Phenotypic Mutation 'sweater' (pdf version)
Gene Symbol Slc45a2
Gene Name solute carrier family 45, member 2
Synonym(s) Aim-1, Aim1, blanc-sale, bls, Dbr, dominant brown, Matp
Accession Number

NCBI RefSeq: NM_053077; MGI: 2153040

Allele sweater
Institutional SourceBeutler Lab
Mapped Yes 
Chromosome 15
Chromosomal Location 10.930-10.960 Mb (+)
Type of Mutation MISSENSE
DNA Base Change
(Sense Strand)
A to C at 10942365 bp (NCBIm37)
Amino Acid Change Histidine changed to Proline
Ref Sequences
H233P in NCBI: NP_444307.1 (fasta)
SMART Domains

DomainStartEndE-ValueType
Pfam:MFS_1 36 364 1.3e-9 PFAM
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.960 (Sensitivity: 0.77; Specificity: 0.95)
(Using NCBI: NP_444307.1)
Phenotypic Category pigmentation, skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(11) : Targeted, other(1) Spontaneous(5) Chemically induced(5)

Lab Alleles UTSW: cardigan, cheng, galak, grey goose, june gloom, nilla, yuki, zuckerkuss, R0148:Slc45a2, R0433:Slc45a2
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
Repository

none

Last Updated 09/30/2011 2:34 PM by Diantha La Vine
Record Created unknown
Record Posted 04/15/2008
Phenotypic Description
The sweater mutation was induced by ENU mutagenesis on the C57BL/6J (black) background, and was discovered in G3 animals.  Homozygous mutant mice exhibit a "dirty white" coat color associated with a light ocular albinism.  Newborn mutants have very light-colored skin and eyes in comparison with their heterozygote littermates.  Their eyes darken during development until only a light red glint remains in adults.  Sweater mutants are viable and fertile.  Sweater mutants bear a strong resemblance to galak, cardigan, and grey goose mutant animals.

 

Nature of Mutation
The sweater mutation was mapped to Chromosome 15, and corresponds to an A to C transversion at position 794 of the Slc45a2 transcript, in exon 3 of 7 total exons.
 
778 TTGTGCTTCATCACACACCTGTGCAGTATCCCT
228 -L--C--F--I--T--H--L--C--S--I--P-
 
The mutated nucleotide is indicated in red lettering, and results in a histidine to proline change at amino acid 233 of the SLC45A2 (solute carrier family 45, member 2) or MATP (membrane associated transporter protein) protein.
Protein Prediction
Figure 1. Protein topology and domain structure of SLC45A2. SLC45A2 is a 55kD protein with 12 membrane-spanning (TM) domains, an elongated N-terminus, and enlarged cytoplasmic loop between transmembrane domains six and seven. The sucrose-transporter signature sequence, R-W-G-R-R is noted. The sweater mutation (red asterisk) results in a histidine to proline change at amino acid 233 of the SLC45A2 protein. This image is interactive. Click on the image to view other mutations found in TMPRSS6. Click on the mutations for more specific information. 
The sweater mutation occurs in the sixth transmembrane domain of the SLC45A2 protein (Figure 1). It is unknown whether normal levels of the altered protein exist in sweater mice.
 
Please see the record for cardigan for more information on Slc45a2.
Putative Mechanism
The sweater mutation results in an H233P change in the sixth transmembrane domain of SLC45A2.  Histidine is a polar, basic amino acid.  Changing to nonpolar proline could disrupt structure, especially as proline has a rigid structure and often disrupts secondary structure motifs.  This amino acid is conserved between fish, mouse and human, suggesting it may be important for SLC45A2 function (1,2).  Although a proline substitution in the tenth transmembrane region occurs in uwd mice which do not have a strong phenotype (1,3), sweater mutants have a light, cream-colored coat, suggesting that the substitution of proline for histidine in the sixth transmembrane domain significantly disrupts the structure and the function of SLC45A2.  A human missense mutation in the sixth transmembrane domain of human SLC45A2 causes oculocutaneous albinism that presents with little pigment, similar to sweater mice (4)
Genotyping
Sweater genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. The same primers used for galak genotyping are used here.
 
Primers for PCR amplification
Galak(F): 5’- CAAGCATGTAGCTAGACCTTCCACAGAGATGAAG -3’
Galak(R): 5’- CAATGACATTGTCATCTGAAGGAACAAAGTTG -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             2:00
5) repeat steps (2-4) 40X
6) 72°C             700
7) 4°C               ∞
 
Primers for sequencing
Galak_seq(F): 5’- GTGGGAAATAAACATGACTGACTGAATATG -3’
Galak_seq(R): 5’- TTCACAAAGAACAAAGTGACTTAGCAAG -3’
 
The following sequence of 1277 nucleotides (from Genbank genomic region NC_000081 for linear DNA sequence of Slc45a2) is amplified:
 
11154                                                           caagcat
11161 gtagctagac cttccacaga gatgaagata gatgtcaagg ttcttagatc atcccaagct
11221 agtttgtatt ttctcaagaa gcttggtggt ggaggaggat aataaaatca tctcttttta
11281 ctgccactgg aaattgattt ttatggacta atttgggtca ataatttgag ttttttgctt
11341 gttgttacgt ttttgttgtc tttaagtagt atagaggata caggttggga aggtgacagt
11401 atctccaagg acggtatttt atttgctgtg cgttcactgc tgtattgaac atttttcatt
11461 tccataccat tgaccttctt ggtaggttac ttgtatgtta ttactccata aaagatacac
11521 aggactaagg tcacagcaaa taaatgccag agatgagtct tgaacccaca ctgtcttagc
11581 ctcttgctgt gttggcgctt catcactaca ggcagtctct gctttcctca gggagctttt
11641 ccacagaagg ggaaggtctg tgcatggtgg gaaataaaca tgactgactg aatatgctaa
11701 tgcatatctc tctctgtctc tctctctctc tctcccaccc cctttgcttt ctaggttttg
11761 gaggtgccct tggctacatt ttgggtgcca tagactgggt gcatctagat ctgggaaggc
11821 tgctgggcac agaattccag gtcatgttct tcttctctgc cctggttctc atcttgtgct
11881 tcatcacaca cctgtgcagt atccctgaag ctccactcag agatgctgca actgaccctc
11941 cctcacagca ggaccctcag ggctcgtcgc tgtcagccag tgggatgcat gaatacggtt
12001 ctattgagaa agttaaaaat ggaggtgcag acacagagca gccagtacag gaatggaaaa
12061 acaaaaagcc ttctggccag gtaaagatgc aaattctttt ttctttttct ccacatgggg
12121 gaagttttct tgctaagtca ctttgttctt tgtgaaattt gtcttgtttg cttgtctgat
12181 gtgaagtttt gtgaagtcta tttgaacctt taaaacctcc cttagtcatt ccctgttgga
12241 atgagaattt tgtgcctcag tggttctctt gcctcttact cctttcaaag catcaaactg
12301 gggaaggtga gacatctgta acagtgagac catgtgagaa ctctccagcc accttctggc
12361 cacaggacat agtcttttag ataaagaatt acaatctaca actttgttcc ttcagatgac
12421 aatgtcattg                                                            

 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.
 References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsAmanda L. Blasius, Bruce Beutler
Edit History
08/25/2011 11:59 AM (current)
01/07/2011 9:09 AM
07/07/2010 2:51 PM
07/07/2010 2:50 PM
02/03/2010 9:34 AM