Phenotypic Mutation 'pinnacles' (pdf version)
Allelepinnacles
Mutation Type missense
Chromosome17
Coordinate86,476,851 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Prkce
Gene Name protein kinase C, epsilon
Synonym(s) Pkce, PKCepsilon, PKC[e], 5830406C15Rik
Chromosomal Location 86,167,785-86,657,919 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been shown to be involved in many different cellular functions, such as neuron channel activation, apoptosis, cardioprotection from ischemia, heat shock response, as well as insulin exocytosis. Knockout studies in mice suggest that this kinase is important for lipopolysaccharide (LPS)-mediated signaling in activated macrophages and may also play a role in controlling anxiety-like behavior. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced ethanol self-administration and are more sensitive to the acute behavioral effects of ethanol and other drugs that activate GABA(A) receptors. Mutants show reduced anxiety and stress hormones. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011104; MGI:97599

Mapped Yes 
Amino Acid Change Threonine changed to Isoleucine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000094873] [ENSMUSP00000094874]
SMART Domains Protein: ENSMUSP00000094873
Gene: ENSMUSG00000045038
AA Change: T218I

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
C1 170 220 4.48e-13 SMART
C1 243 292 8.29e-17 SMART
S_TKc 408 668 1.3e-104 SMART
S_TK_X 669 732 2.56e-25 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
(Using ENSMUST00000097274)
SMART Domains Protein: ENSMUSP00000094874
Gene: ENSMUSG00000045038
AA Change: T218I

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
C1 170 220 4.48e-13 SMART
C1 243 292 8.29e-17 SMART
S_TKc 408 668 1.3e-104 SMART
S_TK_X 669 732 2.56e-25 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
(Using ENSMUST00000097275)
Phenotypic Category
Phenotypequestion? Literature verified References
FACS NK cells - decreased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(10) : Gene trapped(2) Targeted(6) Transgenic(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Prkce APN 17 86625462 missense probably damaging 0.99
IGL01401:Prkce APN 17 86168840 missense probably damaging 1.00
IGL01508:Prkce APN 17 86630085 missense probably damaging 1.00
IGL02500:Prkce APN 17 86168914 missense probably benign 0.16
IGL02957:Prkce APN 17 86496026 missense possibly damaging 0.74
IGL03114:Prkce APN 17 86654555 missense probably damaging 0.97
R0063:Prkce UTSW 17 86482111 splice site probably benign
R0063:Prkce UTSW 17 86482111 splice site probably benign
R0403:Prkce UTSW 17 86168653 missense probably damaging 0.98
R0900:Prkce UTSW 17 86625458 missense probably damaging 1.00
R0919:Prkce UTSW 17 86630160 missense probably benign 0.06
R1413:Prkce UTSW 17 86496018 missense possibly damaging 0.81
R1430:Prkce UTSW 17 86559137 splice site probably benign
R1843:Prkce UTSW 17 86475546 nonsense probably null
R2129:Prkce UTSW 17 86496035 missense possibly damaging 0.89
R2341:Prkce UTSW 17 86474442 missense probably damaging 1.00
R2511:Prkce UTSW 17 86625326 missense probably damaging 1.00
R2679:Prkce UTSW 17 86176226 intron probably benign
R3724:Prkce UTSW 17 86168623 nonsense probably null
R3853:Prkce UTSW 17 86168849 missense probably damaging 1.00
R4364:Prkce UTSW 17 86476851 missense probably damaging 1.00
R4467:Prkce UTSW 17 86619911 missense possibly damaging 0.68
R4523:Prkce UTSW 17 86490750 critical splice acceptor site probably null
R4838:Prkce UTSW 17 86630083 missense probably benign 0.07
R5140:Prkce UTSW 17 86482142 missense probably benign 0.12
R5579:Prkce UTSW 17 86619948 missense probably damaging 1.00
R6026:Prkce UTSW 17 86493230 missense probably benign 0.02
R6048:Prkce UTSW 17 86493347 missense probably benign
R6212:Prkce UTSW 17 86559301 missense probably damaging 1.00
R6484:Prkce UTSW 17 86490809 missense probably benign
R6788:Prkce UTSW 17 86630061 missense probably damaging 1.00
R6915:Prkce UTSW 17 86493407 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-12-19 10:52 AM by Anne Murray
Record Created 2016-11-09 3:03 PM
Record Posted 2018-12-19
Phenotypic Description

Figure 1. Pinnacles mice exhibit decreased frequencies of peripheral CD11b+ dendritic cells in CD11c+ cells. Flow cytometric analysis of peripheral blood was utilized to determine DC cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The pinnacles phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4364, some of which showed reduced frequencies of CD11b+ dendritic cells in CD11c+ cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of decreased frequencies of peripheral CD11b+ dendritic cells in CD11c+ cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 37 mutations (X-axis) identified in the G1 male of pedigree R4364. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. The dendritic cell phenotype was linked by continuous variable mapping to a mutation in Prkce: a C to T transition at base pair 86,476,851 (v38) on chromosome 17, or base pair 309,298 in the GenBank genomic region NC_000083 encoding Prkce. Linkage was found with a recessive model of inheritance, wherein four variant homozygotes departed phenotypically from 15 homozygous reference mice and 22 heterozygous mice with a P value of 9.067 x 10-5 (Figure 2).  

Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. The dendritic cell phenotype was linked by continuous variable mapping to a mutation in Prkce: a C to T transition at base pair 86,476,851 (v38) on chromosome 17, or base pair 309,298 in the GenBank genomic region NC_000083 encoding Prkce. Linkage was found with a recessive model of inheritance, wherein four variant homozygotes departed phenotypically from 15 homozygous reference mice and 22 heterozygous mice with a P value of 9.067 x 10-5 (Figure 2).

 

The mutation corresponds to residue 1,461 in the mRNA sequence NM_011104 within exon 5 of 15 total exons.

 

1445 CATGAGCTCATTATTACAAAGTGCGCTGGGCTG

213  -H--E--L--I--I--T--K--C--A--G--L-

 

The mutated nucleotide is indicated in red. The mutation results in a threonine (T) to isoleucine (I) substitution at position 218 (T218I) in the PKCε protein (Figure 3), and is strongly predicted by PolyPhen-2 to be damaging (score = 0.997).

Protein Prediction
Figure 3. Domain organization of PKCε. The pinnacles mutation results in a threonine to isoleucine substitution at position 218 (T218I). Abbreviations: DAG, diacylglycerol; ABM, actin-binding motif; AGC-kinase, protein kinase A/protein kinase G/protein kinase C-kinase

Prkce encodes protein kinase C epsilon (PKCε), a member of the protein kinase C (PKC) family of serine-threonine kinases. At least 11 mammalian PKC proteins are known with a wide range of tissue distribution, subcellular localization, and function. The PKC family belongs to the AGC-type kinase (protein kinase A/protein kinase G/protein kinase C) superfamily. PKC kinases can be split into three groups: conventional (α, βI [see the record for Untied]], βII, and γ), novel (δ [see the record for rigged], ϵ, η, θ [see the record for celina]), and atypical (ζ and ι/λ). These classifications are based on the structural motifs in the regulatory domain that account for cofactor dependence and interactions during induction of catalytic activity. The classical PKCs are dependent on calcium (Ca2+) and diacylglycerol (DAG), novel PKCs are regulated by diacylglycerol but are Ca2+ independent, and atypical PKCs are independent from both Ca2+ and diacylglycerol but are activated by other lipids.

 

PKC kinases share certain structural features. PKC kinases have highly conserved C-terminal catalytic domains consisting of motifs required for ATP-substrate binding and catalysis. The PKC kinases also have an N-terminal regulatory domain that maintains the enzyme in an inactive conformation. The regulatory and catalytic domains are attached to each other by a hinge region. Similar to other members of the PKC family, PKCε has a C2-like domain, two tandem cysteine-rich zinc finger C1/DAG domains (C1a and C1b), a kinase (C3/C4) domain, and a AGC-kinase C-terminal domain. PKCε has an actin-binding motif between the first and second cysteine-rich regions of the C1 domain (Figure 3) (1).

 

The C2-like domain is approximately 130 amino acids long and binds to anionic phospholipids present in membranes in a Ca2+-dependent manner (2). The C1 domains have a HX12CX2CXnCX2CX4HX2CX7C motif, where H is histidine, C is cysteine, X is any other amino acid, and n is 13 or 14 (3). The C1 domains facilitate DAG and phorbol ester binding. In the C1b domain, the phorbol ester binds to a pocket between two β-sheets (4). The C1 domains also function as hydrophobic switches to anchor PKCs to the membrane (5). The C1 domain has two zinc-coordinating sites required for C1 domain folding. The kinase domain has a glycine-rich ATP-binding loop with a GXGXXG sequence that is found in protein kinases and nucleotide binding proteins. An invariant Lys (Lys409) promotes phosphoryl-transfer. The hinge region of PKCε has 14-3-3 consensus binding sites (6;7). The C-terminal lobe of the kinase domain is predominantly α-helical and contains the activation loop. Met458 connects the two lobes of the kinase domain and controls access to a cavity in the ATP binding pocket. Within the C-terminal catalytic domain is an ATP-binding site (C3) and a substrate-binding domain (C4). PKCε associates with actin in response to stimuli such as AA and DAG (1;8). Association with actin both anchors PKCε and activates the kinase by maintaining it in a catalytically active conformation (1). The PKCε-actin interaction also promotes the formation of F-actin by inhibiting the depolymerization of F-actin, increasing the rate of actin filament elongation, and overturning the inhibition of actin nucleation by thymosin β4 (9). The PKCε-F-actin complex is essential for glutamate exocytosis from dentate gyrus granule cells of the hippocampus (1).

 

Thr566 (in the activation loop), Thr710 (in a Thr-Pro turn motif), and Ser729 (in a Phe-Ser-Tyr motif) must be phosphorylated for full activation of PKCε (10). Non- or hypo-phosphorylated (immature) PKCε associates with anchoring proteins via its catalytic domain. Phospholipid-dependent kinase (PDK1) phosphorylates Thr566, while Thr710 and Ser729 are phosphorylated by conventional PKCs (11). PKCε is also phosphorylated by GSK3-β at Ser-346 and Ser-368 is autophosphorylated (12).

 

The pinnacles mutation results in a threonine to isoleucine substitution at position 218 (T218I); Thr218 is within the DAG1/C1a domain.

Expression/Localization

PKCε is expressed in several tissues, with highest expression in neuronal, hormonal, and immune cells (13;14). PKCε is overexpressed in tumor-derived cell lines and tumor specimens from various organ sites (15).

 

In their inactive conformations, most PKC proteins are localized in the cytosol and often associate with cytoskeletal proteins (16). Upon activation, PKCs translocate to the plasma membrane via a mechanism that involves phospholipase C (PLC)-derived DAG accumulation (17;18). Association with receptors for activated C-kinase-2 (RACK2) anchors PKCε in close proximity to its substrates and localizes active PKCε to the Golgi apparatus and myofilaments (19;20).

Background
Figure 4. Overview of PKCε functions. PKCε is activated by DAG, PIP3, and fatty acids. PKCε promotes activation of several signaling pathways, including RhoA/RhoC, Akt, JNK, NF-κB, MAPK/ERK, and integrin signaling to mediate several functions, including neurite outgrowth, apoptosis, adhesion, and motility. Several PKCε targets shown in the figure are detailed in Table 1. Figure based on Akita.

Many functions have been ascribed to PKC kinases due to their widespread expression and variety of substrates. PKCs are involved in receptor desensitization, modulating membrane structure events, regulating transcription, mediating immune responses, regulating cell growth, and in learning and memory. A high degree of redundancy or cross talk among different PKC proteins can also occur, making the identification of isoform-specific roles difficult. The development of knockout mice for various PKC genes has enabled identification of the in vivo pathways and processes these proteins are involved in as opposed to their broad in vitro substrate specificity. Members of the PKC family play important roles in signaling for various growth factors, cytokines, and hormones including those involved in the regulation of cell growth, apoptosis, and differentiation of hematopoietic cells. These include platelet-derived growth factor (PDGF), insulin-like growth factor 1 (IGF-1), erythropoietin (EPO), thrombopoietin (TPO), stem cell factor (SCF), tumor necrosis factor (TNF), granulocyte-macrophage colony-stimulating factor (GM-CSF), G-CSF, M-CSF, type I and II interferons (IFNs) and various interleukins (ILs).

 

PKCε is activated by several factors, including second messengers, DAG, phosphatidylinositol 3,4,5-triphosphate (PIP3), and fatty acids produced by platelet-derived growth factor (PDGF) and bradykinin (Figure 4) (21;22). PKCε has several functions, including promoting neuron growth during neuronal differentiation, ion channel regulation (23;24), regulation of nociceptor function (25;26), muscle contraction, metabolism, cancer cell invasion, regulation of apoptosis, postnatal myocardial development, protection against ischemic damage (27), activation of the immune system (28;29), and phagocytosis by macrophages (29;30) [reviewed in (31)].

 

PKCε has several known downstream targets (Table 1) and binding partners. One such binding partner is 14-3-3, which associates with PKCε during mitosis. The 14-3-3/PKCε complex is required for cytokinesis during abscission; the role of PKCε in cytokinesis is unknown, but it may involve RhoA (6). PDZ and LIM domain protein 5 (PDLIM5) is another PKCε binding protein, which binds N-type voltage- gated calcium channels (32). PKCε also binds peripherin, inducing its aggregation and the subsequent apoptosis of neuroblastoma cells (33).

 

Table 1. Select PKCε substrates

PKCε target

Description of target

Downstream effect

References

STAT3

Transcription factor

Increases STAT3 nuclear translocation and transcriptional activation; promotes icrotubule polymerization during cell motility

(34;35)

RhoA/RhoC

Rho family GTPases

Depolymerization of filamentous actin during cell motility

(36)

Akt

Serine/threonine kinase important for cell survival and proliferation, angiogenesis, metabolism, and protein translation

 

Akt activation; assembly of actomyosin filaments for contraction during cell motility

(37;38)

Calsequestrin

Calcium-binding protein

Reduces binding of calsequestrin to PKCε

(39)

VR1

Capsaicin receptor

Regulates nociceptor sensitization by ATP

(40)

α4 nicotinic  acetylcholine receptor (nAChR) subunit

The nAChR mediate fast cholinergic neurotransmission

Regulates recovery from receptor desensitization

(41)

MARCKS (myristoylated alanine rich protein kinase C substrate)

Regulatory component of the cytoskeleton

Putative regulates thyrotropin-releasing hormone-stimulated prolactin secretion

(42;43)

TRAM (see the record for Branch)

Adaptor protein in TLR4 (see the record for lps3)-associated signaling

Required for TLR4-associated signaling; PKCε-associated phosphorylation causes reduced TRAM at the cell membrane

(44)

Histone H1

Chromatin component

Putatively anchors activated PKCε in the nucleus where it can regulate gene expression

(45)

Protein kinase D1 (PKD1; see the record for Purnama for information about PKD2)

Serine/threonine kinase

Releases autoinhibition by the pleckstrin homology domain; may modulate PKD-dependent regulation of L-type (and N-type) calcium channels

 

(46)

eNOS (see the record for paul)

Nitric oxide synthase enzyme

 

Increased eNOS activity

(47)

γ2 subunit of GABAA receptors

Ion channel that mediates most inhibitory neurotransmission in the nervous system

Reduces the response of GABAA receptors to ethanol and benzodiazepines; development of this acute tolerance to ethanol

(48;49)

TRPV1 (see the record gingame for information about TRPV5)

Cation channel activated by capsaicin, heat, protons, leukotrienes and anandamide

Promotes bradykinin-mediated enhancement of TRPV1 function

(50)

NaV1.8

Sodium channel

Increases channel function

(51)

Keratin 8

Intermediate filament protein

Unknown; putatively regulates cell-cell contacts in epithelial cells

(52)

IQGAP1 (IQ motif-containing GTPase activating protein 1)

Calcium-sensitive GTPase scaffolding protein in the cytoskeleton

 

Unknown; putatively modulates IQGAP1 binding to Cdc42; IQGAP1 phosphorylation promotes neurite outgrowth

(53;54)

CMyBPC (cardiac myosin binding protein)

Myosin binding protein in the cytoskeleton that functions in cardiac contractility

 

Contributes to aberrant cardiac function in dilated cardiomyopathy

 

(55;56)

Fibroblast growth factor (FGFR) 1 and 2

Receptor that functions in proliferation, survival, and differentiation

Required for the sustained activation of Ras and ERK, which is essential for neuronal differentiation and cell survival

(57)

 

Figure 5. Toll-like receptor 4 (TLR4) signaling pathways. Once TLR4 homodimers recognize their ligands, they recruit combinations of adaptor proteins (MyD88, TICAM, TRAM, TIRAP) via homophilic TIR domain interactions. TLR4 signals through the MyD88-dependent pathway from the cell membrane to produce proinflammatory cytokines and is subsequently internalized into late endosomes to signal through the TICAM-dependent pathway to produce IFN. When bound to vesicular stomatitis virus glycoprotein G (VSV-G), TLR4 can signal through TRAM to induce IRF7 activation, a process that is partially dependent on TICAM. PKCε is required for TRAM phosphorylation.

PKCε has a known function in Toll-like receptor 4 (TLR4)-associated signaling (Figure 5; see the record for lps3). TLR4 senses lipopolysaccharide (LPS). Stimulation of TLR4 by LPS activates two branches of signaling, one defined by early NF-κB (see the record for finlay) activation (MyD88-dependent pathway, mediated by MyD88), and another distinguished by late NF-κB activation as well as interferon responsive factor (IRF)-3 activation leading to type I IFN production and costimulatory molecule upregulation (MyD88-independent pathway, mediated by Trif and TRAM). MyD88-dependent TLR4 signaling culminates in the activation of NF-κB-dependent transcription. Briefly, IRAK-1 and TRAF6 dissociate from the receptor complex, and freed TRAF6 interacts with TAK1, activating it to phosphorylate the IκB kinase (IKK) complex. The IKK complex phosphorylates IκB, targeting it for degradation and relieving its inhibition of NF-κB which translocates to the nucleus and activates expression of target genes including interleukin (IL)-6, IL-1, TNF, IL-12p40 and type I interferon, cytokines required for the inflammatory response. The MyD88-independent pathway relies on the adapter Trif, and its hallmark is the production of type I IFN. Trif signals to TRAF3 and TBK1, both of which are required for IRF-3 activation and subsequent IFN induction. PKCε is required for LPS-induced IKK and NF-kB activation and TNFa and IL-12 production; however, how/where PKCε fits in the TLR4 signaling pathway is unknown, but it is required for TRAM phosphorylation (28;58-61).

 

PKCε is overexpressed in several cancer types, including bladder (62), brain (63), breast (64), head and neck (36;65), lung (66), kidney (67), and prostate cancers (34;68). The mutations that result in PKCε overexpression have not been documented. PKCε overexpression is a prognostic biomarker of poorer overall and disease-free survival (64;65). PKCε promotes aggressive, invasive, and motile phenotypes in breast and prostate cancers (64). In a non-small cell lung carcinoma cell line, PKCε putatively promotes cell cycle dysregulation (66).

 

Chronic PKCε activation is linked to the development of diabetes (69). Increased PKCε activation results in the downregulation of the insulin receptor and lipid accumulation, and subsequent impaired glycogen synthesis and insulin resistance. In the hyperglycemic state, increased PKCε activity was associated with development of cardiomyopathy (70), nephropathy (71), and vascular disease. PKCε levels are reduced in the brains of Alzheimer’s disease patients (72). PKCε suppresses the production of Abeta, a factor associated with Alzheimer’s disease pathogenesis, by promoting alpha-secretase-mediated processing of amyloid precursor protein (APP) (73).

 

Prkce-deficient (Prkce-/-) mice exhibited reduced T cell proliferation in response to anti-CD3E antibody, reduced serum IL-1b and TNFa levels, increased susceptibility to bacterial infection, reduced female fertility, reduced body sizes, and reduced total body fat amounts (28). Macrophages from the Prkce-/- mice showed reduced apoptosis and nitric oxide production in response to LPS, LPS plus interferon-gamma (IFN-g), or LPS, IFN-g, and 15dPGJ2 compared to wild-type macrophages (28). A second Prkce-/- mouse model showed normal development and function of CD3+ T cells (74). T cells from the mice showed comparable proliferative responses and IL-2 secretion in response to anti-CD3 antibodies or mitogenic stimuli (74). NF-kB transactivation and CD25, CD44, and CD69 induction after CD3/CD28 engagement were also normal. Keratinocytes from a third Prkce-/- mouse model showed reduced TNFa production after stimulation with ethanol or 12-O-tetradecanoylphorbol-13-acetate (TPA) (75). Prkce-/- mice showed reduced anxiety-like behavior with reduced levels of the stress hormones corticosterone and adrenocorticotrophic hormone as well as increased sensitivity to neurosteroid modulators of GABAA receptors (76). Prkce-/- mice fed a high-fat diet showed augmented insulin secretion and were protected from glucose intolerance (77). Epidermis-specific overexpression of PKCε causes mice to develop metastatic carcinomas (78).

Putative Mechanism

In addition to its roll in TLR4 signaling, T cell development, and phagocytosis by macrophages, PKCε is putatively involved in B-cell receptor-associated signaling (79). The role of PKCε in BCR signaling is unknown, but PKCε is highly expressed in B cells, and BCR activation results in PKCε translocation from the cytosol to the cell membrane and PI3K phosphorylation of PKCε (79). PKCε also regulates LPS-induced IL-12 synthesis in monocyte-derived dendritic cells (58); however, other roles in dendritic cells have not been documented.

Primers PCR Primer
pinnacles(F):5'- GCATCCATTTAGGTTCGGACATTG -3'
pinnacles(R):5'- AATCGATGATGCTTAAGCCAGC -3'

Sequencing Primer
pinnacles_seq(F):5'- TTTAGGTTCGGACATTGACAGAAAG -3'
pinnacles_seq(R):5'- GAGCCAACTCCCTTCATTTTTG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsMing Zeng, Xue Zhong, and Bruce Beutler