Allele | Glacier | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 44,679,494 bp (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ A (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Pax5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | paired box 5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | EBB-1, Pax-5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 44,524,757-44,710,487 bp (-) (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. Paired box transcription factors are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013] PHENOTYPE: Null mutants exhibit impaired development of the midbrain resulting in a reduced inferior colliculus and an altered cerebellar folial pattern, failure of B cell differentiation, runting, and high postnatal mortality with few survivors. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI Refseq: NM_008782.2; MGI:97489 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Isoleucine changed to Phenylalanine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000014174] [ENSMUSP00000099996] [ENSMUSP00000103455] [ENSMUSP00000103457] [ENSMUSP00000103458] [ENSMUSP00000133540] [ENSMUSP00000141186] [ENSMUSP00000134370] [ENSMUSP00000139296] [ENSMUSP00000133671] [ENSMUSP00000134712] [ENSMUSP00000134391] [ENSMUSP00000128880] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q02650 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000014174 Gene: ENSMUSG00000014030 AA Change: I184F
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | possibly damaging
PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000099996 Gene: ENSMUSG00000014030 AA Change: I184F
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | possibly damaging
PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000103455 Gene: ENSMUSG00000014030 AA Change: I184F
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | possibly damaging
PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000103457 Gene: ENSMUSG00000014030 AA Change: I184F
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000103458 Gene: ENSMUSG00000014030 AA Change: I184F
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | possibly damaging
PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000133540 Gene: ENSMUSG00000014030
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000141186 Gene: ENSMUSG00000014030 AA Change: H95L
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000134370 Gene: ENSMUSG00000014030 AA Change: I184F
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000139296 Gene: ENSMUSG00000014030 AA Change: I183F
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | possibly damaging
PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000133671 Gene: ENSMUSG00000014030 AA Change: I118F
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000134712 Gene: ENSMUSG00000014030 AA Change: I184F
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | possibly damaging
PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000134391 Gene: ENSMUSG00000014030 AA Change: I184F
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | possibly damaging
PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000133978 Gene: ENSMUSG00000014030 AA Change: I128F
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000134119 Gene: ENSMUSG00000014030 AA Change: I128F
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000128880 Gene: ENSMUSG00000014030
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.8250 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Essential (E-score: 1.000) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(13) : Chemically induced (ENU)(2) Gene trapped(1) Targeted(10) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2020-07-29 6:45 PM by External Program | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2016-11-16 8:09 AM | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2016-12-16 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The glacier phenotype was identified among G3 mice of the pedigree R4766, some of which showed an increased frequency of total B1 cells (Figure 1) and a decrease in B1b cells in B1 cells (Figure 2), all in the peripheral blood. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 86 mutations. Both of the above anomalies were linked by continuous variable mapping to three mutations on chromosome 4 in genes Usp45, Fut9, and Pax5. The mutation in Pax5 is presumed to be causative as the phenotypes mimic those observed in Pax5 mouse mutants (see MGI for a list of Pax5 alleles and the record for Apple). The mutation in Pax5 is an A to T transversion at base pair 44,679,494 (v38) on chromosome 4, or base pair 30,947 in the GenBank genomic region NC_000070 encoding Pax5. The strongest association was found with a recessive model of linkage to the normalized frequency of total B1 cells, wherein four variant homozygotes departed phenotypically from 10 homozygous reference mice and 11 heterozygous mice with a P value of 4.234 x 10-13 (Figure 3). A substantial semidominant effect was observed in both of the assays. The mutation corresponds to residue 582 in the mRNA sequence NM_008782 within exon 5 of 10 total exons and to residue 284 in the cDNA sequence ENSMUST00000186542.1 within exon 3 of 3 total exons.
Genomic numbering corresponds to NC_000070. The mutated nucleotide is indicated in red. The mutation results in a histidine (H) to leucine (L) substitution at position 95 (H95L) in the PAX5 protein encoded by the ENSMUST00000186542.1 cDNA transcript and a isoleucine (I) to phenylalanine substitution at position 184 in the Pax5 protein (Pax5a) encoded by the NM_008782 mRNA transcript. The H95L mutation is strongly predicted by PolyPhen-2 to be benign (score = 0.415). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Pax5 encodes Pax5 [alternatively, B-cell lineage-specific activator protein (BSAP)], a member of the paired box (PAX) family of transcription factors that have roles in cellular differentiation, migration, and proliferation (1-5). Pax5 has been further classified as a member of a Pax family subgroup that includes Pax2 and Pax8. The Pax5/2/8 subgroup share a highly conserved paired box DNA binding domain (PRD), an octapeptide motif, a partial homeodomain, a transactivation domain, and a repressor domain (1;6-12) (Figure 4). Pax5 recognizes target genes via the PRD, a 128 amino acid (aa) domain that has two helix-turn-helix motifs separated by a polypeptide linker (4;6;9;12-16). At the N-terminus, a β-hairpin binds to the DNA phosphate backbone, followed by a β-turn that contacts the minor groove of DNA targets (8;12;15-17). The N-terminus is also essential for the recombination function of Pax5 (see the “VH-to-DJH” subsection in the “Background”, below) (8). The polypeptide linker also contributes to DNA binding by contacting the minor groove (12). The centrally located octapeptide motif (TN8TCCT; N can be any combination of eight nucleotides) is a characteristic feature of most Pax proteins and is a region rich in proline, serine, threonine, and tyrosine residues [(18-20); reviewed in (21)]. The octapeptide motif is required for Pax5-Groucho-mediated gene repression; mutation or deletion of this sequence leads to an increase in the transactivation of Pax proteins (18-20;22). Also, the octapeptide motif has the potential to direct cytosine methylation to surrounding gene sequences (23). The partial homeodomain of Pax5 is not required for transcriptional activation of Pax5 target genes, but is required for Pax5-mediated activation of recombination, as deletion of this domain resulted in impaired RAG-mediated recombination (see the “VH-to-DJH” subsection in the “Background”, below) (8). Although the homeodomain is not required for activation of target genes, it is required for interaction with the TATA box binding protein, retinoblastoma protein, and the death domain-associated protein Daxx (24;25) as well as for the recruitment of the Groucho corepressor (18), and the cooperation of Pax5 and Ets-1 (17;26). The 55 amino acid proline-, serine-, and threonine-rich transactivation domain and repressor sequences are at the C-terminus of Pax5 (10;18). The transactivation domain is active in both promoter and enhancer positions during Pax5-mediated regulation of gene expression and can be negatively regulated by the adjacent repressor sequences at the extreme C-terminus (10;18). E1A-binding protein (p300), a histone acetyltransferase that regulates transcription through chromatin remodeling, interacts with the Pax5 C-terminus, and can subsequently facilitate the acetylation of several lysines in the Pax5 N-terminal PRD (e.g., Lys67, Lys87, Lys94, Lys98, and Lys103) upon p300 overexpression (7). Mutations of Lys67, Lys87, Lys89, or Lys103 altered the induction of Pax5 target genes (e.g., CD19 and Blnk (B cell linker; see the record for busy)) in murine pro B cells [see Table 2 for the functional significance of these Pax5 targets; (7)], indicating that Pax5 activity is regulated through acetylation. Pax5 generates multiple isoforms from two known alternative promoters to generate transcripts with distinct first exons (exon 1A and 1B) and otherwise similar in-frame sequences [(9;11;27-29); reviewed in (30)]. Alternative splicing also occurs throughout the transcript to generate multiple protein isoforms [(9); reviewed in (30)]. In both murine spleen and B-lymphoid cell lines, Pax5 generates four isoforms by alternative splicing that are expressed at detectable levels in normal B cells: Pax-5a (i.e., full-length Pax5), Pax5b, Pax5d, and Pax5e (28;31) (Figure 4). Pax-5d lacks exons 6-10 and Pax-5e lacks exons 2 and 6-10 (31). As a result, Pax5a and Pax5d, but not Pax5e, possess an intact DNA-binding domain; Pax5d and Pax5e do not have transactivation, repression, or partial homeodomain homology regions, but do contain a novel 128 base pair sequence with an unknown function (28;31). In a transient transfection system, the Pax5d and Pax5e isoforms worked to either compete or enhance the transactivating function of Pax5a: Pax5d had a transactivating function opposite of Pax5a, while isoform Pax5e increased the activity of Pax5a (31). Lowen et al. also showed that the ratio of Pax5d to Pax5e correlated with the proliferation state of the lipopolysaccharide-activated B cell: increased levels of Pax-5e led to increased proliferation, while increased Pax5d levels inhibited cell growth (31). The function of Pax-5b was not addressed. Some studies have indicated that the differential expression of PAX5 isoforms can be disease-specific in B cell malignancies (11;32;33). However, the findings have been inconsistent as isoform expression patterns differed between the studies, even in normal cells (11;32;33). One study showed that there were no significant differences in PAX5 transcript patterns between normal and cancerous B-lymphocytes (11). In contrast, another study showed a higher number or leukemia-specific isoforms in B-cell precursor acute lymphoblastic leukemia (BCP-ALL) (33). Robichaud et al. identified the expression of five PAX5 isoforms that were generated through alternative splicing in the 3’ region in healthy B-lymphocytes, B cell lines, and primary lymphoma samples (9). The isoforms excluded different combinations of exons 7-9 resulting in changes at the C-terminus of the protein (i.e., shorter protein variants) (9). In three of the isoforms, there was a shift in the reading frame that resulted in novel protein sequences that contained a higher ratio of proline, serine, and threonine residues (9). In this study, all of the PAX5 isoforms could recognize and bind the same DNA targets, but with different transactivation potentials (9). Furthermore, in individual lymphoma samples, Robichaud et al. noted one predominant isoform, either the full length PAX5 or PAX5Δ8, an isoform that lacks 34 amino acids within the transactivating domain; healthy samples expressed multiple isoforms (9). This study also determined that upon activation of distinct cellular pathways with mitogenic agents, different isoform expression patterns were induced (9). In another study, on ‘aged’ normal lymphocytes, researchers found that transcripts in these lymphocytes corresponded to isoforms already described (9;11), including those with various exon deletions (e.g., Δ2, Δ7/8, Δ2/7/8, Δ2/7/8/9, Δ2/4/8, and Δ2/3/4/8) (32). Nebral et al. found that there was a time-dependent accumulation of splice variants, indicating that the conflicting finds in other studies may be due to unintentional ‘ageing’ of lymphocytes or cold shock conditions (32).
Pax5 interacts with partner proteins to increase Pax5 specificity for target genes [Table 1; (16)]. Pax5 can form ternary complexes between Pax5, Ets proto-oncogene family proteins, and DNA [Figure 5; (26)]. The crystal structure of the ternary complex of the Pax5 PRD (aa 19-142) and the Ets domain (aa 335-436) of Ets-1 bound to a 25 base pair Mb-1 DNA promoter fragment has been solved at a resolution of 2.25 Å [Figure 5; (17); PDB: 1K78]. Pax5 binds DNA similar to Pax6 [PDB: 6PAX; (14)] in that the N-terminal domain (NTD) and C-terminal domain (CTD) of the Pax5 PRD each have three α helices with a helix-turn-helix motif that contact the DNA major groove (17). Furthermore, the NTD has a short β hairpin at its N-terminus, followed by a β turn; the linker that connects the NTD and CTD binds in the DNA minor groove in an extended conformation (17). The Pax5 PRD has several direct contacts with the DNA bases as well as contacts with the sugar phosphate backbone (17). For example, in helix C (i.e., the recognition helix), His62 directly contacts G9 (and indirectly contacts T10 and A11 through water-mediated interactions) and Lys67 directly contacts T11 (17). Previous studies had determined that His62 is essential for Pax5 binding, as mutations at this base results in 95% loss in Pax5 binding (16;26). Within the β turn, Asn29 and Gly30 contact the minor groove through direct and water-mediated interactions (17). Residues Ile83, Gly84, Gly85, and Ser86 within the linker domain contact the minor groove through main chain or side chain atoms (17). Within the CTD, Arg137 is in van der Waals contact with T21 and S133 is in a hydrogen bond with G23 in the major groove (17). Pax5 recruits Ets-1 to a Pax5-Ets binding site to subsequently enhance its DNA-binding ability at the promoter of the Mb-1 (alternatively, Ig-α; see the record for crab)) gene; Gln22 in Pax5 is an essential residue for this interaction [(7;12;16;17;26;34-36); reviewed in (30)]. The interaction of Pax5 with Ets-1 counteracts Ets-1 autoinhibition to subsequently increase the binding of Ets-1 to the Mb-1 promoter >1000-fold (34). In addition to Ets-1, Pax5 can recruit other members of the Ets family (i.e., Fli-1, GABPα (together with the ankyrin-repeat protein GABPβ), and PU.1) to the Mb-1 promoter in vitro (16;37-39); reviewed in (21)]. In the case of PU.1, the interaction with Pax5 can result in either a cooperative function (e.g., recruiting Groucho proteins such as Grg4 (7;24;38)) to the Igh locus (38)), or a repressive function (e.g., antagonizing activity at the Igk locus (37)). Table 1. Additional Pax5 interacting proteins. See (30) and (21) for more information.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | Pax5 is expressed in the embryonic central nervous system (transiently in the mesencephalon (i.e., the midbrain), in the midbrain-hindbrain boundary preceding the development of the midbrain and cerebellum, and spinal cord) and fetal liver, B-lymphocytes, and adult testis [(3;4;43-45); reviewed in (21;30)]. In B-lymphocytes, Pax5 expression is initiated in pre-pro-B cells and expressed by the B220+ pro-B cell stage in the bone marrow (46;47). Expression persists to the mature B cell stage in peripheral lymphoid organs where it is subsequently repressed in terminally differentiated plasma cells [(7;44;48-51); reviewed in (21;52)]. Several factors regulate Pax5 expression. For example, in adult B lymphopoiesis, the transcription factors E2A and early B cell factor (EBF1) initiate Pax5 expression [(53;54); reviewed in (55)]. Also, Pax2 activates Pax5 expression via binding to an enhancer sequence within the Pax5 gene (45). Metastasis-associated protein 1 (MTA1) has also been identified as a regulator of Pax5 transcription [(56); reviewed in (30)]. The JAK2/STAT5 pathway regulates Pax5 activity and may also regulate its expression: phosphorylated STAT5 (see record for domino for information on STAT1) enhances activation of the Pax5 promoter in pre-B cells (57). Also, JAK2 activation can induce the DNA-binding ability and nuclear localization of Pax5 in breast carcinoma cells (58). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
The Pax protein family regulates pattern formation, morphogenesis, cellular differentiation, and organogenesis by activating (or repressing) genes that encode secreted proteins, cell surface receptors, cell cycle regulators, and transcription factors [(3;16); reviewed in (21)]. Pax5/BSAP was identified as a regulator of B cell lineage development (7;48;49) that also plays a role in neural development (44;50) and cancer (1;11;48). In order to facilitate gene regulation, Pax5 can either induce active chromatin (to activate target genes) or eliminate active chromatin (to repress genes) (59). Pax5 induces chromatin changes by recruiting both histone-modifying complexes and chromatin-remodeling complexes to the target genes (48;59). ChIP profiling of histone modifications in Pax5-deficient cells determined that Pax5 induces H3K4 methylation and H3K9 acetylation at regulatory elements of target genes [(59;60); reviewed in (52)]. In the case of repressed genes, Pax5 eliminates active histone modifications (59). Pax5 and B Cells Pax5 plays a role in several aspects of B cell biology including the initiation of B cell lineage commitment in the bone marrow, maintenance of the B cell fate in more mature cells, V-DJ recombination of the Igh locus, and B cell migration [(25;44;48;61); reviewed in (62)]. Early B cell differentiation Mutation of Pax5 leads to B cell developmental arrest at an early progenitor B cell stage in the bone marrow [(50); Figure 6]. During B cell differentiation from a common hematopoietic stem cell progenitor to a mature B cell, Pax5 and other lineage-specific B lymphoid transcription factors such as EBF and E2A function to both activate B lineage-specific genes as well as to repress the transcription of other lineage-inappropriate genes (1;9;18;21;47-50;52;60;61;63-67). Pax5 can bind to a large part of the cis-regulatory genome (i.e., ~8000 Pax5 target genes) in pro-B and mature B cells (47). Microarray analysis of both wild-type and Pax5-deficient pro-B cells found that Pax5 repressed 110 genes and activate 170 genes (46;60;61). The Pax5-regulated genes included those that encode regulatory and structural proteins that have diverse functions such as transcriptional control, adhesion, migration, immune function, cellular metabolism, and receptor signaling [Table 2; (47;59-61;68); reviewed in (52;55). Table 2. Select B cell genes regulated by Pax5. See (47;59-61;68-70) for more Pax5 targets.
Mature B cell function, identity, and survival In addition to its role in early B cell lymphopoiesis, Pax5 also functions in mature B cells to downregulate B cell-specific genes and reactivate lineage-inappropriate genes (e.g., X-box-binding protein 1 (Xbp1) (71;81), B lymphocyte-induced maturation protein 1 [Blimp-1; (68;81)], immunoglobulin J chain (Igj) (82), and the Igh 3′ enhancer (83-85)) that were previously repressed during B cell maturation to maintain B cell identity throughout B lymphopoiesis (i.e., to repress the plasma cell pathway [(47;60;68;78;86); reviewed in (21)]. Pax5 also functions to control the migration of committed B cells by activating genes that code for adhesion receptors as well as adaptors and effectors downstream of integrin signaling [(59;60); reviewed in (52)]. In a study with conditional knockout of Pax5 in mature B cells, loss of Pax5 caused dedifferentiation of mature B cells into uncommitted progenitors in the bone marrow and the subsequent conversion of those progenitors to functional T cells (78;87). Figure 7 shows an overall view of BCR signaling; factors controlled by Pax5 are bolded.
VH-DJH rearrangement In Pax5−/− progenitors, VH-DJH recombination of the distal VHJ558 gene family is reduced by ∼50-fold [(50); reviewed in (52)]. Expression of Pax5 in developing T lineage cells in vitro can induce rearrangement of DH-proximal VH7183 genes to the DJH region (85;88). In situ hybridization determined that Pax5 mediates Igh locus contraction and subsequent distal VHJ558 gene recombination (83-85). Subsequent findings determined that Pax5 binds to the VH coding regions and subsequently facilitates RAG1-RAG2 (see the records for maladaptive and snowcock, respectively)-mediated VH-to-DJH recombination by physically interacting with RAG1-RAG2 (8). Zhang et al. propose two Pax5 functions in regulating Igh recombination (8). One, Pax5 binds to the Igh enhancer regions to establish the proper chromosomal configuration for VH-to-DJH rearrangements. Two, the binding of Pax5 to VH coding regions as well as to the RAG1-RAG2 complex mediates RAG-mediated recombination of VH genes (8). Midbrain and cerebellum development Studies have found that the Pax5-Pax2 complex is necessary for development of the midbrain and cerebellum (89). In a mouse model in which only one copy of both Pax2 (Pax2+/-) and Pax5 (Pax5+/-) were expressed, 20% of the compound heterozygotes had missing inferior colliculi and disrupted vermis of the cerebellum (89). A compound model with ablation of Pax5 expression (Pax5-/-) and Pax2 heterozygosity had complete loss of the posterior midbrain and cerebellum by embryonic (E) day 9.5 (89). In the chick brain, changes in Pax5 expression via transfection resulted in swelling of the anterior tectum and changed the diencephalon into a tectum-like structure (90). This study proposed a role of Pax5 in regulating the activity of the isthmus organizer (90). Pax5 in cancer Pax5 has been proposed to act as either an oncogene (11;48) or a tumor suppressor (1;87) in human cancers. PAX5 point mutations, monallelic loss of PAX5, and PAX5 fusions with other genes that cause increased Pax5 expression [e.g., PAX5 fusion to IGH (27;91-94)] have been identified in acute lymphoblastic leukemia (ALL) cell lines (i.e., REH and a B-lymphoid cell line derived from a patient) and in lymphoplasmocytoid lymphoma [(10;95); reviewed in (52)]. Overexpression or aberrant somatic hypermutations of PAX5 has also been identified in non-Hodgkin lymphoma [(27;96;97); reviewed in (30)]. In addition to B cell-associated cancers, PAX5 deregulation has been linked to increased malignancy in nonlymphoid cancers such as astrocytomas, medulloblastomas, neuroblastomas, oral carcinomas, colorectal carcinomas, cervical carcinomas, bladder carcinomas, breast cancer, and small-cell lung carcinomas by altering cancer proliferation, apoptosis, and phenotype transitioning [(42;58); reviewed in (30)]. A recent study on hepatocellular cancer (HCC) showed that ectopic expression of PAX5 suppressed HCC growth through the induction of p53-mediated apoptosis indicating that, in the case of hepatocarcinogenesis, PAX5 functions as a tumor suppressor (1).
Pax5 animal models Pax5 knockout (Pax5-/-) mice exhibit growth retardation and early death by three weeks of age (44). The ~5% of Pax5-/- mice to survive to adulthood were fertile, but were runted (44). Pax5-/- mice are osteopenic, are missing ~60% of their bone mass, and their spleens produced ~5 times the amount of osteoclasts compared to controls (3). Examination of the brains of Pax5-/- mice determined that the inferior colliculus in the auditory midbrain region was underdeveloped near the midline by as early as embryonic day (E) 16.5, but hearing was not affected (44;98). In the Pax5-/- mice, B cell development is arrested at the pro-B cell stage resulting in a lack of immunoglobulin in the serum [(3;25;44;50;86); reviewed in (21)]. In the Pax5-/- fetal liver, B cell development halts before the appearance of B220+ progenitors (50); in the Pax5-/- bone marrow, development progresses to a c-Kit+B220+ progenitor cell stage [(44;50); reviewed in (52)]. Pro-B cells from Pax5-/- mice can differentiate into almost all hemopoietic cell lineages both in vitro and in vivo [Figure 8; (18;67;99;100)]. Retroviral transduction of Pax5 causes the Pax5-deficient pro-B cells to progress along the B-lymphoid lineage (18;67;99). DH-to-JH rearrangement proceeds normally in the Pax5-/- mice along with rearrangement of a subset of the VH7183 genes; rearrangement of DH-distal VHJ558 genes is severely compromised (8;101). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | Similar to previous studies using conditional knockout or Pax5 (78;87) and the Pax5-/- mice (18;67;99;100), aberrant Pax5 expression/function in glacier is proposed to cause a conversion of B cell progenitors to other lymphoid cells. Similar to the Pax5-/- mice, arrest of B cell development in the glacier mice leads to a reduction in the amount of immunoglobulin in the serum [(3;25;44;50;86); reviewed in (21)]. As the glacier mutation is within the octapeptide motif, it may result in an increase in the transactivation of Pax proteins. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer Glacier_pcr_F: ATGGCTTTTCTCACCCAAGG Glacier_pcr_R: ATCCTTGAGCTGGCACTTGC Sequencing Primer Glacier_seq_F: GGCTTTTCTCACCCAAGGAGTAAAG Glacier_seq_R: GCCCTTCTGCAGCAGTTG |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 457 nucleotides is amplified (chromosome 4, - strand): 1 atccttgagc tggcacttgc ccttctgcag cagttgtacc cagcccagta tatctagtga Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Katherine Timer | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Xue Zhong and Bruce Beutler |