Phenotypic Mutation 'celina2'

• Allele: celina2
• Mutation Type: critical splice donor site
• Chromosome: 2
• Coordinate: 11,231,797 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Prkcq
• Gene Name: protein kinase C, theta
• Synonym(s): A130035A12Rik, PKC-theta, PKC theta, PKC-0, Pkcq, PKCtheta
• Chromosomal Location: 11,176,922-11,306,033 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipid-dependent protein kinase. This kinase is important for T-cell activation. It is required for the activation of the transcription factors NF-kappaB and AP-1, and may link the T cell receptor (TCR) signaling complex to the activation of the transcription factors. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced T cell proliferative responses and interleukin 2 production and a lack of T cell receptor-initiated NF-kappaB activation in mature T lymphocytes. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 11172108 - 11301222 bp
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000028118 ^†] [ENSMUSP00000100035 ^†] † probably from a misspliced transcript
• AlphaFold: Q02111
• PDB Structure: Identification of the Activator Binding Residues in the Second Cysteine-Rich Regulatory Domain of Protein Kinase C Theta [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000028118; Gene: ENSMUSG00000026778

Domain	Start	End	E-Value	Type
PDB:2ENJ|A	3	126	6e-83	PDB
C1	160	209	3.27e-15	SMART
C1	232	281	2.22e-17	SMART
S_TKc	380	634	1.17e-97	SMART
S_TK_X	635	698	2.6e-26	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000100035; Gene: ENSMUSG00000026778

Domain	Start	End	E-Value	Type
PDB:2ENJ|A	3	126	2e-84	PDB
C1	160	209	3.27e-15	SMART
C1	232	281	2.22e-17	SMART
Pfam:Pkinase_Tyr	380	558	2.8e-27	PFAM
Pfam:Pkinase	380	560	2.2e-47	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000110503; Gene: ENSMUSG00000026778

Domain	Start	End	E-Value	Type
PDB:2ENJ|A	3	126	9e-86	PDB
Blast:C2	6	101	2e-44	BLAST
C1	160	209	3.27e-15	SMART
C1	232	281	2.22e-17	SMART
Pfam:Pkinase	380	465	1.7e-8	PFAM

• Predicted Effect: noncoding transcript
• Meta Mutation Damage Score: 0.9485
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:42 PM by Anne Murray
• Record Created: 2016-10-10 8:59 PM by Jin Huk Choi
• Record Posted: 2016-11-08
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Jin Huk Choi, James Butler, Bruce Beutler

Accession Number

NCBI RefSeq: NM_008859; MGI:97601

Alleles Listed at MGI

All Mutations and Alleles(5) : Targeted(5)

Phenotypic Description

Figure 1. Homozygous celina2 mice exhibit diminished T-dependent IgG responses to OVA/alum. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The celina2 phenotype was identified among G3 mice of the pedigree R4820, some of which showed diminished T-dependent antibody responses to OVA/alum (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced T-dependent IgG response to OVA/alum using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 36 mutations (X-axis) identified in the G1 male of pedigree R4820. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 36 mutations. The diminished T-dependent antibody response to OVA/alum was linked by continuous variable mapping to a mutation in Prkcq. The Prkcq mutation is an A to G transition at base pair 11,226,986 (v38) on chromosome 2, or base pair 55,083 in the GenBank genomic region NC_000068 within the donor splice site of intron 2 (Transcript_ID = ENSMUST00000028118.8). Linkage was found with a recessive model of inheritance, wherein two variant homozygotes departed phenotypically from five homozygous reference mice and seven heterozygous mice with a P value of 2.54 x 10^-4 (Figure 2).  The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in the use of a cryptic site in exon 1 (out of 16 total exons; Transcript_ID = ENSMUST00000102970.4). Use of the cryptic site in exon 1 would result in a 14-base pair deletion in exon 1 and a frame-shifted protein product beginning after amino acid 34 and terminating after the inclusion of 20 aberrant amino acids.

C57BL/6J:                              <--exon 2-->         intron 2-->      exon 3--> 54965 ……ATGTCACCGTTT……TATGTGGAATCAG gtaaattaactggg…… AAAATGGGCAG…… 1     ……-M--S--P--F-……-Y--V--E--S--                  E--N--G--Q-……

Genomic numbering corresponds to NC_000068. The donor splice site of intron 1, which is destroyed by the celina2 mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 3. Domain organization of PKCθ. The celina2 mutation is in the donor splice site of intron 2. C2 designates the C2-like pTyr-binding domain; C1a and C1b are cysteine-rich zinc fingers. This image is interactive; click to view the locations of additional mutations in PKCθ.

Prkcq encodes protein kinase C theta (PKCθ), a member of the PKC family of serine threonine kinases. PKC kinases share certain structural features including a highly conserved catalytic domain consisting of motifs required for ATP-substrate binding and catalysis, and a regulatory domain that maintains the enzyme in an inactive conformation. The regulatory and catalytic domains are attached to each other by a hinge region (Figure 3). PKCθ has a N-terminal C2-like pTyr-binding domain (amino acids 8-123), a C2-like domain, a proline-rich motif in the V3 (hinge) domain that mediates CD28 interaction and immunological synapse translocation, and two tandem cysteine-rich zinc finger C1 domains (amino acids 159-209 and 231-281) that bind diacylglycerol (1).

The celina2 mutation is predicted to destroy the splice donor site of intron 1, leading to a frame-shifted protein product and coding of a premature stop codon at amino acid 54 after the inclusion of 20 aberrant amino acids.

For more information about Prkcq, please see the record for celina.

Putative Mechanism

PKCs are involved in receptor desensitization, modulating membrane structure events, regulating transcription, mediating immune responses, regulating cell growth, and in learning and memory. PKCθ has roles in the regulation of migration, lymphoid cell motility, insulin signaling in skeletal muscle cells, insulin secretion and resistance, T cell activation, survival responses in adult T cells and T cell FasL-mediated apoptosis (see the record for riogrande), mast cell activation, neuronal differentiation and function, development of the peripheral and central nervous system (2-13). PKCθ also has putative functions in mitosis and the cell cycle (14-18).

B cell responses are classified as T-dependent (T-D) or T-independent (T-I) based on their requirement for T cell help in antibody production. T cell-dependent antigens are processed and presented to helper T cells via the MHC class II molecules, whereas T cell-independent antigens are typically polysaccharides that cannot be processed and presented by MHC molecules. These antigens are often expressed on the surface of pathogens in an organized, highly repetitive form that can activate specific B cells by cross-linking of antigen receptors. The formation of antigen receptor clusters can recruit and activate multiple Btk molecules, resulting in long-term mobilization of intracellular ionized Ca²⁺, gene transcription and B cell activation and proliferation. Toll-like receptor (TLR) engagement provides a second signal that allows the secretion of antibody in response to these antigens. The T-D B cell response is mediated by conventional (follicular B-2) B cells, while T-I B cell responses are mediated by peritoneal B-1 and marginal zone (MZ) B cells [reviewed by (19;20)]. The reduction of B cell antibody responses to OVA-alum in the celina2 mice suggests that the function of antigen processing may be impaired.

Primers

PCR Primer
celina2_pcr_F: CTGTCTGAGATAAAACACTAAGTGG
celina2_pcr_R: AGAGGCCATCACTAAGCCTG

Sequencing Primer
celina2_seq_F: CTGAGATAAAACACTAAGTGGAGGTG
celina2_seq_R: TTGTCTAGTCTAGCCACC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 402 nucleotides is amplified (chromosome 2, + strand):

1   ctgtctgaga taaaacacta agtggaggtg gaacactaaa aataatatgt cttagagccc
61  catacataca gtgtttgtct tttgtcattt ttctagggaa caaccatgtc accgtttctt
121 cgaatcggtt tatccaactt tgactgtggg acctgccaag cttgtcaggg agaggcagtg
181 aacccctact gcgctgtgct tgtcaaagag tatgtggaat caggtaaatt aactggggtc
241 gggggggggg gggagaagag gagatggtgg ctagactaga caagcacttg ggagacgaga
301 ccttccagga tgtctgatgg aactgaatgt cacagtttag gacactggtg accaacaaag
361 gccaaattct ttcttaagga ctcaggctta gtgatggcct ct

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Kong, K. F., Yokosuka, T., Canonigo-Balancio, A. J., Isakov, N., Saito, T., and Altman, A. (2011) A Motif in the V3 Domain of the Kinase PKC-Theta Determines its Localization in the Immunological Synapse and Functions in T Cells Via Association with CD28. Nat Immunol. 12, 1105-1112.

  2. Tang, S., Gao, Y., and Ware, J. A. (1999) Enhancement of Endothelial Cell Migration and in Vitro Tube Formation by TAP20, a Novel Beta 5 Integrin-Modulating, PKC Theta-Dependent Protein. J Cell Biol. 147, 1073-1084.

  3. Shahabi, N. A., McAllen, K., and Sharp, B. M. (2008) Stromal Cell-Derived Factor 1-Alpha (SDF)-Induced Human T Cell Chemotaxis Becomes Phosphoinositide 3-Kinase (PI3K)-Independent: Role of PKC-Theta. J Leukoc Biol. 83, 663-671.

  4. Schmitz-Peiffer, C., Browne, C. L., Oakes, N. D., Watkinson, A., Chisholm, D. J., Kraegen, E. W., and Biden, T. J. (1997) Alterations in the Expression and Cellular Localization of Protein Kinase C Isozymes Epsilon and Theta are Associated with Insulin Resistance in Skeletal Muscle of the High-Fat-Fed Rat. Diabetes. 46, 169-178.

  5. Serra, C., Federici, M., Buongiorno, A., Senni, M. I., Morelli, S., Segratella, E., Pascuccio, M., Tiveron, C., Mattei, E., Tatangelo, L., Lauro, R., Molinaro, M., Giaccari, A., and Bouche, M. (2003) Transgenic Mice with Dominant Negative PKC-Theta in Skeletal Muscle: A New Model of Insulin Resistance and Obesity. J Cell Physiol. 196, 89-97.

  6. Kim, J. K., Fillmore, J. J., Sunshine, M. J., Albrecht, B., Higashimori, T., Kim, D. W., Liu, Z. X., Soos, T. J., Cline, G. W., O'Brien, W. R., Littman, D. R., and Shulman, G. I. (2004) PKC-Theta Knockout Mice are Protected from Fat-Induced Insulin Resistance. J Clin Invest. 114, 823-827.

  7. Monks, C. R., Kupfer, H., Tamir, I., Barlow, A., and Kupfer, A. (1997) Selective Modulation of Protein Kinase C-Theta during T-Cell Activation. Nature. 385, 83-86.

  8. Coudronniere, N., Villalba, M., Englund, N., and Altman, A. (2000) NF-Kappa B Activation Induced by T Cell receptor/CD28 Costimulation is Mediated by Protein Kinase C-Theta. Proc Natl Acad Sci U S A. 97, 3394-3399.

  9. Villalba, M., Bushway, P., and Altman, A. (2001) Protein Kinase C-Theta Mediates a Selective T Cell Survival Signal Via Phosphorylation of BAD. J Immunol. 166, 5955-5963.

  10. Bertolotto, C., Maulon, L., Filippa, N., Baier, G., and Auberger, P. (2000) Protein Kinase C Theta and Epsilon Promote T-Cell Survival by a Rsk-Dependent Phosphorylation and Inactivation of BAD. J Biol Chem. 275, 37246-37250.

  11. Manicassamy, S., Gupta, S., Huang, Z., and Sun, Z. (2006) Protein Kinase C-Theta-Mediated Signals Enhance CD4+ T Cell Survival by Up-Regulating Bcl-xL. J Immunol. 176, 6709-6716.

  12. Manicassamy, S., and Sun, Z. (2007) The Critical Role of Protein Kinase C-Theta in Fas/Fas Ligand-Mediated Apoptosis. J Immunol. 178, 312-319.

  13. Besalduch, N., Santafe, M. M., Garcia, N., Gonzalez, C., Tomas, M., Tomas, J., and Lanuza, M. A. (2011) Transmitter Release in the Neuromuscular Synapse of the Protein Kinase C Theta-Deficient Adult Mouse. J Comp Neurol. 519, 849-855.

  14. Deeds, L., Teodorescu, S., Chu, M., Yu, Q., and Chen, C. Y. (2003) A p53-Independent G1 Cell Cycle Checkpoint Induced by the Suppression of Protein Kinase C Alpha and Theta Isoforms. J Biol Chem. 278, 39782-39793.

  15. Passalacqua, M., Patrone, M., Sparatore, B., Melloni, E., and Pontremoli, S. (1999) Protein Kinase C-Theta is Specifically Localized on Centrosomes and Kinetochores in Mitotic Cells. Biochem J. 337 ( Pt 1), 113-118.

  16. Wilda, M., Ghaffari-Tabrizi, N., Reisert, I., Utermann, G., Baier, G., and Hameister, H. (2001) Protein Kinase C Isoenzyme: Selective Expression Pattern of Protein Kinase C-θ during Mouse Development. Mech Dev. 103, 197-200.

  17. Hilgenberg, L., and Miles, K. (1995) Developmental Regulation of a Protein Kinase C Isoform Localized in the Neuromuscular Junction. J Cell Sci. 108 ( Pt 1), 51-61.

  18. Michalczyk, I., Sikorski, A. F., Kotula, L., Junghans, R. P., and Dubielecka, P. M. (2013) The Emerging Role of Protein Kinase Ctheta in Cytoskeletal Signaling. J Leukoc Biol. 93, 319-327.

  19. Alugupalli, K. R. (2008) A Distinct Role for B1b Lymphocytes in T Cell-Independent Immunity. Curr Top Microbiol Immunol. 319, 105-130.

  20. Vos, Q., Lees, A., Wu, Z. Q., Snapper, C. M., and Mond, J. J. (2000) B-Cell Activation by T-Cell-Independent Type 2 Antigens as an Integral Part of the Humoral Immune Response to Pathogenic Microorganisms. Immunol Rev. 176, 154-170.