Phenotypic Mutation 'unmodulated2'

• Allele: unmodulated2
• Mutation Type: splice site
• Chromosome: 5
• Coordinate: 140,869,537 bp (GRCm39)
• Base Change: G ⇒ T (forward strand)
• Gene: Card11
• Gene Name: caspase recruitment domain family, member 11
• Synonym(s): 2410011D02Rik, BIMP3, CARMA1, 0610008L17Rik
• Chromosomal Location: 140,858,745-140,986,337 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 140872999 - 141000596 bp
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000082941 ^†] † probably from a misspliced transcript
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000082941; Gene: ENSMUSG00000036526

Domain	Start	End	E-Value	Type
Pfam:CARD	23	109	1.3e-23	PFAM
coiled coil region	176	440	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
low complexity region	535	549	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
PDZ	674	755	2.73e-1	SMART
Blast:SH3	776	838	1e-10	BLAST
low complexity region	839	850	N/A	INTRINSIC
low complexity region	920	934	N/A	INTRINSIC
SCOP:d1kjwa2	970	1149	1e-18	SMART
Blast:GuKc	973	1139	1e-102	BLAST

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm
• Last Updated: 2019-09-04 9:42 PM by Diantha La Vine
• Record Created: 2016-10-12 3:41 PM by Jin Huk Choi
• Record Posted: 2016-11-28
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Jin Huk Choi, James Butler, Bruce Beutler

Accession Number

NCBI RefSeq: NM_175362; MGI:1916978

Alleles Listed at MGI

NCBI RefSeq: NM_175362; MGI:1916978

Phenotypic Description

Figure 1. Unmodulated2 mice exhibit a reduced B to T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Unmodulated2 mice exhibit a decreased B1a cells in B1 cells frequency. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Unmodulated2 mice exhibit an increased B1b cells in B1 cells frequency. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Unmodulated2 mice exhibit a decreased frequency of IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM+ B cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Unmodulated2 mice exhibit an increased frequency of T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Unmodulated2 mice exhibit an increased frequency of CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD4+ T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Unmodulated2 mice exhibit an increased frequency of CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8+ T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Unmodulated2 mice exhibit a reduced frequency of effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8 T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Unmodulated2 mice exhibit an increased frequency of NK T cells. Flow cytometric analysis of peripheral blood was utilized to determine NK T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Unmodulated2 mice exhibit reduced expression of B220 on B cells. Flow cytometric analysis of peripheral blood was utilized to B220 mean fluorescence intensity. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Unmodulated2 mice exhibit increased expression of IgM on B cells. Flow cytometric analysis of peripheral blood was utilized to IgM mean fluorescence intensity. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Homozygous unmodulated2 mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Homozygous unmodulated2 mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 14. Unmodulated2 mice exhibit diminished T-dependent IgM responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgM levels were determined by ELISA. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The unmodulated2 phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R4778, some of which showed a decrease in the B to T cell ratio (Figure 1) caused by a decreased frequency of B1a cells in B1 cells (Figure 2), an increased frequency of B1b cells in B1 cells (Figure 3), and a decreased frequency of IgM+ B cells (Figure 4) coupled with an increased frequency of total T cells (Figure 5) of CD4+ T (Figure 6), an increased frequency of CD8+ T cells (Figure 7), a reduced frequency of effector memory CD8 T cells in CD8 T cells (Figure 8), all in the peripheral blood. Some mice showed an increased frequency of NK T cells in the peripheral blood (Figure 9). Some mice showed a reduced expression of B220 on B cells (Figure 10) and an increased expression of IgM on B cells (Figure 11), both in the peripheral blood. The T-dependent antibody responses to ovalbumin administered with aluminum hydroxide (Figure 12) and to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 13) was also diminished. The T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) was also reduced (Figure 14). 

Nature of Mutation

Figure 15. Linkage mapping of the reduced T-independent B cell response to NP-Ficoll using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 50 mutations (X-axis) identified in the G1 male of pedigree R4778. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 50 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Card11:  a C to A transversion at base pair 140,883,782 (v38) on chromosome 5, or base pair 116,815 in the GenBank genomic region NC_000071 encoding Card11 within intron 17. The strongest association was found with an additive model of linkage to the T-independent B cell response to NP-Ficoll, wherein six variant homozygous and 34 heterozygous mice departed phenotypically from 21 homozygous reference mice with a P value of 1.203 x 10^-21 (Figure 15).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in the use of a cryptic site in intron 17. Use of a cryptic site in intron 17 would result in a 10-base pair insertion in intron 17, leading to a frame-shifted protein product beginning after amino acid 756 of the protein, which is normally 1,154 amino acids in length, and terminating after the inclusion of 44 aberrant amino acids.

C57BL/6J:           <--exon 17      <--intron 17 exon 18-->        <--exon 25 115107 ……GTCAACCATGAAG ……ttacggtctcctcag GATACCGGAAG……GAGGACCAGCTGTGA 127258 753    ……-V--N--H--E--                   G--Y--R--K-……-E--D--Q--L--*- 1154   correct unmodulated2:             <--exon 17 <--intron 17         <--exon 18-->           115107 ……GTCAACCATGAAG ……ttacggtctcctcag GATACCGGAAGCT……GTCCCTCAAGTGTGA…… 116936 753    ……-V--N--H--E--        G--L--L--R --I--P--E--A-……-V--P--Q--V--*-   801            correct                           aberrant

The mutated nucleotide is indicated in red and the donor splice site of intron 17 is indicated in blue lettering. 

Protein Prediction

Figure 16. Domain structure of CARMA1. The unmodulated2 occurs within intron 17 of the protein. Four predicted α-helices are represented in pink. This image is interactive. Other mutations found in CARMA1 are noted in red. Click on each mututation for more specific information.

Card11 encodes CARMA1. CARMA1 contains no catalytic domains, but several protein interaction domains [Figure 16; reviewed in (1)]. The N-terminal half of CARMA1 contains a caspase recruitment domain (CARD) (residues 19-105) and a coiled-coil domain (residues 116-439). A membrane-associated guanylate kinase (MAGUK) domain occupies the bulk of the C-terminal half of CARMA1 (2;3). MAGUK family proteins contain 3 modular protein interaction domains, of which the hallmark is an approximately 300 amino acid region with homology to yeast guanylate kinase (GUK), but which is catalytically inactive. In addition, up to three PDZ domains and an SH3 domain are always present in tandem with the guanylate kinase domain. CARMA1 contains one PDZ (residues 660-742), one SH3 (residues 766-834) and one GUK domain (residues 954-1142) (4;5). The N- and C-terminal halves of CARMA1 are connected by a region of 232 amino acids between the CARD and coiled-coil domains designated the linker domain (residues 440-671). A NORS (no regular secondary structure) subdomain is found at the N-terminus of the linker domain (residues 44-519). The unmodulated2 mutation is predicted to result in the use of a cryptic site in intron 17, which would result in a 10-base pair insertion in intron 17, a frame-shifted protein product beginning after amino acid 756 of the protein, and coding of a premature stop codon after the inclusion of 44 aberrant amino acids (at amino acid 801). The aberrant amino acids are in the region between the PDZ and SH3 domains and in the SH3 domain. Expression, dimerization, localization, and function of CARMA1^unmodulated2 have not been examined.

Please see the record for king for more information about Card11.

Putative Mechanism

CARMA1 belongs to the membrane-associated guanylate kinase (MAGUK) protein family, whose members function as molecular scaffolds for the localized assembly of such multiprotein complexes [reviewed in (6)]. Upon T cell activation by TCR and costimulatory molecule engagement, CARMA1 associates with a complex containing Bcl10 and MALT1 (Mucosa-Associated Lymphoid tissue lymphoma Translocation-associated gene 1; also known as MLT or Paracaspase) and recruits these proteins to lipid rafts of the immunological synapse, where they activate the IKK complex, leading to degradation of IκB and subsequent activation of NF-κB (7;8). The CARMA1/Bcl10/MALT1 complex functions similarly in B cells to activate NF-κB in response to BCR engagement (9). NF-κB controls the proliferation, differentiation and survival of B and T cells by activating the transcription of target genes, including various cytokines.

CARMA1 mutants have normal numbers and differentiation of B cells in the bone marrow, but IgD^highIgM^low splenocytes and serum immunoglobulins (IgM, IgG1, IgG2a, IgG2b, IgG3, and IgA) are reduced in CARMA1 mutants. Peritoneal CD5⁺ B1 B cells are absent, and NK cells are reduced in number in CARMA1 mutant mice. CARMA1 mutant B cells fail to proliferate in response to BCR stimulation with anti-IgM, or upon CD40 stimulation. T cell development is largely normal in CARMA1 mutants, which have normal numbers of single- and double-positive thymocytes. However, within the double negative (CD4^-CD8^-) compartment, the proportion of DN3 cells (CD25⁺CD44^lo) is reduced, while that of DN4 cells (CD25^-CD44^lo) is increased.

Activating mutations in CARD11 (e.g., Gly123Asp, Glu127Gly, and Gly116Ser) have been linked to a disorder in humans associated with persisten polyclonal B cell lymphocytosis [PPBL; OMIM: #606445; (10;11). PPBL is also often referred to as B cell expansion with NF-κB and T-cell anergy (BENTA). PPBL onset occurs in infancy with patients exhibiting splenomegaly and polyclonal expansion of B cells, subsequently leading to peripheral lymphocytosis (11). PPBL patients may also exhibit mild immune dysfunction (e.g., defective antibody responses and T cell anergy) as well as the development of B cell malignancy (11). Patients with B cell lymphocytosis exhibit high expression of cell cycle progression genes as well as increased proliferation and improved B cell survival after BCR stimulation (10).

Primers

PCR Primer
unmodulated2_pcr_F: CTGTCCTGGTACATGGTGTC
unmodulated2_pcr_R: TGCATATAGCCTACTGCATGTTAAG

Sequencing Primer
unmodulated2_seq_F: TACATGGTGTCTAGGACATGCACC
unmodulated2_seq_R: CTGCATGTTAAGTACCACTTGGCAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 402 nucleotides is amplified (chromosome 5, - strand):

1   tgcatatagc ctactgcatg ttaagtacca cttggcagaa aaggcatggg gaccacaata
61  tagatgctag taagttagac attgtggctc agcacagatg ttagccctaa gctttcttgg
121 aagctgaagt gaaagagaga acccctagct ggcatggctg cccactcaca aggaggaaga
181 caggcactca gacgcggtat ctccagggtg cttacatttc tggattacgg tctcctcagg
241 ataccggaag ctgctgaagg agatggagga tggtctgatc acatcagggg actcgttcta
301 tatccgcctg aacctgaaca tctccagcca gctggatgcc tgctccatgt ccctcaagtg
361 tgacgacgtg gtgcatgtcc tagacaccat gtaccaggac ag

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Thome, M. (2004) CARMA1, BCL-10 and MALT1 in Lymphocyte Development and Activation. Nat Rev Immunol. 4, 348-359.

  2. Bertin, J., Wang, L., Guo, Y., Jacobson, M. D., Poyet, J. L., Srinivasula, S. M., Merriam, S., DiStefano, P. S., and Alnemri, E. S. (2001) CARD11 and CARD14 are Novel Caspase Recruitment Domain (CARD)/membrane-Associated Guanylate Kinase (MAGUK) Family Members that Interact with BCL10 and Activate NF-Kappa B. J Biol Chem. 276, 11877-11882.

  3. Gaide, O., Martinon, F., Micheau, O., Bonnet, D., Thome, M., and Tschopp, J. (2001) Carma1, a CARD-Containing Binding Partner of Bcl10, Induces Bcl10 Phosphorylation and NF-kappaB Activation. FEBS Lett. 496, 121-127.

  4. Tanner, M. J., Hanel, W., Gaffen, S. L., and Lin, X. (2007) CARMA1 Coiled-Coil Domain is Involved in the Oligomerization and Subcellular Localization of CARMA1 and is Required for T Cell Receptor-Induced NF-kappaB Activation. J Biol Chem. 282, 17141-17147.

  5. Funke, L., Dakoji, S., and Bredt, D. S. (2005) Membrane-Associated Guanylate Kinases Regulate Adhesion and Plasticity at Cell Junctions. Annu Rev Biochem. 74, 219-245.

  6. Egawa, T., Albrecht, B., Favier, B., Sunshine, M. J., Mirchandani, K., O'Brien, W., Thome, M., and Littman, D. R. (2003) Requirement for CARMA1 in Antigen Receptor-Induced NF-Kappa B Activation and Lymphocyte Proliferation. Curr Biol. 13, 1252-1258.

  7. Che, T., You, Y., Wang, D., Tanner, M. J., Dixit, V. M., and Lin, X. (2004) MALT1/paracaspase is a Signaling Component Downstream of CARMA1 and Mediates T Cell Receptor-Induced NF-kappaB Activation. J Biol Chem. 279, 15870-15876.

  8. Wang, D., You, Y., Case, S. M., McAllister-Lucas, L. M., Wang, L., DiStefano, P. S., Nunez, G., Bertin, J., and Lin, X. (2002) A Requirement for CARMA1 in TCR-Induced NF-Kappa B Activation. Nat Immunol. 3, 830-835.

  9. Sommer, K., Guo, B., Pomerantz, J. L., Bandaranayake, A. D., Moreno-Garcia, M. E., Ovechkina, Y. L., and Rawlings, D. J. (2005) Phosphorylation of the CARMA1 Linker Controls NF-kappaB Activation. Immunity. 23, 561-574.

  10. Brohl, A. S., Stinson, J. R., Su, H. C., Badgett, T., Jennings, C. D., Sukumar, G., Sindiri, S., Wang, W., Kardava, L., Moir, S., Dalgard, C. L., Moscow, J. A., Khan, J., and Snow, A. L. (2014) Germline CARD11 Mutation in a Patient with Severe Congenital B Cell Lymphocytosis. J Clin Immunol. .

  11. Snow, A. L., Xiao, W., Stinson, J. R., Lu, W., Chaigne-Delalande, B., Zheng, L., Pittaluga, S., Matthews, H. F., Schmitz, R., Jhavar, S., Kuchen, S., Kardava, L., Wang, W., Lamborn, I. T., Jing, H., Raffeld, M., Moir, S., Fleisher, T. A., Staudt, L. M., Su, H. C., and Lenardo, M. J. (2012) Congenital B Cell Lymphocytosis Explained by Novel Germline CARD11 Mutations. J Exp Med. 209, 2247-2261.