| Gene Symbol | Slc45a2 | |||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Name | solute carrier family 45, member 2 | |||||||||||||||||||||||||||||||||||
| Synonym(s) | Aim-1, Aim1, blanc-sale, bls, Dbr, dominant brown, Matp | |||||||||||||||||||||||||||||||||||
| Accession Number | ||||||||||||||||||||||||||||||||||||
| Allele | sweater | |||||||||||||||||||||||||||||||||||
| Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||
| Mapped | Yes | |||||||||||||||||||||||||||||||||||
| Chromosome | 15 | |||||||||||||||||||||||||||||||||||
| Chromosomal Location | 10.930-10.960 Mb (+) | |||||||||||||||||||||||||||||||||||
| Type of Mutation | MISSENSE | |||||||||||||||||||||||||||||||||||
| DNA Base Change (Sense Strand) |
A to C at 10942365 bp (NCBIm37) | |||||||||||||||||||||||||||||||||||
| Amino Acid Change | Histidine changed to Proline | |||||||||||||||||||||||||||||||||||
| Ref Sequences |
H233P in
NCBI: NP_444307.1
(fasta)
|
|||||||||||||||||||||||||||||||||||
| SMART Domains |
|
|||||||||||||||||||||||||||||||||||
| Predicted Effect | probably damaging
PolyPhen 2 Score 0.960 (Sensitivity: 0.77; Specificity: 0.95) |
|||||||||||||||||||||||||||||||||||
| Phenotypic Category | pigmentation, skin/coat/nails | |||||||||||||||||||||||||||||||||||
| Penetrance | 100% | |||||||||||||||||||||||||||||||||||
| Alleles Listed at MGI |
All alleles(11) : Targeted, other(1) Spontaneous(5) Chemically induced(5) | |||||||||||||||||||||||||||||||||||
| Lab Alleles | UTSW: cardigan, cheng, galak, grey goose, june gloom, nilla, yuki, zuckerkuss, R0148:Slc45a2, R0433:Slc45a2 | |||||||||||||||||||||||||||||||||||
| Mode of Inheritance | Autosomal Recessive | |||||||||||||||||||||||||||||||||||
| Local Stock | Sperm, gDNA | |||||||||||||||||||||||||||||||||||
| Repository |
none | |||||||||||||||||||||||||||||||||||
| Last Updated | 09/30/2011 2:34 PM by Diantha La Vine | |||||||||||||||||||||||||||||||||||
| Record Created | unknown | |||||||||||||||||||||||||||||||||||
| Record Posted | 04/15/2008 | |||||||||||||||||||||||||||||||||||
| Phenotypic Description |
The sweater mutation was induced by ENU mutagenesis on the C57BL/6J (black) background, and was discovered in G3 animals. Homozygous mutant mice exhibit a "dirty white" coat color associated with a light ocular albinism. Newborn mutants have very light-colored skin and eyes in comparison with their heterozygote littermates. Their eyes darken during development until only a light red glint remains in adults. Sweater mutants are viable and fertile. Sweater mutants bear a strong resemblance to galak, cardigan, and grey goose mutant animals.
|
|||||||||||||||||||||||||||||||||||
| Nature of Mutation |
The sweater mutation was mapped to Chromosome 15, and corresponds to an A to C transversion at position 794 of the Slc45a2 transcript, in exon 3 of 7 total exons.
778 TTGTGCTTCATCACACACCTGTGCAGTATCCCT
228 -L--C--F--I--T--H--L--C--S--I--P-
The mutated nucleotide is indicated in red lettering, and results in a histidine to proline change at amino acid 233 of the SLC45A2 (solute carrier family 45, member 2) or MATP (membrane associated transporter protein) protein.
| |||||||||||||||||||||||||||||||||||
| Protein Prediction |
Please see the record for cardigan for more information on Slc45a2.
| |||||||||||||||||||||||||||||||||||
| Putative Mechanism |
The sweater mutation results in an H233P change in the sixth transmembrane domain of SLC45A2. Histidine is a polar, basic amino acid. Changing to nonpolar proline could disrupt structure, especially as proline has a rigid structure and often disrupts secondary structure motifs. This amino acid is conserved between fish, mouse and human, suggesting it may be important for SLC45A2 function (1,2). Although a proline substitution in the tenth transmembrane region occurs in uwd mice which do not have a strong phenotype (1,3), sweater mutants have a light, cream-colored coat, suggesting that the substitution of proline for histidine in the sixth transmembrane domain significantly disrupts the structure and the function of SLC45A2. A human missense mutation in the sixth transmembrane domain of human SLC45A2 causes oculocutaneous albinism that presents with little pigment, similar to sweater mice (4).
| |||||||||||||||||||||||||||||||||||
| Genotyping |
Sweater genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. The same primers used for galak genotyping are used here.
Primers for PCR amplification
Galak(F): 5’- CAAGCATGTAGCTAGACCTTCCACAGAGATGAAG -3’
Galak(R): 5’- CAATGACATTGTCATCTGAAGGAACAAAGTTG -3’
PCR program
1) 95°C 2:00
2) 95°C 0:30
3) 56°C 0:30
4) 72°C 2:00
5) repeat steps (2-4) 40X
6) 72°C 700
7) 4°C ∞
Primers for sequencing
Galak_seq(F): 5’- GTGGGAAATAAACATGACTGACTGAATATG -3’
Galak_seq(R): 5’- TTCACAAAGAACAAAGTGACTTAGCAAG -3’
The following sequence of 1277 nucleotides (from Genbank genomic region NC_000081 for linear DNA sequence of Slc45a2) is amplified:
11154 caagcat
11161 gtagctagac cttccacaga gatgaagata gatgtcaagg ttcttagatc atcccaagct 11221 agtttgtatt ttctcaagaa gcttggtggt ggaggaggat aataaaatca tctcttttta 11281 ctgccactgg aaattgattt ttatggacta atttgggtca ataatttgag ttttttgctt 11341 gttgttacgt ttttgttgtc tttaagtagt atagaggata caggttggga aggtgacagt 11401 atctccaagg acggtatttt atttgctgtg cgttcactgc tgtattgaac atttttcatt 11461 tccataccat tgaccttctt ggtaggttac ttgtatgtta ttactccata aaagatacac 11521 aggactaagg tcacagcaaa taaatgccag agatgagtct tgaacccaca ctgtcttagc 11581 ctcttgctgt gttggcgctt catcactaca ggcagtctct gctttcctca gggagctttt 11641 ccacagaagg ggaaggtctg tgcatggtgg gaaataaaca tgactgactg aatatgctaa 11701 tgcatatctc tctctgtctc tctctctctc tctcccaccc cctttgcttt ctaggttttg 11761 gaggtgccct tggctacatt ttgggtgcca tagactgggt gcatctagat ctgggaaggc 11821 tgctgggcac agaattccag gtcatgttct tcttctctgc cctggttctc atcttgtgct 11881 tcatcacaca cctgtgcagt atccctgaag ctccactcag agatgctgca actgaccctc 11941 cctcacagca ggaccctcag ggctcgtcgc tgtcagccag tgggatgcat gaatacggtt 12001 ctattgagaa agttaaaaat ggaggtgcag acacagagca gccagtacag gaatggaaaa 12061 acaaaaagcc ttctggccag gtaaagatgc aaattctttt ttctttttct ccacatgggg 12121 gaagttttct tgctaagtca ctttgttctt tgtgaaattt gtcttgtttg cttgtctgat 12181 gtgaagtttt gtgaagtcta tttgaacctt taaaacctcc cttagtcatt ccctgttgga 12241 atgagaattt tgtgcctcag tggttctctt gcctcttact cctttcaaag catcaaactg 12301 gggaaggtga gacatctgta acagtgagac catgtgagaa ctctccagcc accttctggc 12361 cacaggacat agtcttttag ataaagaatt acaatctaca actttgttcc ttcagatgac 12421 aatgtcattg
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.
| |||||||||||||||||||||||||||||||||||
| References | ||||||||||||||||||||||||||||||||||||
| Science Writers | Nora G. Smart | |||||||||||||||||||||||||||||||||||
| Illustrators | Diantha La Vine | |||||||||||||||||||||||||||||||||||
| Authors | Amanda L. Blasius, Bruce Beutler |

The sweater mutation was mapped to Chromosome 15, and corresponds to an A to C transversion at position 794 of the Slc45a2 transcript, in exon 3 of 7 total exons.