Phenotypic Mutation 'durango' (pdf version)
Alleledurango
Mutation Type missense
Chromosome6
Coordinate91,723,471 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Slc6a6
Gene Name solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonym(s) Taut
Chromosomal Location 91,684,053-91,759,066 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009320; MGI:98488

Mapped Yes 
Amino Acid Change Glycine changed to Aspartic acid
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000032185] [ENSMUSP00000145794] [ENSMUSP00000146312] [ENSMUSP00000146306]
SMART Domains Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: G60D

DomainStartEndE-ValueType
Pfam:SNF 41 568 1.2e-241 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000032185)
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000205480)
Predicted Effect probably benign
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000205828)
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000206545)
Meta Mutation Damage Score 0.474 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
vision/eye
Candidate Explorer Status CE: excellent candidate; human score: 0.5; ML prob: 0.516
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(591) Gene trapped(588) Spontaneous (1) Targeted(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Slc6a6 APN 6 91741170 intron probably benign
IGL01829:Slc6a6 APN 6 91735189 missense probably damaging 1.00
IGL01896:Slc6a6 APN 6 91726069 missense probably damaging 0.97
IGL02087:Slc6a6 APN 6 91735179 missense probably benign
IGL02301:Slc6a6 APN 6 91726056 missense probably benign 0.31
IGL02439:Slc6a6 APN 6 91749827 missense probably damaging 0.99
IGL02555:Slc6a6 APN 6 91748330 unclassified probably benign
animas UTSW 6 91740014 splice site probably null
R0530:Slc6a6 UTSW 6 91724958 missense probably null 0.04
R1327:Slc6a6 UTSW 6 91726035 missense probably benign 0.00
R1503:Slc6a6 UTSW 6 91740992 missense probably damaging 1.00
R1612:Slc6a6 UTSW 6 91741027 missense probably damaging 1.00
R2033:Slc6a6 UTSW 6 91724910 missense probably benign 0.12
R2146:Slc6a6 UTSW 6 91735180 missense probably benign 0.05
R2309:Slc6a6 UTSW 6 91726196 missense possibly damaging 0.63
R2434:Slc6a6 UTSW 6 91735212 missense probably benign 0.33
R2656:Slc6a6 UTSW 6 91741048 missense probably damaging 1.00
R3402:Slc6a6 UTSW 6 91726129 missense probably benign
R3403:Slc6a6 UTSW 6 91726129 missense probably benign
R3978:Slc6a6 UTSW 6 91755052 missense probably benign 0.41
R4236:Slc6a6 UTSW 6 91741276 missense probably damaging 0.98
R4332:Slc6a6 UTSW 6 91723471 missense probably damaging 1.00
R4980:Slc6a6 UTSW 6 91726060 missense probably damaging 1.00
R5326:Slc6a6 UTSW 6 91735189 missense probably damaging 1.00
R5358:Slc6a6 UTSW 6 91735174 missense probably benign 0.28
R5542:Slc6a6 UTSW 6 91735189 missense probably damaging 1.00
R5774:Slc6a6 UTSW 6 91745000 missense probably damaging 1.00
R5839:Slc6a6 UTSW 6 91723317 missense probably damaging 1.00
R5861:Slc6a6 UTSW 6 91741033 missense probably damaging 1.00
R5939:Slc6a6 UTSW 6 91754948 missense probably benign 0.01
R6160:Slc6a6 UTSW 6 91740014 splice site probably null
R6262:Slc6a6 UTSW 6 91755032 missense possibly damaging 0.66
R6265:Slc6a6 UTSW 6 91754915 missense probably damaging 0.99
R6665:Slc6a6 UTSW 6 91726039 missense probably benign 0.38
R6998:Slc6a6 UTSW 6 91752438 missense probably benign 0.21
R7057:Slc6a6 UTSW 6 91741267 missense probably damaging 1.00
X0002:Slc6a6 UTSW 6 91723476 missense probably damaging 1.00
X0063:Slc6a6 UTSW 6 91741224 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2017-03-31 9:26 AM by Anne Murray
Record Created 2016-11-04 8:01 AM
Record Posted 2017-03-31
Phenotypic Description

Figure 1. Durango mice exhibit reduced thickness of the retina. OCT was utilized to determine retinal thickness. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The durango phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4332, some of which showed reduced thickness of the retina (as measured from the basement membrane of the retinal pigment epithelium to the internal limiting membrane) (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced retinal thickness using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 53 mutations (X-axis) identified in the G1 male of pedigree R4332. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 53 mutations. The retina phenotype was linked to two mutations on chromosome 6 in Slc6a6 and Ccdc129. The mutation in Slc6a6 is presumed causative as the eye phenotype mimics other alleles of Slc6a6 (see MGI for a list of Slc6a6 alleles and more information). The Slc6a6 mutation is a G to A transition at base pair 91,723,471 (v38) on chromosome 6, or base pair 39,426 in the GenBank genomic region NC_000072 encoding Slc6a6.  The retina phenotype was linked using a recessive model of inheritance, wherein two variant homozygotes departed phenotypically from nine homozygous reference mice and six heterozygous mice with a P value of 2.297 x 10-18 (Figure 2).  

 

The mutation corresponds to residue 476 in the mRNA sequence NM_009320 within exon 4 of 6 total exons.

 
460 GCCGGAGGCTTCGTGGGTTTGGGCAACGTCTGG

55  -A--G--G--F--V--G--L--G--N--V--W-

 

The mutated nucleotide is indicated in red.  The mutation results in a glycine (G) to aspartic acid (D) substitution at position 60 (G60D) in the SLC6A6 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 3. Domain organization and topology of TauT. TauT has 12 transmembrane domains. The location of the durango mutation is indicated.

Slc6a6 encodes the taurine transporter (TauT), a member of the sodium and chloride-coupled transporter (alternatively, neurotransmitter transporter) gene family. The sodium and chloride-coupled transporters include neurotransmitter, amino acid, and osmolyte transporters [reviewed in (1)]. TauT shows a narrow specificity for β-amino acids (i.e., taurine, hypotaurine, and β-alanine). Taurine transport requires at least two Na+ ions and one Cl- ion to transport one taurine molecule across the cell membrane (2;3); bromide is able to partially substitute for Cl- (3).

 

TauT has 12 transmembrane domains. Charged amino acids in transmembrane four regulate the gating of taurine transport (4). Lys319, Lys317, and Asp325 are proposed to form a consensus sequence for taurine transport (5). Mutation of residues 319, 317, and 325 to glutamine (K319Q and K317Q) or tyrosine (D325Y) resulted in increased taurine uptake. Arg324 is proposed to be a binding site for taurine; mutation of R324 to glycine (R324G) resulted in reduced taurine transport as the result of an increase in the Km of the transporter (5). Ser322 is phosphorylated by protein kinase C (PKC), which regulates TauT function. Mutation of Ser322 to an alanine resulted in a three-fold increase in taurine transport activity in an oocyte expression system (5). Ser322 phosphorylation may alter the three-dimensional structure of the gate and block taurine binding to Arg324. In addition to Ser322, there are several putative PKC and protein kinase A (PKA) phosphorylation consensus sites in the TauT intracellular domains. In contrast the inhibitory role of PKC-mediated TauT phosphorylation, PKA activation increased taurine transport in Ehrlich ascites tumor cells (6). In a retinal pigment epithelial cell line, PKA activation increased taurine uptake, and PKA inhibition partially blocked taurine uptake induced by cholera toxin treatment (7;8). Cholera toxin-induced cAMP elevation resulted in increased taurine uptake through an increase in the affinity of TauT for taurine.

 

The durango mutation results in a glycine (G) to aspartic acid (D) substitution at position 60 (G60D). Residue 60 is within the first transmembrane domain.

Expression/Localization

TauT is expressed in most tissues, including rat and mouse brain (9;10), human thyroid (11), human placenta (12), mouse retina (13), mouse renal tubules (14), heart, skeletal muscle, and liver (10;13;15). TauT is localized to the plasma membrane (9;10;12;13;15).

 

Slc6a6 expression is regulated by glucose in a retinal pigment epithelial cell line (1;16). In addition, Slc6a6 mRNA and TauT protein expression are reduced after endogenous p53 induction by a DNA-damaging drug in renal cell cultures (17). Slc6a6 expression is increased in several cell lines cultured in hypertonic medium (1). In addition, TNF-α treatment of brain capillary cells (18) or an intestinal cell line (19) resulted in increased Slc6a6 expression. Taurine transport is stimulated and Slc6a6 expression increased in a retinal pigment epithelial cell line after treatment with nitric oxide donors (20).

Background
Figure 4. TauT is involved in taurine transport across the blood-retinal barrier. Taurine is essential for brain, retina, and kidney development. Taurine functions in cell volume regulation, antioxidant release, neuromodulation, protein stabilization, stress responses, immunomodulation, excitation-contraction coupling in muscle fibers, cytoprotection, and antiarrhythmic properties in the myocardium

Taurine is one of the most abundant amino acids in several tissues, but it is not incorporated into proteins. Instead, taurine functions in cell volume regulation, antioxidant release, neuromodulation, protein stabilization, stress responses, immunomodulation, excitation-contraction coupling in muscle fibers, cytoprotection, and antiarrhythmic properties in the myocardium (21-24). Taurine also has a putative function in the protection of cells from injury. Taurine is essential for brain, retina, and kidney development (4;25). The mechanism by which taurine functions may involve trophic effects, antioxidant effects, changes in intracellular calcium levels and ion channel activity, and membrane and protein stabilization [review in (1)]. Taurine is synthesized from cysteine derived in part from methionine through the cysteine sulfinate pathway, which involves oxidation of cysteine to cysteine sulfinate by cysteine dioxygenase and decarboxylation of cysteine sulfinate by cysteine sulfinate decarboxylase [reviewed in (1)].

 

Slc6a6-deficient (Slc6a6-/-) mice exhibit reduced taurine tissue levels in skeletal and heart muscle as well as brain, retina, kidney, liver, and plasma (25-28). Slc6a6-/- mice have reduced body weights and reduced fertility compared to wild-type littermates (25;26;29). The Slc6a6-/- mice also exhibit reduced exercise capacity (26;27), changes in neuroreceptor expression (30), loss of long-term potentiation in the striatum (31), hyposensitivity to chemical nociceptive stimuli (32), vision loss (25;33), defects in renal osmoregulation (34), and liver disease (28). Skeletal muscle in the Slc6a6-/- mice exhibited electromyographic abnormalities (27). The Slc6a6-/- skeletal muscle showed reduced cell volume, structural defects, and reduced exercise endurance capacity (26). The heart in the Slc6a6-/- mice compensates for the loss of taurine by upregulating various organic solutes to maintain normal osmolyte balance (29). Skeletal muscle is not able to compensate for the loss of taurine; the reason for the difference between the heart and skeletal muscle is unknown. The Slc6a6-/- heart had reduced ventricular wall thickness and cardiac atrophy as well as smaller cardiomyocytes (26). Cardiac output was reduced and there was increased expression of cardiac failure marker genes in the Slc6a6-/- mice compared to wild-type mice (26). The expression of several neuroreceptors (e.g., GABAA receptor, kainate receptors, and AMPA receptor) were upregulated in the brains from the Slc6a6-/- mice (30). Slc6a6-/- mice exhibited a loss of renal taurine levels in the kidney and subsequent hypotaurinemia (34). Slc6a6-/- mice exhibit increased concentrations of urea in the plasma as well as within cells (34;35). Water deprivation caused an increase in plasma osmolality as well as K+ and urea concentrations in the Slc6a6-/- mice compared to wild-type littermates (34). Loss of Slc6a6 expression predisposed C57BL/6 mice to develop end-stage diabetic kidney disease (14). Slc6a6-/- and Slc6a6+/- mice did not exhibit changes in fasting blood glucose levels compared to wild-type mice. Kidney weight was increased in Slc6a6-/- mice at 3 and 5 months after diabetes induction (14). Urine volume was reduced in diabetic Slc6a6-/- mice compared to diabetic wild-type and Slc6a6+/- mice indicating the development of advanced chronic kidney disease. Approximately half of the diabetic Slc6a6-/- and Slc6a6+/- mice died at four months. The Slc6a6-/- mice develop moderate unspecific hepatitis and liver fibrosis. The liver injury is slowly progressive with major liver pathology observed after 1 year of age (28). TauT is required to maintain volume regulation in T cells and that this function regulates T cell survival, T cell memory development, and T cell-mediated immune reactions (36). Slc6a6-/- mice exhibited diminished T cell-mediated recall responses in response to hapten-induced contact hypersensitivity (36). The number of CD4+ and CD8+ T cells in peripheral lymph nodes was normal in unprimed Slc6a6-/- mice; however, after activation, both CD4+ and CD8+ T cell numbers were reduced. The Slc6a6-/- mice also showed impaired in vivo generation of T cell memory upon antigen challenge.

Putative Mechanism

The Slc6a6-/- mice exhibit severe and progressive retinal degeneration (25;29;37). At postnatal day 14, the Slc6a6-/- mice exhibit a comparable number of rows of photoreceptor nuclei to wild-type littermates. However, the inner and outer segments of the photoreceptor cells are smaller than in the wild-type littermates. Retinal function at P14 is reduced in the Slc6a6-/- mice to approximately one-third of what is observed in wild-type littermates (25;29). At P30, the number of photoreceptor nuclei are significantly reduced and there is a complete loss of retinal function (25;29). Light deprivation slowed, but did not prevent, loss of photoreceptor cells in the Slc6a6-/- retina (33). The retinal degernation observed in Slc6a6-/- mice is proposed to be due to a reduction in the scavenging of free radicals or to impaired retinoid transport between the retinal pigment epithelium and the retina (29).

Primers PCR Primer
durango(F):5'- CTTAAGTCACTGGGGAAGGC -3'
durango(R):5'- ATGCTGACCCTGTGTCTGAG -3'

Sequencing Primer
durango_seq(F):5'- GTTGTTCTTCCTCCAACAGAAAACG -3'
durango_seq(R):5'- GACCCTGTGTCTGAGGTACATC -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsRafael Ufret