Phenotypic Mutation 'sweater' (pdf version)
Allelesweater
Mutation Type missense
Chromosome15
Coordinate11,012,696 bp (GRCm39)
Base Change A ⇒ C (forward strand)
Gene Slc45a2
Gene Name solute carrier family 45, member 2
Synonym(s) Aim1, Dbr, blanc-sale, dominant brown, Aim-1, Matp, bls, Oca4
Chromosomal Location 11,000,807-11,029,319 bp (+) (GRCm39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and hair, especially the underfur. Eyes are very light at birth but darken with age. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_053077; MGI: 2153040

MappedYes 
Amino Acid Change Histidine changed to Proline
Institutional SourceBeutler Lab
Gene Model not available
AlphaFold P58355
SMART Domains Protein: ENSMUSP00000112408
Gene: ENSMUSG00000022243
AA Change: H233P

DomainStartEndE-ValueType
Pfam:MFS_2 1 457 2e-22 PFAM
Pfam:MFS_1 2 292 2.6e-12 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000117100)
Meta Mutation Damage Score Not available question?
Is this an essential gene? Probably nonessential (E-score: 0.073) question?
Phenotypic Category Autosomal Recessive
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance 100% 
Alleles Listed at MGI

All alleles(11) : Targeted, other(1) Spontaneous(5) Chemically induced(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Slc45a2 APN 15 11000903 start codon destroyed probably null 0.80
IGL02283:Slc45a2 APN 15 11001268 missense probably damaging 1.00
IGL02634:Slc45a2 APN 15 11023440 missense probably benign 0.21
IGL03039:Slc45a2 APN 15 11012773 missense probably benign
IGL03123:Slc45a2 APN 15 11012741 missense probably benign 0.01
IGL03226:Slc45a2 APN 15 11022278 missense probably damaging 1.00
cardigan UTSW 15 11022257 synonymous probably benign
cheng UTSW 15 11025954 missense probably damaging 0.99
Draco2 UTSW 15 11000903 start codon destroyed probably benign 0.05
galak UTSW 15 11012752 missense probably benign
goku UTSW 15 11000941 nonsense probably null
grey_goose UTSW 15 11003067 missense probably damaging 1.00
june_gloom UTSW 15 11023529 missense possibly damaging 0.94
nilla UTSW 15 splice donor site
Olaf UTSW 15 unclassified
voldemort UTSW 15 unclassified
yuki UTSW 15 11001178 missense probably damaging 1.00
zuckerkuss UTSW 15 11026020 critical splice donor site probably benign
R0148:Slc45a2 UTSW 15 11025954 missense probably damaging 0.99
R0433:Slc45a2 UTSW 15 11025831 missense probably benign 0.17
R0440:Slc45a2 UTSW 15 11000903 start codon destroyed probably benign 0.05
R0675:Slc45a2 UTSW 15 11025864 missense probably damaging 1.00
R1384:Slc45a2 UTSW 15 11025832 missense probably benign 0.04
R1616:Slc45a2 UTSW 15 11022214 missense probably null 0.01
R1824:Slc45a2 UTSW 15 11022172 missense probably damaging 0.99
R2244:Slc45a2 UTSW 15 11003087 missense probably benign 0.21
R3761:Slc45a2 UTSW 15 11012800 missense probably benign 0.07
R4631:Slc45a2 UTSW 15 11012662 missense probably benign 0.13
R4756:Slc45a2 UTSW 15 11028016 nonsense probably null
R4990:Slc45a2 UTSW 15 11001236 missense probably benign 0.00
R5066:Slc45a2 UTSW 15 11012693 missense probably benign 0.31
R5209:Slc45a2 UTSW 15 11027871 missense probably damaging 0.98
R5210:Slc45a2 UTSW 15 11027871 missense probably damaging 0.98
R5211:Slc45a2 UTSW 15 11027871 missense probably damaging 0.98
R5212:Slc45a2 UTSW 15 11027871 missense probably damaging 0.98
R5213:Slc45a2 UTSW 15 11027871 missense probably damaging 0.98
R5259:Slc45a2 UTSW 15 11027871 missense probably damaging 0.98
R5261:Slc45a2 UTSW 15 11027871 missense probably damaging 0.98
R5390:Slc45a2 UTSW 15 11027871 missense probably damaging 0.98
R5394:Slc45a2 UTSW 15 11027871 missense probably damaging 0.98
R5395:Slc45a2 UTSW 15 11027871 missense probably damaging 0.98
R5422:Slc45a2 UTSW 15 11027871 missense probably damaging 0.98
R5496:Slc45a2 UTSW 15 11027871 missense probably damaging 0.98
R5498:Slc45a2 UTSW 15 11027871 missense probably damaging 0.98
R5499:Slc45a2 UTSW 15 11027871 missense probably damaging 0.98
R5500:Slc45a2 UTSW 15 11027871 missense probably damaging 0.98
R5501:Slc45a2 UTSW 15 11027871 missense probably damaging 0.98
R5649:Slc45a2 UTSW 15 11012693 missense probably benign 0.00
R5662:Slc45a2 UTSW 15 11022169 missense probably benign 0.31
R5696:Slc45a2 UTSW 15 11001219 missense probably damaging 1.00
R5896:Slc45a2 UTSW 15 11000941 nonsense probably null
R6236:Slc45a2 UTSW 15 11022158 missense probably benign 0.00
R6709:Slc45a2 UTSW 15 11001216 missense possibly damaging 0.46
R7243:Slc45a2 UTSW 15 11023436 missense possibly damaging 0.94
R7839:Slc45a2 UTSW 15 11027835 missense probably benign
R8221:Slc45a2 UTSW 15 11001233 missense probably benign 0.02
R8404:Slc45a2 UTSW 15 11027958 missense possibly damaging 0.62
R8502:Slc45a2 UTSW 15 11027958 missense possibly damaging 0.62
R8680:Slc45a2 UTSW 15 11000972 missense probably benign 0.00
R8724:Slc45a2 UTSW 15 11012610 missense probably benign 0.00
R8966:Slc45a2 UTSW 15 11001122 missense probably damaging 1.00
R9431:Slc45a2 UTSW 15 11026005 missense possibly damaging 0.94
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
Repository

none

Last Updated 2018-08-01 4:35 PM by Diantha La Vine
Record Created unknown
Record Posted 2008-04-15
Phenotypic Description
The sweater mutation was induced by ENU mutagenesis on the C57BL/6J (black) background, and was discovered in G3 animals.  Homozygous mutant mice exhibit a "dirty white" coat color associated with a light ocular albinism.  Newborn mutants have very light-colored skin and eyes in comparison with their heterozygote littermates.  Their eyes darken during development until only a light red glint remains in adults.  Sweater mutants are viable and fertile.  Sweater mutants bear a strong resemblance to galak, cardigan, and grey goose mutant animals.
Nature of Mutation
The sweater mutation was mapped to Chromosome 15, and corresponds to an A to C transversion at position 794 of the Slc45a2 transcript, in exon 3 of 7 total exons.
 
778 TTGTGCTTCATCACACACCTGTGCAGTATCCCT
228 -L--C--F--I--T--H--L--C--S--I--P-
 
The mutated nucleotide is indicated in red lettering, and results in a histidine to proline change at amino acid 233 of the SLC45A2 (solute carrier family 45, member 2) or MATP (membrane associated transporter protein) protein.
Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 1. Protein topology and domain structure of SLC45A2. SLC45A2 is a 55kD protein with 12 membrane-spanning (TM) domains, an elongated N-terminus, and enlarged cytoplasmic loop between transmembrane domains six and seven. The sucrose-transporter signature sequence, R-W-G-R-R is noted. The sweater mutation (red asterisk) results in a histidine to proline change at amino acid 233 of the SLC45A2 protein. This image is interactive. Click on the mutations for more specific information. 
The sweater mutation occurs in the sixth transmembrane domain of the SLC45A2 protein (Figure 1). It is unknown whether normal levels of the altered protein exist in sweater mice.
 
Please see the record for cardigan for more information on Slc45a2.
Putative Mechanism
The sweater mutation results in an H233P change in the sixth transmembrane domain of SLC45A2.  Histidine is a polar, basic amino acid.  Changing to nonpolar proline could disrupt structure, especially as proline has a rigid structure and often disrupts secondary structure motifs.  This amino acid is conserved between fish, mouse and human, suggesting it may be important for SLC45A2 function (1,2).  Although a proline substitution in the tenth transmembrane region occurs in uwd mice which do not have a strong phenotype (1,3), sweater mutants have a light, cream-colored coat, suggesting that the substitution of proline for histidine in the sixth transmembrane domain significantly disrupts the structure and the function of SLC45A2.  A human missense mutation in the sixth transmembrane domain of human SLC45A2 causes oculocutaneous albinism that presents with little pigment, similar to sweater mice (4). 
Primers Primers cannot be located by automatic search.
Genotyping
Sweater genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. The same primers used for galak genotyping are used here.
 
Primers for PCR amplification
Sweater(F): 5’- CAAGCATGTAGCTAGACCTTCCACAGAGATGAAG -3’
Sweater(R): 5’- CAATGACATTGTCATCTGAAGGAACAAAGTTG -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             2:00
5) repeat steps (2-4) 40X
6) 72°C             700
7) 4°C               ∞
 
Primers for sequencing
Sweater_seq(F): 5’- GTGGGAAATAAACATGACTGACTGAATATG -3’
Sweater_seq(R): 5’- TTCACAAAGAACAAAGTGACTTAGCAAG -3’
 
The following sequence of 1277 nucleotides (from Genbank genomic region NC_000081 for linear DNA sequence of Slc45a2) is amplified:
 
11154                                                           caagcat
11161 gtagctagac cttccacaga gatgaagata gatgtcaagg ttcttagatc atcccaagct
11221 agtttgtatt ttctcaagaa gcttggtggt ggaggaggat aataaaatca tctcttttta
11281 ctgccactgg aaattgattt ttatggacta atttgggtca ataatttgag ttttttgctt
11341 gttgttacgt ttttgttgtc tttaagtagt atagaggata caggttggga aggtgacagt
11401 atctccaagg acggtatttt atttgctgtg cgttcactgc tgtattgaac atttttcatt
11461 tccataccat tgaccttctt ggtaggttac ttgtatgtta ttactccata aaagatacac
11521 aggactaagg tcacagcaaa taaatgccag agatgagtct tgaacccaca ctgtcttagc
11581 ctcttgctgt gttggcgctt catcactaca ggcagtctct gctttcctca gggagctttt
11641 ccacagaagg ggaaggtctg tgcatggtgg gaaataaaca tgactgactg aatatgctaa
11701 tgcatatctc tctctgtctc tctctctctc tctcccaccc cctttgcttt ctaggttttg
11761 gaggtgccct tggctacatt ttgggtgcca tagactgggt gcatctagat ctgggaaggc
11821 tgctgggcac agaattccag gtcatgttct tcttctctgc cctggttctc atcttgtgct
11881 tcatcacaca cctgtgcagt atccctgaag ctccactcag agatgctgca actgaccctc
11941 cctcacagca ggaccctcag ggctcgtcgc tgtcagccag tgggatgcat gaatacggtt
12001 ctattgagaa agttaaaaat ggaggtgcag acacagagca gccagtacag gaatggaaaa
12061 acaaaaagcc ttctggccag gtaaagatgc aaattctttt ttctttttct ccacatgggg
12121 gaagttttct tgctaagtca ctttgttctt tgtgaaattt gtcttgtttg cttgtctgat
12181 gtgaagtttt gtgaagtcta tttgaacctt taaaacctcc cttagtcatt ccctgttgga
12241 atgagaattt tgtgcctcag tggttctctt gcctcttact cctttcaaag catcaaactg
12301 gggaaggtga gacatctgta acagtgagac catgtgagaa ctctccagcc accttctggc
12361 cacaggacat agtcttttag ataaagaatt acaatctaca actttgttcc ttcagatgac
12421 aatgtcattg                                                            
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsAmanda L. Blasius, Bruce Beutler
Edit History
2011-08-25 11:59 AM (current)
2011-01-07 9:09 AM
2010-07-07 2:51 PM
2010-07-07 2:50 PM
2010-02-03 9:34 AM