C transition at base pair 142,449,455 (v38) on chromosome 6, or base pair 23676 in the GenBank genomic region NC_000072 encoding Gys2. Linkage was found with a recessive model of inheritance, wherein three variant homozygotes departed phenotypically from 11 homozygous reference mice and 23 heterozygous mice with a P value of 5.759 x 10^-6 (Figure 2).  

The mutation corresponds to residue 1,591 in the mRNA sequence NM_145572 within exon 10 of 17 total exons.

1575 GATGACTTAACAATTATGAAAAGGGCCATTTTT 423  -D--D--L--T--I--M--K--R--A--I--F-

The mutated nucleotide is indicated in red. The mutation results in a methionine (M) to threonine (T) substitution at position 428 (M428T) in the GYS2 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.666).

Protein Prediction

Figure 3. Domain organization of GYS2. GYS2 has no known defined domain. Phosphorylation sites are shown as orange ovals. Secondary structures are based on AtGS (see Figure 4). β-strands are noted in blue, and α-helices are shown in pink. The hazelnut mutation results in a methionine to threonine substitution at position 428 in the GYS2 protein. The image is interactive. Click on each mutation to view more information.

Figure 4. Crystal structure of glycogen synthase from Agrobacterium tumefaciens. β-strands are shown in blue, and α-helices are shown in pink. UCSF Chimera model is based on PDB 1RZV. Click on the 3D structure to view it rotate.

Gys2 encodes glycogen synthase-2 (GYS2), the liver type of glycogen synthase; GYS1 is the skeletal muscle type of glycogen synthase. There are two forms of glycogen synthase: a skeletal muscle type (GYS1) and a liver type (GYS2). GYS1/2 does not have any defined domains.

The crystal structure of Agrobacterium tumefaciens GYS has been solved [Figures 3 and 4; PDB:1RZV; (1)]. A. tumefaciens GYS folds into two Rossman-fold domains; a deep fissure between the domains houses the catalytic center. Amino acids 1 to 244 forms a nine-stranded, predominantly parallel, central β-sheet flanked on both sides by seven α-helices. Amino acids 271 to 456 forms a six-stranded parallel β-sheet and nine α-helices. GYS has a kink at amino acids 457 to 460, with amino acids 461 to 477 crossing over to the N-terminal domain (amino acids 1 to 244) and continuing as an α-helix. The C-terminal ends of β-strands β13 (residues 297 to 299) and β14 (326 to 328) as well as the loop between β15 and α12 (352 to 356) form an ADP-binding pocket.

GYS1/2 can be phosphorylated by phosphorylase kinase during glycogen synthesis, converting GYS to an inactive form. GYS2 can also be phosphorylated by AMPK and PKA (Ser8), glycogen synthase kinase-3 (GSK3)-α and GSK3-β (Ser641, Ser745, Ser649, and Ser653), and casein kinase-II (Ser657). Dephosphorylation by protein phosphatase-1 at Ser641 and Ser645 activates GYS2.

The hazelnut mutation results in a methionine (M) to threonine (T) substitution at position 428 (M428T) in the GYS2 protein.

Expression/Localization

GYS2 is expressed in the liver and localizes to the cytoplasm. GYS2 expression oscillates in a circadian manner; peak levels occur at night (2).

Background

Figure 5. GYS2 and its function in glycogen biosynthesis. The synthesis of glycogen involves primarily the action of GYS1/2, which catalyzes the addition of α-1,4-linked glucose to the nonreducing end of the growing glycogen chain, and the branching enzyme (not shown), which introduces α-1,6-linked ramifications.

Glycogen is the primary carbohydrate storage form in the liver and skeletal muscle. Glycogen is a means by which the body stores excess glucose after elevation of blood glucose levels. During glycogen synthesis, glucose is phosphorylated (by hexokinases in the muscle and gluokinase in the liver) to form glucose-6-phosphate (G6P), which is subsequently isomerized by phosphoglucomutase to glucose-1-phosphate (G1P). G1P is activated by UDP-glucose pyrophosphorylase 2 which adds uridine to the G1P, resulting in the formation of uridine diphosphoglucose (UDP-glucose). Glycogenin attaches C-1 of a UDP-glucose to a tyrosine residue on the enzyme. After the addition of the first glucose, each glycogenin will add six to seven glucoses via alpha(1-4) bonds. Glycogenin-catalyzed linkage of several glucose units forms a primer for glycogen synthase recognition. Glycogen synthase catalyzes the rate-limiting step in glycogen synthesis:  the transfer of a glucose molecule from UDP-glucose to a terminal branch of the glycogen primer forming alpha(1,4) bonds (Figure 5). The branching enzyme amylo-(1,4 to 1,6)-transglycosylase produces the characteristic alpha(1,6) branches of glycogen by breaking alpha(1,4) chains and carrying the broken chain to carbon six. The reducing end of glycogen has a free carbon number one on glucose; the other ends are non-reducing ends. When glucose is needed in the body, the glycogen is broken down from the ends of the molecule causing release of G1P, rearrangement of the remaining glycogen to permit continued breakdown, and conversion of G1P to G6P. G6P can subsequently be broken down in glycolysis, oxidized in the pentose phosphate pathway, and/or converted to glucose by gluconeogenesis.

Mutations in human GYS2 and/or GYS2 deficiency are associated with liver glycogen storage disease-0 [GSD0A; OMIM: #240600; (3-5)]. Patients with GSD0A exhibit fasting hypoglycemia and hyperketonemia, but hyperglycemia and hyperlactatemia with feeding (4;6). A mutation in GYS2 (c.1802T>G; p. Leu601X) was identified in a patient with ketotic hypoglycemia (7). Patients with ketotic hypoglycemia have fasting hypoglycemia, but normal hormonal and metabolite profiles. GYS2 is a putative predisposing factor of polycystic ovary syndrome in relation to obesity in Korean women (8).

Putative Mechanism

Gys2-deficient (Gys2^-/-) mice exhibited reduced circulating levels of glucose, glycerol, liver glycogen, calcium, sodium, total protein, and chloride [MGI and (9)]. Homozygous mice expressing a mutant Gys2 (Gys2^R582A/R582A) exhibited reduced fasting glucose levels, but normal glucose levels after feeding (9). The Gys2^R582A/R582A mice also exhibited reduced circulating insulin levels, impaired basal production of glucose, impaired glucose tolerance, reduced glycogen catabolism, absent liver glycogen levels, insulin resistance, and increased liver triglyceride levels (9). Mice with liver-specific knockout of Gys2 exhibited reduced fed liver glycogen content, reduced circulating glucose levels in fed and fasted states, increased liver triglyceride levels, reduced systemic arterial diastolic blood pressure, and impaired exercise endurance (10). Expression of a constitutively active mutant GYS2 in rats caused lowering of blood glucose in the fed, but not fasted, state (11). Also, fasted rats overexpressing GYS2 showed increased clearance of blood glucose after glucose challenge (11).

The fasting hypoglycemia phenotype observed in the hazelnut mice is similar to that observed in the Gys2^-/- and Gys2^R582A/R582A mice, indicating loss of GYS2^haszelnut function.

Primers

PCR Primer
hazelnut_pcr_F: GGTTCAAAGAAATTCTGTAAGTGGG
hazelnut_pcr_R: GCGCACATGCACACAGATTC

Sequencing Primer
hazelnut_seq_F: GGTTAAAGGTTCTTGCTGCCAACC
hazelnut_seq_R: GCACACAGATTCTTATTCAGGGGC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 747 nucleotides is amplified (chromosome 6, - strand):

1   gcgcacatgc acacagattc ttattcaggg gcaaactcat tagtacatca gtttgaaact
61  aatggagttt tgaagttcaa atatatattg gcctaacttg ataaatgcat gaaaaatatt
121 tatatggcaa atctatttta acagcttagt aaataccact attacagtaa atgaactatt
181 tatgccggac aattagaaag cacttaacta gttccagcca tttttttatt tttaatactg
241 ttttcatcac agaggagaaa ttcctgacat gaatagtatt ttggatcgag atgacttaac
301 aattatgaaa agggccattt tttcaactca ggtaagaaaa actttaagtg cccaccatct
361 cccatgatca ttcaaatcaa cctaggcaat attgtcttca ttcatgtaaa ggaatgtgct
421 aaattaggaa tcttcaaatc tgcgagttga aaaagatact ggcctttcat tctgtttaca
481 tttgtggtta tggaacaggg caggttggaa ccagaggata atttgaagga cttacattct
541 ctctttcact gtgtgggtcc taaagatggg atttaaatta tcaggttggc agcaagaacc
601 tttaaccact gaccatcatt ttacccattt agaaaaaaat ctacttgaat gattttgtat
661 gtgcttttat gagttgtttc taggggattc ttttaaaaat ctcataaaag tctgtttttg
721 aacccactta cagaatttct ttgaacc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Buschiazzo, A., Ugalde, J. E., Guerin, M. E., Shepard, W., Ugalde, R. A., and Alzari, P. M. (2004) Crystal Structure of Glycogen Synthase: Homologous Enzymes Catalyze Glycogen Synthesis and Degradation. EMBO J. 23, 3196-3205.

  2. Doi, R., Oishi, K., and Ishida, N. (2010) CLOCK Regulates Circadian Rhythms of Hepatic Glycogen Synthesis through Transcriptional Activation of Gys2. J Biol Chem. 285, 22114-22121.

  3. Lewis, G. M., Spencer-Peet, J., and Stewart, K. M. (1963) Infantile Hypoglycaemia due to Inherited Deficiency of Glycogen Synthetase in Liver. Arch Dis Child. 38, 40-48.

  4. Gitzelmann, R., Spycher, M. A., Feil, G., Muller, J., Seilnacht, B., Stahl, M., and Bosshard, N. U. (1996) Liver Glycogen Synthase Deficiency: A Rarely Diagnosed Entity. Eur J Pediatr. 155, 561-567.

  5. Orho, M., Bosshard, N. U., Buist, N. R., Gitzelmann, R., Aynsley-Green, A., Blumel, P., Gannon, M. C., Nuttall, F. Q., and Groop, L. C. (1998) Mutations in the Liver Glycogen Synthase Gene in Children with Hypoglycemia due to Glycogen Storage Disease Type 0. J Clin Invest. 102, 507-515.

  6. Aynsley-Green, A., Williamson, D. H., and Gitzelmann, R. (1977) Hepatic Glycogen Synthetase Deficiency. Definition of Syndrome from Metabolic and Enzyme Studies on a 9-Year-Old Girl. Arch Dis Child. 52, 573-579.

  7. Nessa, A., Kumaran, A., Kirk, R., Dalton, A., Ismail, D., and Hussain, K. (2012) Mutational Analysis of the GYS2 Gene in Patients Diagnosed with Ketotic Hypoglycaemia. J Pediatr Endocrinol Metab. 25, 963-967.

  8. Hwang, J. Y., Lee, E. J., Jin Go, M., Sung, Y. A., Lee, H. J., Heon Kwak, S., Jang, H. C., Soo Park, K., Lee, H. J., Byul Jang, H., Song, J., Park, K. H., Kim, H. L., Cho, M. C., and Lee, J. Y. (2012) Genome-Wide Association Study Identifies GYS2 as a Novel Genetic Factor for Polycystic Ovary Syndrome through Obesity-Related Condition. J Hum Genet. 57, 660-664.

  9. von Wilamowitz-Moellendorff, A., Hunter, R. W., Garcia-Rocha, M., Kang, L., Lopez-Soldado, I., Lantier, L., Patel, K., Peggie, M. W., Martinez-Pons, C., Voss, M., Calbo, J., Cohen, P. T., Wasserman, D. H., Guinovart, J. J., and Sakamoto, K. (2013) Glucose-6-Phosphate-Mediated Activation of Liver Glycogen Synthase Plays a Key Role in Hepatic Glycogen Synthesis. Diabetes. 62, 4070-4082.

  10. Irimia, J. M., Meyer, C. M., Peper, C. L., Zhai, L., Bock, C. B., Previs, S. F., McGuinness, O. P., DePaoli-Roach, A., and Roach, P. J. (2010) Impaired Glucose Tolerance and Predisposition to the Fasted State in Liver Glycogen Synthase Knock-Out Mice. J Biol Chem. 285, 12851-12861.

  11. Ros, S., Zafra, D., Valles-Ortega, J., Garcia-Rocha, M., Forrow, S., Dominguez, J., Calbo, J., and Guinovart, J. J. (2010) Hepatic Overexpression of a Constitutively Active Form of Liver Glycogen Synthase Improves Glucose Homeostasis. J Biol Chem. 285, 37170-37177.