Phenotypic Mutation 'candy_corn'

• Allele: candy_corn
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 142,402,059 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Gys2
• Gene Name: glycogen synthase 2
• Synonym(s): glycogen synthase, liver, LGS
• Chromosomal Location: 142,368,339-142,418,835 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, liver glycogen synthase, catalyzes the rate-limiting step in the synthesis of glycogen - the transfer of a glucose molecule from UDP-glucose to a terminal branch of the glycogen molecule. Mutations in this gene cause glycogen storage disease type 0 (GSD-0) - a rare type of early childhood fasting hypoglycemia with decreased liver glycogen content. [provided by RefSeq, Dec 2009] ; PHENOTYPE: Mice homozygous for a conditional allele knocked out in the liver results in abnormal glycogen homeostasis, altered glucose homeostasis, decreased exercise endurance, and a phenotype similar to patients with glycogen storage disease 0. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamic Acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000032371]
• AlphaFold: Q8VCB3
• SMART Domains: Protein: ENSMUSP00000032371; Gene: ENSMUSG00000030244; AA Change: E260G

Domain	Start	End	E-Value	Type
Pfam:Glycogen_syn	32	667	N/A	PFAM

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
  (Using ENSMUST00000032371)
• Meta Mutation Damage Score: 0.1867
• Is this an essential gene?: Possibly nonessential (E-score: 0.299)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2022-04-12 3:40 PM by External Program
• Record Created: 2016-09-28 3:50 PM
• Record Posted: 2018-08-29
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: James Butler, Emre Turer, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_145572; MGI:2385254

Alleles Listed at MGI

All Mutations and Alleles(3) Targeted(3)

Phenotypic Description

Figure 1. Candy_corn mice exhibited hyperglycemia in response to glucose stimulation. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The candy_corn phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3151, some of which showed hyperglycemia 30 minutes after glucose challenge (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the hyperglycemia phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 65 mutations (X-axis) identified in the G1 male of pedigree R3151. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 65 mutations. The hyperglycemia phenotype was linked by continuous variable mapping to a mutation in Gys2: an A to G transition at base pair 142,456,333 (v38) on chromosome 6, or base pair 16,798 in the GenBank genomic region NC_000072 encoding Gys2. Linkage was found with a recessive model of inheritance, wherein 10 variant homozygotes departed phenotypically from nine homozygous reference mice and 27 heterozygous mice with a P value of 1.88 x 10^-4 (Figure 2).  

The mutation corresponds to residue 1,087 in the mRNA sequence NM_145572 within exon 5 of 17 total exons.

1071 TTCACCACAGTGTCAGAAATCACAGCCATCGAG 255  -F--T--T--V--S--E--I--T--A--I--E-

The mutated nucleotide is indicated in red.  The mutation results in a glutamic acid (E) to glycine (G) substitution at position 260 (E260G) in the GYS2 protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.001).

**this is a double linkage of Gys2 and Rab33b

Protein Prediction

Figure 3. Domain organization of GYS2. GYS2 has no known defined domain. Phosphorylation sites are shown as orange ovals. Secondary structures are based on AtGS (see Figure 4). β-strands are noted in blue, and α-helices are shown in pink. The candy_corn mutation results in a glutamic acid to glycine substitution at position 260 in the GYS2 protein. The image is interactive. Click on each mutation to view more information.

Figure 4. Crystal structure of glycogen synthase from Agrobacterium tumefaciens. β-strands are shown in blue, and α-helices are shown in pink. UCSF Chimera model is based on PDB 1RZV. Click on the 3D structure to view it rotate.

Gys2 encodes liver-specific glycogen synthase-2 (GYS2). GYS2 does not have defined domains (Figure 3 & 4). The candy_corn mutation results in a glutamic acid (E) to glycine (G) substitution at position 260 (E260G) in the GYS2 protein.

For more information about Gys2, please see the record for hazelnut.

Putative Mechanism

Glycogen is a primary carbohydrate storage form primarily found in liver and skeletal muscle. Glycogen synthase catalyzes the rate-limiting step in glycogen synthesis:  the transfer of a glucose molecule from uridine diphosphoglucose (UDPG) to a terminal branch of the glycogen primer by alpha(1,4) bonds. The branching enzyme amylo-(1,4 to 1,6)-transglycosylase produces the characteristic alpha(1,6) branches of glycogen by breaking alpha(1,4) chains and carrying the broken chain to the carbon #6.

Mutations in human GYS2 and/or GYS2 deficiency are associated with liver glycogen storage disease-0 [GSD0A; OMIM: #240600; (1-3)]. Patients with GSD0A exhibit fasting hypoglycemia and hyperketonemia, but hyperglycemia and hyperlactatemia with feeding (2;4). A mutation in GYS2 (c.1802T>G; p. Leu601X) was identified in a patient with ketotic hypoglycemia (5). Patients with ketotic hypoglycemia have fasting hypoglycemia, but normal hormonal and metabolite profiles. GYS2 is a putative predisposing factor of polycystic ovary syndrome in relation to obesity in Korean women (6).

Gys2-deficient mice exhibited reduced circulating levels of glucose, glycerol, liver glycogen, calcium, sodium, total protein, and chloride [MGI and (7)]. Homozygous mice expressing a mutant Gys2 (Gys2^R582A/R582A) exhibit reduced fasting glucose levels, but normal glucose levels after feeding (7). The Gys2^R582A/R582A mice exhibited reduced circulating insulin levels, impaired basal production of glucose, impaired glucose tolerance, reduced glycogen catabolism, absent liver glycogen levels, insulin resistance, and increased liver triglyceride levels (7). Mice with liver-specific knockout of Gys2 exhibited reduction in fed liver glycogen content, reduced circulating glucose levels in fed and fasted states, increased liver triglyceride levels, reduced systemic arterial diastolic blood pressure, and impaired exercise endurance (8). Expression of a constitutively active mutant GYS2 in rats caused lowering of blood glucose in the fed, but not fasted state (9). Also, fasted rats overexpressing GYS2 showed increased clearance of blood glucose after glucose challenge (9).

The impaired glucose tolerance phenotype observed in the candy_corn mice indicates loss of GYS2^candy_corn function. Some function may be retained as changes in fasting glucose levels were not noted.

Primers

PCR Primer
candy_corn_pcr_F: TCTTGAAGACCCCACCTCTAG
candy_corn_pcr_R: CAGACTTGAAGTGAACAGTGCTG

Sequencing Primer
candy_corn_seq_F: TGAAGACCCCACCTCTAGACACC
candy_corn_seq_R: GGGGTCTTTACAACTTCAATCAGC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 436 nucleotides is amplified (chromosome 6, - strand):

1   cagacttgaa gtgaacagtg ctgttaaaaa taccaatttt atactctagc cagtggctta
61  atatccacta gtcctttaat ggggtcttta caacttcaat cagctctgag gaaaaccttg
121 gcatgtggag ggggtcctgt aaggaacgtg tgtttgtctt caacagttcg acattgacaa
181 agaggccggg gagaggcaga tataccaccg ctactgcatg gagcgggcat ccgtgcactg
241 tgcgcacgtg ttcaccacag tgtcagaaat cacagccatc gaggcagagc acatgctgaa
301 gaggaagcct ggtaatgaca gaggctgggt ttgccaccct aacacatgca gcacccttgc
361 ttaattgctg tgctctcacc tgcggtttcc tagttgtcag agaccacttg ggtgtctaga
421 ggtggggtct tcaaga

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Lewis, G. M., Spencer-Peet, J., and Stewart, K. M. (1963) Infantile Hypoglycaemia due to Inherited Deficiency of Glycogen Synthetase in Liver. Arch Dis Child. 38, 40-48.

  2. Gitzelmann, R., Spycher, M. A., Feil, G., Muller, J., Seilnacht, B., Stahl, M., and Bosshard, N. U. (1996) Liver Glycogen Synthase Deficiency: A Rarely Diagnosed Entity. Eur J Pediatr. 155, 561-567.

  3. Orho, M., Bosshard, N. U., Buist, N. R., Gitzelmann, R., Aynsley-Green, A., Blumel, P., Gannon, M. C., Nuttall, F. Q., and Groop, L. C. (1998) Mutations in the Liver Glycogen Synthase Gene in Children with Hypoglycemia due to Glycogen Storage Disease Type 0. J Clin Invest. 102, 507-515.

  4. Aynsley-Green, A., Williamson, D. H., and Gitzelmann, R. (1977) Hepatic Glycogen Synthetase Deficiency. Definition of Syndrome from Metabolic and Enzyme Studies on a 9-Year-Old Girl. Arch Dis Child. 52, 573-579.

  5. Nessa, A., Kumaran, A., Kirk, R., Dalton, A., Ismail, D., and Hussain, K. (2012) Mutational Analysis of the GYS2 Gene in Patients Diagnosed with Ketotic Hypoglycaemia. J Pediatr Endocrinol Metab. 25, 963-967.

  6. Hwang, J. Y., Lee, E. J., Jin Go, M., Sung, Y. A., Lee, H. J., Heon Kwak, S., Jang, H. C., Soo Park, K., Lee, H. J., Byul Jang, H., Song, J., Park, K. H., Kim, H. L., Cho, M. C., and Lee, J. Y. (2012) Genome-Wide Association Study Identifies GYS2 as a Novel Genetic Factor for Polycystic Ovary Syndrome through Obesity-Related Condition. J Hum Genet. 57, 660-664.

  7. von Wilamowitz-Moellendorff, A., Hunter, R. W., Garcia-Rocha, M., Kang, L., Lopez-Soldado, I., Lantier, L., Patel, K., Peggie, M. W., Martinez-Pons, C., Voss, M., Calbo, J., Cohen, P. T., Wasserman, D. H., Guinovart, J. J., and Sakamoto, K. (2013) Glucose-6-Phosphate-Mediated Activation of Liver Glycogen Synthase Plays a Key Role in Hepatic Glycogen Synthesis. Diabetes. 62, 4070-4082.

  8. Irimia, J. M., Meyer, C. M., Peper, C. L., Zhai, L., Bock, C. B., Previs, S. F., McGuinness, O. P., DePaoli-Roach, A., and Roach, P. J. (2010) Impaired Glucose Tolerance and Predisposition to the Fasted State in Liver Glycogen Synthase Knock-Out Mice. J Biol Chem. 285, 12851-12861.

  9. Ros, S., Zafra, D., Valles-Ortega, J., Garcia-Rocha, M., Forrow, S., Dominguez, J., Calbo, J., and Guinovart, J. J. (2010) Hepatic Overexpression of a Constitutively Active Form of Liver Glycogen Synthase Improves Glucose Homeostasis. J Biol Chem. 285, 37170-37177.