Allele | surface2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | critical splice donor site | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 113,379,661 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | A ⇒ G (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Ighd | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | immunoglobulin heavy constant delta | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | IgD | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 113,371,155-113,379,944 bp (-) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype | PHENOTYPE: Homozygotes for a null allele show delayed antibody affinity maturation and reduced IgE levels. Homozygotes for another null allele show 30-50% less B cells in spleen and lymph nodes, reduced IgG2b levels, and increased IgA levels. Homozygotes for an ENU-induced allele show shifted IgD expression. [provided by MGI curators] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | MGI:96447 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Limits of the Critical Region | 113406604 - 113416324 bp | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | no structure available at present | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.0776 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Probably nonessential (E-score: 0.095) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(5) : Chemically induced (ENU)(1) Targeted(2) Transgenic (2) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:41 PM by Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2016-11-29 8:22 PM by Jin Huk Choi | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2017-01-31 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The surface2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4703, some of which showed reduced expression of IgD on B cells in the peripheral blood (Figure 1) as well as reduced percentages of IgD+ B cells in the peripheral blood (Figure 2). |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 94 mutations. Both of the above phenotypes were linked by continuous variable mapping to a mutation in Ighd: an A to G transition at base pair 113,416,041 (v38) on chromosome 12, or base pair 284 in the GenBank genomic region NC_000078 encoding Ighd. The strongest association was found with an additive model of inheritance to the IgD+ B cell percentage, wherein three variant homozygotes departed phenotypically from 20 homozygous reference mice and 25 heterozygous mice with a P value of 1.751 x 10-5 (Figure 3). The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 282-nucleotide exon 1 (out of 5 total exons). The next available start codon is in exon 2 (highlighted below).
Genomic numbering corresponds to NC_000078. The donor splice site of intron 1, which is destroyed by the surface2 mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. The new putative start codon is highlighted. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Ighd encodes immunoglobulin heavy chain constant delta (Cδ). Immunoglobulin heavy chain genes have a variable domain and a constant region. Mouse IgD heavy chain has two Ig-like domains (CH1 and CH2, respectively) at the N-terminus and a transmembrane domain (Figure 4). The two CH domains are connected through a flexible hinge region. The intracellular tail of the membrane-bound IgD consists of three amino acids: Lys-Val-Lys (KVK). The surface2 mutation is predicted to result in deletion of exon 1. Deletion of exon 1 would cause an in-frame deletion of the amino acids encoded therein, which comprise the CH1 domain. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | Upon maturation into circulating follicular B cells, B cells coexpress both IgM and IgD. Upon B cell activation by antigens and helper T cells, the B cells undergo isotype switching and lose IgM and IgD, switching to express the same variable domain linked to IgG, IgA, or IgE constant region domains. Isotype switching involves DNA recombination of the Ig heavy chain locus, Igh, and subsequent deletion of Ighm and Ighd constant region exons and the reorganization of the Ighg, Ighe, or Igha constant region exons immediately 3’ to the VDJH variable exon. The VDJH exon is then spliced to IgG, IgE, or IgA constant region exons in the mRNA (1;2). B cells induce numerous responses to microbial infections, including antigen internalization, proliferation, T cell-independent antibody production, and the T cell-dependent antibody response. These responses are initiated upon antigen binding by the BCR, which rapidly recruits a signaling complex through interactions with Src family kinases (SFK) and the tyrosine kinase Syk (see the record for poppy). BCR engagement also activates pathways regulated by PKCβ (see Untied), PI-3K, and Ras/MAPK, which further modulate B cell responses [see (3;4) for reviews of B cell antigen receptor signaling]. For more information about BCR-associated signaling, please see the record for crab. IgD is a potent inducer of TNF, IL1B, and IL1RN. IgD also induces release of IL-6, IL-10, and LIF from peripheral blood mononuclear cells. IgD-deficient mice have normal frequencies of B cells in the lymph node and spleen (5). A second study found that IgD-deficient mice exhibited 30 to 50% less B cells in the spleen and lymph nodes, but had a normal pre-B cell compartment (6). The loss of IgD expression resulted in an increase in IgM expression and comparable amounts of surface Ig expressed on B cells (5;6). T cell frequency and the ratio of CD4 to CD8 T cells in the IgD-deficient mice were normal (5). The IgD-deficient mice respond efficiently to both T-dependent and T-independent antigens (5;6). Affinity maturation of serum antibodies was delayed in the IgD-deficient mice (5). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer surface2_pcr_F: GTGTTGATGAAGCAGCTGAG surface2_pcr_R: TCCTCTCAGAGTGCAAAGCC Sequencing Primer surface2_seq_F: TGTTGATGAAGCAGCTGAGAAAAG surface2_seq_R: TTGGAAGTCAGCCACTGAAAATC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 423 nucleotides is amplified (chromosome 12, - strand): 1 tcctctcaga gtgcaaagcc ccagaggaaa atgaaaagat aaacctgggc tgtttagtaa Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Katherine Timer | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Ming Zeng, Xue Zhong, Jin Huk Choi, and Bruce Beutler |