Phenotypic Mutation 'clip' (pdf version)
Allele | clip |
Mutation Type |
nonsense
|
Chromosome | 3 |
Coordinate | 95,452,695 bp (GRCm39) |
Base Change | C ⇒ T (forward strand) |
Gene |
Ctss
|
Gene Name | cathepsin S |
Synonym(s) | Cat S |
Chromosomal Location |
95,434,097-95,463,714 bp (+) (GRCm39)
|
MGI Phenotype |
FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, which encode preproproteins that are proteolytically processed to generate mature protein products. This enzyme is secreted by antigen-presenting cells during inflammation and may induce pain and itch via activation of G-protein coupled receptors. Homozygous knockout mice for this gene exhibit impaired wound healing, reduced tumorigenesis in a pancreatic cancer model, and reduced pathogenesis in a myasthenia gravis model. [provided by RefSeq, Aug 2015] PHENOTYPE: Homozygous null mice are resistant to the development of experimental autoimmune myasthenia gravis and showed reduced T and B cell responses to acetylcholine receptor. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_001267695 (variant 1), NM_021281 (variant 2); MGI:107341
|
Mapped | Yes |
Limits of the Critical Region |
95526786 - 95556400 bp |
Amino Acid Change |
Glutamine changed to Stop codon
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000015667]
[ENSMUSP00000112006]
|
AlphaFold |
O70370 |
SMART Domains |
Protein: ENSMUSP00000015667 Gene: ENSMUSG00000038642 AA Change: Q160*
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
25 |
N/A |
INTRINSIC |
Inhibitor_I29
|
39 |
99 |
2.3e-27 |
SMART |
Pept_C1
|
126 |
342 |
2.3e-122 |
SMART |
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000112006 Gene: ENSMUSG00000038642 AA Change: Q159*
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
20 |
N/A |
INTRINSIC |
Inhibitor_I29
|
36 |
96 |
3.01e-23 |
SMART |
Pept_C1
|
123 |
339 |
6.79e-120 |
SMART |
|
Predicted Effect |
probably null
|
Meta Mutation Damage Score |
0.9755 |
Is this an essential gene? |
Probably nonessential (E-score: 0.138) |
Phenotypic Category |
Autosomal Recessive |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All Mutations and Alleles(15) : Chemically induced (other)(1) Gene trapped(7) Radiation induced(1) Targeted(5) Transgenic(1)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL01140:Ctss
|
APN |
3 |
95446036 |
missense |
probably damaging |
1.00 |
IGL02162:Ctss
|
APN |
3 |
95454132 |
missense |
probably benign |
0.26 |
IGL03026:Ctss
|
APN |
3 |
95446141 |
missense |
probably benign |
0.01 |
IGL03219:Ctss
|
APN |
3 |
95450411 |
missense |
possibly damaging |
0.88 |
R0025:Ctss
|
UTSW |
3 |
95457448 |
missense |
probably damaging |
1.00 |
R0025:Ctss
|
UTSW |
3 |
95457448 |
missense |
probably damaging |
1.00 |
R0033:Ctss
|
UTSW |
3 |
95452888 |
splice site |
probably benign |
|
R0033:Ctss
|
UTSW |
3 |
95452888 |
splice site |
probably benign |
|
R1844:Ctss
|
UTSW |
3 |
95454105 |
critical splice acceptor site |
probably null |
|
R2866:Ctss
|
UTSW |
3 |
95452717 |
missense |
probably benign |
0.04 |
R4061:Ctss
|
UTSW |
3 |
95450345 |
missense |
probably benign |
0.34 |
R4846:Ctss
|
UTSW |
3 |
95452695 |
nonsense |
probably null |
|
R5917:Ctss
|
UTSW |
3 |
95450424 |
missense |
probably benign |
0.00 |
R6443:Ctss
|
UTSW |
3 |
95454114 |
missense |
probably benign |
0.00 |
R6555:Ctss
|
UTSW |
3 |
95450340 |
nonsense |
probably null |
|
R7391:Ctss
|
UTSW |
3 |
95436852 |
missense |
probably benign |
|
R8007:Ctss
|
UTSW |
3 |
95457465 |
missense |
probably null |
1.00 |
R9088:Ctss
|
UTSW |
3 |
95436867 |
missense |
possibly damaging |
0.48 |
R9356:Ctss
|
UTSW |
3 |
95454120 |
missense |
possibly damaging |
0.88 |
R9398:Ctss
|
UTSW |
3 |
95454258 |
missense |
possibly damaging |
0.82 |
R9522:Ctss
|
UTSW |
3 |
95454109 |
missense |
probably benign |
0.01 |
|
Mode of Inheritance |
Autosomal Recessive |
Local Stock | |
Repository | |
Last Updated |
2019-09-04 9:42 PM
by Anne Murray
|
Record Created |
2016-10-19 7:58 PM
by Jin Huk Choi
|
Record Posted |
2018-10-16 |
Phenotypic Description |
The clip phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4846, some of which showed a diminished T-dependent antibody response to ovalbumin administered with aluminum hydroxide (Figure 1).
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 56 mutations. The diminished T-dependent antibody response to OVA/alum phenotype was linked by continuous variable mapping to a mutation in Ctss: a C to T transition at base pair 95,545,384 (v38) on chromosome 3, or base pair 18,599 in the GenBank genomic region NC_000069 encoding Ctss. Linkage was found with a recessive model of inheritance, wherein seven variant homozygotes departed phenotypically from 12 homozygous reference mice and 13 heterozygous mice with a P value of 9.431 x 10-7 (Figure 2). The mutation corresponds to residue 592 in the mRNA sequence NM_001267695 within exon 5 of 8 total exons and to residue 589 in the mRNA sequence NM_021281 within exon 5 of 8 total exons.
18584 GGGGCCCTTGAAGGGCAGCTGAAGCTGAAAACG
155 -G--A--L--E--G--Q--L--K--L--K--T- NP_001254624
154 -G--A--L--E--G--Q--L--K--L--K--T- NP_067256
|
Genomic numbering corresponds to NC_000069. The mutated nucleotide is indicated in red. The mutation results in substitution of glutamine 160 to a premature stop codon (Q160*) in variant 1 and Q159* in variant 2 of the CTSS protein.
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
Ctss encodes cathepsin S, one of 11 cysteine protease cathepsins (i.e., cathepsins B, C, F, H, K, L, O, S, V, W, and X). The cysteine cathepsins are members of the papain family. Cathepsin S contains a signal domain, a pro-peptide domain, and a mature domain (Figure 3). Cathepsin S is synthesized as an inactive zymogen in the endoplasmic reticulum. Cathepsin S requires proteolytic cleavage of the N-terminal propeptide for its activity. Mature cathepsin S has a similar structure to other cathepsins (e.g., cathepsins K, L, H, and papain) (1). It is a monomer with two globular domains, and a third smaller “P” domain formed by the N-terminal part of the pro-peptide [Figure 4; PDB:2C0Yl; (2) and PDB:1GLO; (1)]. The P domain is anchored to the prosegment binding loop. The “left” globular domain is comprised of three α-helices and a hydrophobic core, while the “right” globular domain is an antiparallel β-sheet barrel enclosing a hydrophobic core with two α-helices flanking either side of the barrel (2). The interface between the globular domains provides the structure for the active-site cleft; catalytic His164-stabilizing Asn184-catalytic Cys25 comprise the catalytic triad (1). The clip mutation results in substitution of glutamine 160 to a premature stop codon (Q160*) in cathepsin S; Gln160 is within the mature cathepsin S protein.
|
Expression/Localization | CTSS is highly expressed in the spleen, heart, and lung (3). Cathepsin S is predominantly expressed in antigen presenting cells (APCs) namely B cells, macrophages, and dendritic cells. Cathepsin S is also expressed in microglia and ‘non-professional’ APCs such as epithelial cells (4-6). Cathepsin S is localized in the endosome of hematopoietic cells. Cathepsin S expression is upregulated in an antigen-induced arthritis mouse model (7) as well as in obesity (8).
|
Background |
Formation of major histocompatibility complex (MHC) class II peptide complexes begins with the synthesis of class II αβ heterodimers in the endoplasmic reticulum (Figure 5). The dimers are assembled with the assistance of the invariant chain (Ii or CD74) chaperone, subsequently forming the αβ-Ii complex. The αβ-Ii complex is delivered to endosomes, where Ii is degraded by cathepsins, permitting accessibility of the MHC II antigen-binding site. Cathepsin S is the major endoprotease that cleaves Ii from the MHC class II-Ii complex before antigen presentation in macrophages and dendritic cells; cathepsin L and cathepsin F can partially compensate for loss of cathepsin S deficiency in macrophages (9;10). Cathepsin S-mediated cleavage of Ii causes formation of 24-amino acid CLIP (class II associated invariant chain peptide) fragments. HLA-DM in humans and H-2M in mice catalyze the replacement of the MHC II-bound CLIP peptide with an extracellularly derived antigenic peptide. Inability to degrade CD74 causes accumulation of a class II-associated, 10-kD Ii fragment within endosomes, which disrupts class II trafficking, peptide complex formation, and class II-restricted antigen presentation (11). Cathepsin S also putatively functions in the cross presentation of MHC I molecules to CD8+ T cells (12). Cathepsin S also promotes epitope generation for a subset of antigens during antigen processing in antigen-presenting cell lines (13). Cathepsin S has several substrates in addition to its function in MHC class II processing (Table 1). Table 1. Select cathepsin S substrates
Target
|
Description of target
|
Cathepsin S-induced effect
|
References
|
Ii (alternatively, CD74)
|
MHC class II chaperone
|
Removes Ii from MHC II to promote MHC II maturation and peptide loading
|
(11;13-16)
|
Leptin
|
Adipocyte-secreted hormone that regulates appetite, energy homoeostasis, body weight, neuroendocrine systems, and immune functions; see the record for potbelly
|
Inactivates leptin in white adipose tissue
|
(17)
|
MBP
|
An autoantigen in multiple sclerosis
|
Cathepsin degrades MBP
|
(18)
|
Rip1
|
Receptor involved in necroptosis
|
Limits macrophage necroptosis
|
(19)
|
PAR-2
|
G-protein coupled receptor expressed in keratinocytes and nociceptive neurons
|
Pain signaling through activation of transient receptor potential vanilloid 4 (TRPV4)
|
(20;21)
|
E-cadherin
|
Cell adhesion protein
|
Promotes tumor formation and angiogenesis
|
(22)
|
SLPI
|
Inhibitor of neutrophil elastase (see the record for Ruo)
|
SLPI inactivation
|
(23)
|
JAM-B
|
Component of tight and adherens junctions
|
Cathepsin S-derived blood brain barrier metastases
|
(24)
|
Collagen/elastin
|
Structural elements of the extracellular matrix and the basement membrane
|
Extracellular matrix remodeling in differentiation, wound healing, angiogenesis, metastasis, and conditions associated with inflammation
|
(25-29)
|
Laminin
|
Proteoglycans
|
Fibronectin
|
During adipogenesis, cathepsin S induces fibronectin degradation during the early steps of differentiation
|
(30)
|
bFGF
|
Matrix-derived angiogenic factors
|
Promotes angiogenesis and neoplastic progression
|
(25)
|
IGF
|
IL-36γ
|
Proinflammatory cytokine highly expressed in epithelial cells that is associated with psoriasis
|
Cathepsin S-induced cleavage activates IL-36γ
|
(31)
|
EGFR
|
Receptor tyrosine kinase (see the record for Velvet)
|
Cathepsin S regulates EGFR signaling by facilitating EGF-mediated EGFR degradation
|
(32)
|
MrgprC11
|
Receptor that binds select pruritogens in the periphery to mediate non-histaminergic itch
|
Cathepsin S-induced cleavage of MrgprC11 in nociceptive fibers evokes itch sensation in a ligand-independent manner
|
(33)
|
Endostatin
|
Anti-angiogenic protein
|
Releases a peptide from endostatin with increased angiostatic properties
|
(34)
|
Abbreviations: Ii, invariant chain; MBP, myelin basic protein; Rip1, receptor interacting protein kinase-1; PAR-2, protease-activated receptor-2; SLPI, secretory leukoprotease inhibitor; JAM-B, junctional adhesion molecule-B; bFGF, basic fibroblast growth factor; IGF, insulin growth factor; IL-36γ, interleukin 36-gamma; EGFR, epidermal growth factor receptor; MrgprC11, Mas-related G protein coupled receptor C11 Cathepsin S can be secreted from macrophages, smooth muscle cells, tumor cells, and endothelial cells [reviewed in (35)]. Secreted cathepsin S can remodel the extracellular matrix in several tissues through degradation of select extracellular matix proteins (Table 1). Cathepsin S can also degrade collagen fragments that are phagocytosed by fibroblasts, macrophages and smooth muscle cells. Extracellular degradation of collagen can be incomplete, leaving fragments that are phagocytosed. The phagosomes fuse with lysosomes containing cathepsins and complete the degradation. Cathepsin S has putative functions in the development of several autoimmune and allergic conditions in humans, including multiple sclerosis, rheumatoid arthritis, and asthma. In addition, cathepsin S-mediated degradation of components of the extracellular matrix putatively promotes the initiation and progression of several diseases, including arthritis, atherosclerosis, and chronic obstructive pulmonary disease. Cathepsin S initiates the proteolytic processing of myelin basic protein, a putative autoantigen that contributes to the pathogenesis of multiple sclerosis (18). Cathepsin S secreted from tumors as well as tumor-associated macrophages and endothelial cells promotes cancer growth and neovascularization (36). Reduced cathepsin S expression resulted in aberrant tumor vascularization, reduced proliferation, and increased apoptosis. Ctss-deficient (Ctss-/-) mice exhibited abnormal B lymphocyte antigen presentation, resistance to collagen-induced arthritis, salivary gland inflammation, and reduced susceptibility to autoimmune diabetes (9;37). Ctss-/- mice showed reduced blood glucose levels compared to wild-type mice after both normal chow and high-fat diets (38). Ctss-/- mouse also showed reduced T cell proliferative responses and B cell responses to acetylcholine receptor as well as reduced susceptibility to experimental autoimmune myasthenia gravis and reduced angiogenesis during wound healing (39;40). Ctss-/- mice had normal numbers of B and T cells as well as normal IgE responses, but showed impaired antibody class switching to IgG2a and IgG3 (16). Ctss-/- mice showed reduced social interaction and novelty recognition compared to wild-type mice (41). The Ctss-/- mice showed reduced dendritic spine density of the cortical neurons. The phenotypes were attributed to reduced cathepsin S-associated proteolysis of perisynaptic extracellular matrix proteins. Ctss-/- mice showed comparable body weights to wild-type mice, but reduced amounts of subscapular and gonadal fat pads, impaired adipocyte formation, lower trabecular bone mineral density, and lower cortical bone mass due to a change in the balance between adipocyte and osteoblast differentiation, increased bone turnover, and changed bone microarchitecture (42). Ctss-/- mice showed increased cardiac fibrosis, macrophage infiltration, and expression of inflammatory cytokines as well as aberrant accumulation of autophagosomes and reduced clearance of damaged mitochondria after angiotensin II-induced cardiac fibrosis compared to wild-type mice (43). Ctss-/- mice showed reduced numbers of microglia on the axotomized side after facial nerve axotomy; the Ctss-/- microglia abutted on injured motoneurons, but did not adhere to the injured neurons (6).
|
Primers |
PCR Primer
clip_pcr_F: ATGTTCAATGTGCACCATCCC
clip_pcr_R: TAGGGATAGGAAGCGTCTGC
Sequencing Primer
clip_seq_F: GAGAAATGTCTGCCTTCCAATGGTC
clip_seq_R: ATAGGAAGCGTCTGCCTCTATGC
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 400 nucleotides is amplified (chromosome 3, + strand):
1 atgttcaatg tgcaccatcc ccaccagggc acatcctcgc ctggagaaat gtctgccttc 61 caatggtctg agagagaagg agccctcagt ggggcaggca gctcttcctg gcagagctgg 121 agttgtcttc tgccctgcgg aagccatact gatcccggac ggattcttct ctgttttagg 181 gttcttgtgg tgcctgctgg gctttcagtg ctgtgggggc ccttgaaggg cagctgaagc 241 tgaaaacggg gaagctgata tccctcagtg ctcagaacct ggtggactgc tcaaatgaag 301 aaaagtatgg gaataaaggc tgtggaggcg gctacatgac cgaagctttc cagtacatca 361 ttgataatgg gggcatagag gcagacgctt cctatcccta
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References | 1. Turkenburg, J. P., Lamers, M. B., Brzozowski, A. M., Wright, L. M., Hubbard, R. E., Sturt, S. L., and Williams, D. H. (2002) Structure of a Cys25-->Ser Mutant of Human Cathepsin S. Acta Crystallogr D Biol Crystallogr. 58, 451-455.
2. Kaulmann, G., Palm, G. J., Schilling, K., Hilgenfeld, R., and Wiederanders, B. (2006) The Crystal Structure of a Cys25 -> Ala Mutant of Human Procathepsin S Elucidates Enzyme-Prosequence Interactions. Protein Sci. 15, 2619-2629.
3. Shi, G. P., Webb, A. C., Foster, K. E., Knoll, J. H., Lemere, C. A., Munger, J. S., and Chapman, H. A. (1994) Human Cathepsin S: Chromosomal Localization, Gene Structure, and Tissue Distribution. J Biol Chem. 269, 11530-11536.
4. Bania, J., Gatti, E., Lelouard, H., David, A., Cappello, F., Weber, E., Camosseto, V., and Pierre, P. (2003) Human Cathepsin S, but Not Cathepsin L, Degrades Efficiently MHC Class II-Associated Invariant Chain in Nonprofessional APCs. Proc Natl Acad Sci U S A. 100, 6664-6669.
7. Schurigt, U., Stopfel, N., Huckel, M., Pfirschke, C., Wiederanders, B., and Brauer, R. (2005) Local Expression of Matrix Metalloproteinases, Cathepsins, and their Inhibitors during the Development of Murine Antigen-Induced Arthritis. Arthritis Res Ther. 7, R174-88.
8. Taleb, S., Lacasa, D., Bastard, J. P., Poitou, C., Cancello, R., Pelloux, V., Viguerie, N., Benis, A., Zucker, J. D., Bouillot, J. L., Coussieu, C., Basdevant, A., Langin, D., and Clement, K. (2005) Cathepsin S, a Novel Biomarker of Adiposity: Relevance to Atherogenesis. FASEB J. 19, 1540-1542.
9. Nakagawa, T. Y., Brissette, W. H., Lira, P. D., Griffiths, R. J., Petrushova, N., Stock, J., McNeish, J. D., Eastman, S. E., Howard, E. D., Clarke, S. R., Rosloniec, E. F., Elliott, E. A., and Rudensky, A. Y. (1999) Impaired Invariant Chain Degradation and Antigen Presentation and Diminished Collagen-Induced Arthritis in Cathepsin S Null Mice. Immunity. 10, 207-217.
10. Shi, G. P., Bryant, R. A., Riese, R., Verhelst, S., Driessen, C., Li, Z., Bromme, D., Ploegh, H. L., and Chapman, H. A. (2000) Role for Cathepsin F in Invariant Chain Processing and Major Histocompatibility Complex Class II Peptide Loading by Macrophages. J Exp Med. 191, 1177-1186.
11. Driessen, C., Bryant, R. A., Lennon-Dumenil, A. M., Villadangos, J. A., Bryant, P. W., Shi, G. P., Chapman, H. A., and Ploegh, H. L. (1999) Cathepsin S Controls the Trafficking and Maturation of MHC Class II Molecules in Dendritic Cells. J Cell Biol. 147, 775-790.
13. Hsieh, C. S., deRoos, P., Honey, K., Beers, C., and Rudensky, A. Y. (2002) A Role for Cathepsin L and Cathepsin S in Peptide Generation for MHC Class II Presentation. J Immunol. 168, 2618-2625.
14. Riese, R. J., Wolf, P. R., Bromme, D., Natkin, L. R., Villadangos, J. A., Ploegh, H. L., and Chapman, H. A. (1996) Essential Role for Cathepsin S in MHC Class II-Associated Invariant Chain Processing and Peptide Loading. Immunity. 4, 357-366.
15. Riese, R. J., Mitchell, R. N., Villadangos, J. A., Shi, G. P., Palmer, J. T., Karp, E. R., De Sanctis, G. T., Ploegh, H. L., and Chapman, H. A. (1998) Cathepsin S Activity Regulates Antigen Presentation and Immunity. J Clin Invest. 101, 2351-2363.
16. Shi, G. P., Villadangos, J. A., Dranoff, G., Small, C., Gu, L., Haley, K. J., Riese, R., Ploegh, H. L., and Chapman, H. A. (1999) Cathepsin S Required for Normal MHC Class II Peptide Loading and Germinal Center Development. Immunity. 10, 197-206.
17. Oliveira, M., Assis, D. M., Paschoalin, T., Miranda, A., Ribeiro, E. B., Juliano, M. A., Bromme, D., Christoffolete, M. A., Barros, N. M., and Carmona, A. K. (2012) Cysteine Cathepsin S Processes Leptin, Inactivating its Biological Activity. J Endocrinol. 214, 217-224.
18. Beck, H., Schwarz, G., Schroter, C. J., Deeg, M., Baier, D., Stevanovic, S., Weber, E., Driessen, C., and Kalbacher, H. (2001) Cathepsin S and an Asparagine-Specific Endoprotease Dominate the Proteolytic Processing of Human Myelin Basic Protein in Vitro. Eur J Immunol. 31, 3726-3736.
19. McComb, S., Shutinoski, B., Thurston, S., Cessford, E., Kumar, K., and Sad, S. (2014) Cathepsins Limit Macrophage Necroptosis through Cleavage of Rip1 Kinase. J Immunol. 192, 5671-5678.
20. Zhao, P., Lieu, T., Barlow, N., Metcalf, M., Veldhuis, N. A., Jensen, D. D., Kocan, M., Sostegni, S., Haerteis, S., Baraznenok, V., Henderson, I., Lindstrom, E., Guerrero-Alba, R., Valdez-Morales, E. E., Liedtke, W., McIntyre, P., Vanner, S. J., Korbmacher, C., and Bunnett, N. W. (2014) Cathepsin S Causes Inflammatory Pain Via Biased Agonism of PAR2 and TRPV4. J Biol Chem. 289, 27215-27234.
22. Gocheva, V., Zeng, W., Ke, D., Klimstra, D., Reinheckel, T., Peters, C., Hanahan, D., and Joyce, J. A. (2006) Distinct Roles for Cysteine Cathepsin Genes in Multistage Tumorigenesis. Genes Dev. 20, 543-556.
23. Taggart, C. C., Lowe, G. J., Greene, C. M., Mulgrew, A. T., O'Neill, S. J., Levine, R. L., and McElvaney, N. G. (2001) Cathepsin B, L, and S Cleave and Inactivate Secretory Leucoprotease Inhibitor. J Biol Chem. 276, 33345-33352.
24. Sevenich, L., Bowman, R. L., Mason, S. D., Quail, D. F., Rapaport, F., Elie, B. T., Brogi, E., Brastianos, P. K., Hahn, W. C., Holsinger, L. J., Massague, J., Leslie, C. S., and Joyce, J. A. (2014) Analysis of Tumour- and Stroma-Supplied Proteolytic Networks Reveals a Brain-Metastasis-Promoting Role for Cathepsin S. Nat Cell Biol. 16, 876-888.
25. Wang, B., Sun, J., Kitamoto, S., Yang, M., Grubb, A., Chapman, H. A., Kalluri, R., and Shi, G. P. (2006) Cathepsin S Controls Angiogenesis and Tumor Growth Via Matrix-Derived Angiogenic Factors. J Biol Chem. 281, 6020-6029.
27. Regmi, S. C., Samsom, M. L., Heynen, M. L., Jay, G. D., Sullivan, B. D., Srinivasan, S., Caffery, B., Jones, L., and Schmidt, T. A. (2017) Degradation of Proteoglycan 4/lubricin by Cathepsin S: Potential Mechanism for Diminished Ocular Surface Lubrication in Sjogren's Syndrome. Exp Eye Res. 161, 1-9.
31. Ainscough, J. S., Macleod, T., McGonagle, D., Brakefield, R., Baron, J. M., Alase, A., Wittmann, M., and Stacey, M. (2017) Cathepsin S is the Major Activator of the Psoriasis-Associated Proinflammatory Cytokine IL-36gamma. Proc Natl Acad Sci U S A. 114, E2748-E2757.
33. Reddy, V. B., Sun, S., Azimi, E., Elmariah, S. B., Dong, X., and Lerner, E. A. (2015) Redefining the Concept of Protease-Activated Receptors: Cathepsin S Evokes Itch Via Activation of Mrgprs. Nat Commun. 6, 7864.
34. Veillard, F., Saidi, A., Burden, R. E., Scott, C. J., Gillet, L., Lecaille, F., and Lalmanach, G. (2011) Cysteine Cathepsins S and L Modulate Anti-Angiogenic Activities of Human Endostatin. J Biol Chem. 286, 37158-37167.
36. Small, D. M., Burden, R. E., Jaworski, J., Hegarty, S. M., Spence, S., Burrows, J. F., McFarlane, C., Kissenpfennig, A., McCarthy, H. O., Johnston, J. A., Walker, B., and Scott, C. J. (2013) Cathepsin S from both Tumor and Tumor-Associated Cells Promote Cancer Growth and Neovascularization. Int J Cancer. 133, 2102-2112.
37. Hsing, L. C., Kirk, E. A., McMillen, T. S., Hsiao, S. H., Caldwell, M., Houston, B., Rudensky, A. Y., and LeBoeuf, R. C. (2010) Roles for Cathepsins S, L, and B in Insulitis and Diabetes in the NOD Mouse. J Autoimmun. 34, 96-104.
38. Lafarge, J. C., Pini, M., Pelloux, V., Orasanu, G., Hartmann, G., Venteclef, N., Sulpice, T., Shi, G. P., Clement, K., and Guerre-Millo, M. (2014) Cathepsin S Inhibition Lowers Blood Glucose Levels in Mice. Diabetologia. 57, 1674-1683.
39. Shi, G. P., Sukhova, G. K., Kuzuya, M., Ye, Q., Du, J., Zhang, Y., Pan, J. H., Lu, M. L., Cheng, X. W., Iguchi, A., Perrey, S., Lee, A. M., Chapman, H. A., and Libby, P. (2003) Deficiency of the Cysteine Protease Cathepsin S Impairs Microvessel Growth. Circ Res. 92, 493-500.
40. Yang, H., Kala, M., Scott, B. G., Goluszko, E., Chapman, H. A., and Christadoss, P. (2005) Cathepsin S is Required for Murine Autoimmune Myasthenia Gravis Pathogenesis. J Immunol. 174, 1729-1737.
41. Takayama, F., Zhang, X., Hayashi, Y., Wu, Z., and Nakanishi, H. (2017) Dysfunction in Diurnal Synaptic Responses and Social Behavior Abnormalities in Cathepsin S-Deficient Mice. Biochem Biophys Res Commun. 490, 447-452.
42. Rauner, M., Foger-Samwald, U., Kurz, M. F., Brunner-Kubath, C., Schamall, D., Kapfenberger, A., Varga, P., Kudlacek, S., Wutzl, A., Hoger, H., Zysset, P. K., Shi, G. P., Hofbauer, L. C., Sipos, W., and Pietschmann, P. (2014) Cathepsin S Controls Adipocytic and Osteoblastic Differentiation, Bone Turnover, and Bone Microarchitecture. Bone. 64, 281-287.
43. Pan, L., Li, Y., Jia, L., Qin, Y., Qi, G., Cheng, J., Qi, Y., Li, H., and Du, J. (2012) Cathepsin S Deficiency Results in Abnormal Accumulation of Autophagosomes in Macrophages and Enhances Ang II-Induced Cardiac Inflammation. PLoS One. 7, e35315.
|
Science Writers | Anne Murray |
Illustrators | Diantha La Vine |
Authors | Jin Huk Choi, James Butler, Beibei Fang, Bruce Beutler |