Phenotypic Mutation 'celina2' (pdf version)
List |< first << previous [record 60 of 511] next >> last >|
Allelecelina2
Mutation Type critical splice donor site
Chromosome2
Coordinate11,226,986 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Prkcq
Gene Name protein kinase C, theta
Synonym(s) PKC theta, PKC-0, PKCtheta, PKC-theta, A130035A12Rik, Pkcq
Chromosomal Location 11,172,108-11,301,222 bp (+)
MGI Phenotype Homozygotes for targeted null mutations exhibit reduced T cell proliferative responses and interleukin 2 production and a lack of T cell receptor-initiated NF-kappaB activation in mature T lymphocytes.
Accession Number

NCBI RefSeq: NM_008859; MGI:97601

Mapped Yes 
Limits of the Critical Region 11172108 - 11301222 bp
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000028118] [ENSMUSP00000100035]
PDB Structure
Identification of the Activator Binding Residues in the Second Cysteine-Rich Regulatory Domain of Protein Kinase C Theta [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000028118
Gene: ENSMUSG00000026778

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 6e-83 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
S_TKc 380 634 1.17e-97 SMART
S_TK_X 635 698 2.6e-26 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000100035
Gene: ENSMUSG00000026778

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 2e-84 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
Pfam:Pkinase_Tyr 380 558 2.8e-27 PFAM
Pfam:Pkinase 380 560 2.2e-47 PFAM
Predicted Effect probably null
Phenotypic Category T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(5) : Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Prkcq APN 2 11283843 missense probably benign 0.37
IGL01656:Prkcq APN 2 11226955 missense probably damaging 1.00
IGL01732:Prkcq APN 2 11260833 splice donor site probably benign 0.00
IGL02136:Prkcq APN 2 11260668 missense probably benign 0.00
IGL02161:Prkcq APN 2 11277076 missense probably benign 0.00
IGL02178:Prkcq APN 2 11277040 missense probably damaging 1.00
IGL03107:Prkcq APN 2 11260786 missense possibly damaging 0.57
IGL03149:Prkcq APN 2 11232545 missense probably benign 0.00
celina UTSW 2 11283849 missense possibly damaging 0.75
3-1:Prkcq UTSW 2 11300094 missense probably damaging 1.00
K3955:Prkcq UTSW 2 11246793 splice acceptor site probably benign
R0049:Prkcq UTSW 2 11283832 missense probably benign 0.01
R0049:Prkcq UTSW 2 11283832 missense probably benign 0.01
R0183:Prkcq UTSW 2 11253162 missense probably damaging 1.00
R0366:Prkcq UTSW 2 11246838 splice donor site probably benign
R0388:Prkcq UTSW 2 11254234 missense probably benign 0.00
R1385:Prkcq UTSW 2 11256286 missense probably damaging 1.00
R1687:Prkcq UTSW 2 11290533 missense probably damaging 1.00
R1693:Prkcq UTSW 2 11254199 missense probably damaging 0.99
R1760:Prkcq UTSW 2 11300070 missense probably damaging 1.00
R1764:Prkcq UTSW 2 11232631 missense probably damaging 1.00
R1968:Prkcq UTSW 2 11245397 missense probably damaging 1.00
R2020:Prkcq UTSW 2 11279521 missense probably benign 0.00
R2108:Prkcq UTSW 2 11232569 missense probably damaging 1.00
R2762:Prkcq UTSW 2 11232640 missense possibly damaging 0.75
R3402:Prkcq UTSW 2 11283849 missense possibly damaging 0.82
R3429:Prkcq UTSW 2 11246970 missense probably damaging 1.00
R3545:Prkcq UTSW 2 11283816 missense probably benign 0.11
R3547:Prkcq UTSW 2 11283816 missense probably benign 0.11
R3893:Prkcq UTSW 2 11226971 missense probably damaging 1.00
R3900:Prkcq UTSW 2 11260866 missense noncoding transcript
R4086:Prkcq UTSW 2 11283868 missense probably damaging 0.97
R4423:Prkcq UTSW 2 11256169 missense possibly damaging 0.66
R4541:Prkcq UTSW 2 11283812 missense possibly damaging 0.84
R4649:Prkcq UTSW 2 11279522 missense possibly damaging 0.83
R4652:Prkcq UTSW 2 11279522 missense possibly damaging 0.83
R4749:Prkcq UTSW 2 11248157 missense noncoding transcript
R4820:Prkcq UTSW 2 11226986 critical splice donor site probably null
R5197:Prkcq UTSW 2 11299416 missense probably damaging 1.00
R5470:Prkcq UTSW 2 11260721 missense noncoding transcript
R5653:Prkcq UTSW 2 11299993 nonsense probably null
R5655:Prkcq UTSW 2 11260830 missense noncoding transcript
R5786:Prkcq UTSW 2 11253212 missense noncoding transcript
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 11/08/2016 10:08 AM by Anne Murray
Record Created 10/10/2016 8:59 PM by Jin Huk Choi
Record Posted 11/08/2016
Phenotypic Description

Figure 1. Homozygous celina2 mice exhibit diminished T-dependent IgG responses to OVA/alum. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The celina2 phenotype was identified among G3 mice of the pedigree R4820, some of which showed diminished T-dependent antibody responses to OVA/alum (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced T-dependent IgG response to OVA/alum using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 36 mutations (X-axis) identified in the G1 male of pedigree R4820. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 36 mutations. The diminished T-dependent antibody response to OVA/alum was linked by continuous variable mapping to a mutation in Prkcq. The Prkcq mutation is an A to G transition at base pair 11,226,986 (v38) on chromosome 2, or base pair 55,083 in the GenBank genomic region NC_000068 within the donor splice site of intron 2 (Transcript_ID = ENSMUST00000028118.8). Linkage was found with a recessive model of inheritance, wherein two variant homozygotes departed phenotypically from five homozygous reference mice and seven heterozygous mice with a P value of 2.54 x 10-4 (Figure 2).  The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in the use of a cryptic site in exon 1 (out of 16 total exons; Transcript_ID = ENSMUST00000102970.4). Use of the cryptic site in exon 1 would result in a 14-base pair deletion in exon 1 and a frame-shifted protein product beginning after amino acid 34 and terminating after the inclusion of 20 aberrant amino acids.

 

C57BL/6J:              

               <--exon 2-->         intron 2-->      exon 3-->

54965 ……ATGTCACCGTTT……TATGTGGAATCAG gtaaattaactggg…… AAAATGGGCAG……
1     ……-M--S--P--F-……-Y--V--E--S--                  E--N--G--Q-……

 

Genomic numbering corresponds to NC_000068. The donor splice site of intron 1, which is destroyed by the celina2 mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction
Figure 3. Domain organization of PKCθ. The celina2 mutation is in the donor splice site of intron 2. C2 designates the C2-like pTyr-binding domain; C1a and C1b are cysteine-rich zinc fingers. This image is interactive; click to view the locations of additional mutations in PKCθ.

Prkcq encodes protein kinase C theta (PKCθ), a member of the PKC family of serine threonine kinases. PKC kinases share certain structural features including a highly conserved catalytic domain consisting of motifs required for ATP-substrate binding and catalysis, and a regulatory domain that maintains the enzyme in an inactive conformation. The regulatory and catalytic domains are attached to each other by a hinge region (Figure 3). PKCθ has a N-terminal C2-like pTyr-binding domain (amino acids 8-123), a C2-like domain, a proline-rich motif in the V3 (hinge) domain that mediates CD28 interaction and immunological synapse translocation, and two tandem cysteine-rich zinc finger C1 domains (amino acids 159-209 and 231-281) that bind diacylglycerol (1).

 

The celina2 mutation is predicted to destroy the splice donor site of intron 1, leading to a frame-shifted protein product and coding of a premature stop codon at amino acid 54 after the inclusion of 20 aberrant amino acids.

 

For more information about Prkcq, please see the record for celina.

Putative Mechanism

PKCs are involved in receptor desensitization, modulating membrane structure events, regulating transcription, mediating immune responses, regulating cell growth, and in learning and memory. PKCθ has roles in the regulation of migration, lymphoid cell motility, insulin signaling in skeletal muscle cells, insulin secretion and resistance, T cell activation, survival responses in adult T cells and T cell FasL-mediated apoptosis (see the record for riogrande), mast cell activation, neuronal differentiation and function, development of the peripheral and central nervous system (2-13). PKCθ also has putative functions in mitosis and the cell cycle (14-18).

 

B cell responses are classified as T-dependent (T-D) or T-independent (T-I) based on their requirement for T cell help in antibody production. T cell-dependent antigens are processed and presented to helper T cells via the MHC class II molecules, whereas T cell-independent antigens are typically polysaccharides that cannot be processed and presented by MHC molecules. These antigens are often expressed on the surface of pathogens in an organized, highly repetitive form that can activate specific B cells by cross-linking of antigen receptors. The formation of antigen receptor clusters can recruit and activate multiple Btk molecules, resulting in long-term mobilization of intracellular ionized Ca2+, gene transcription and B cell activation and proliferation. Toll-like receptor (TLR) engagement provides a second signal that allows the secretion of antibody in response to these antigens. The T-D B cell response is mediated by conventional (follicular B-2) B cells, while T-I B cell responses are mediated by peritoneal B-1 and marginal zone (MZ) B cells [reviewed by (19;20)]. The reduction of B cell antibody responses to OVA-alum in the celina2 mice suggests that the function of antigen processing may be impaired.

Primers PCR Primer
celina2(F):5'- CTGTCTGAGATAAAACACTAAGTGG -3'
celina2(R):5'- AGAGGCCATCACTAAGCCTG -3'

Sequencing Primer
celina2_seq(F):5'- CTGAGATAAAACACTAAGTGGAGGTG -3'
celina2_seq(R):5'- TTGTCTAGTCTAGCCACC -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsJin Huk Choi, James Butler, Bruce Beutler
List |< first << previous [record 60 of 511] next >> last >|