Phenotypic Mutation 'Oregano'

• Allele: Oregano
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 44,759,996 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Ebf1
• Gene Name: early B cell factor 1
• Synonym(s): Olf1, O/E-1, Olf-1
• Chromosomal Location: 44,508,144-44,898,918 bp (+) (GRCm39)
• MGI Phenotype: PHENOTYPE: Homozygotes for a targeted null mutation exhibit a reduced striatum due to excess apoptosis, altered facial branchiomotor neurone migration, and a block in B cell differentiation. Mutants are smaller than normal and many die prior to 4 weeks of age. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 44617317 - 45008091 bp
• Amino Acid Change: Phenylalanine changed to Serine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000080020] [ENSMUSP00000099857] [ENSMUSP00000104891]
• AlphaFold: Q07802
• PDB Structure: DNA binding domain of Early B-cell Factor 1 (Ebf1) bound to DNA (crystal form II) [X-RAY DIFFRACTION] ; DNA binding domain of Early B-cell Factor 1 (Ebf1) bound to DNA (Crystal form I) [X-RAY DIFFRACTION] ; Early B-cell Factor 1 (Ebf1) bound to DNA [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000080020; Gene: ENSMUSG00000057098; AA Change: F211S

Domain	Start	End	E-Value	Type
IPT	261	345	7.38e-8	SMART
HLH	346	395	5.4e-2	SMART
low complexity region	526	544	N/A	INTRINSIC
low complexity region	564	575	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000081265)
• SMART Domains: Protein: ENSMUSP00000099857; Gene: ENSMUSG00000057098; AA Change: F211S

Domain	Start	End	E-Value	Type
Pfam:COE1_DBD	17	247	8e-150	PFAM
IPT	262	346	7.38e-8	SMART
HLH	347	396	5.4e-2	SMART
low complexity region	527	545	N/A	INTRINSIC
low complexity region	565	576	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000101326)
• SMART Domains: Protein: ENSMUSP00000104891; Gene: ENSMUSG00000057098; AA Change: F211S

Domain	Start	End	E-Value	Type
IPT	254	338	7.38e-8	SMART
HLH	339	388	5.4e-2	SMART
low complexity region	519	537	N/A	INTRINSIC
low complexity region	557	568	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000109268)
• Meta Mutation Damage Score: 0.9595
• Is this an essential gene?: Probably essential (E-score: 0.896)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2020-07-29 6:45 PM by External Program
• Record Created: 2016-12-01 7:47 PM by Jin Huk Choi
• Record Posted: 2018-07-18
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, James Butler, Bruce Beutler

Accession Number

NCBI RefSeq: NM_001290709 (variant 1), NM_007897 (variant 2), NM_001290710 (variant 3), NM_001290711 (variant 4); MGI:95275

Alleles Listed at MGI

All Mutations and Alleles(28) : Chemically induced (other)(1) Gene trapped(21) Spontaneous(1) Targeted(5)

Phenotypic Description

Figure 1. Homozygous oregano mice exhibit diminished T-dependent IgG responses to alum-precipitated OVA. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Homozygous oregano mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Homozygous oregano mice exhibit diminished T-independent IgM responses to NP-Ficoll. IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Oregano mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Oregano mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Oregano mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Oregano mice exhibit increased frequencies of peripheral B1a cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Oregano mice exhibit increased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Oregano mice exhibit reduced frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Oregano mice exhibit reduced frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Oregano mice exhibit reduced frequencies of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Oregano mice exhibit reduced frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Oregano mice exhibit reduced frequencies of peripheral B1b cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 14. Oregano mice exhibit reduced frequencies of peripheral B2 cells. Flow cytometric analysis of peripheral blood was utilized to determine B2 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 15. Oregano mice exhibit reduced expression of IgD on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 16. Oregano mice exhibited increased TNFα secretion in response to TLR7 ligand, R848. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The oregano phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R4904, one of which showed a decrease in T-dependent antibody responses to alum-precipitated OVA (Figure 1) and recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 2) as well as T-independent antibody response to NP-Ficoll (Figure 3). The oregano mouse also showed increased frequencies of T cells (Figure 4), CD4+ T cells (Figure 5), CD8+ T cells (Figure 6), B1a cells (Figure 7), and B1b cells (Figure 8) with concomitant reduced frequencies of B cells (Figure 9), IgM+ B cells (Figure 10), IgD+ B cells (Figure 11), B1 cells (Figure 12), B1b cells in B1 cells (Figure 13), and B2 cells (Figure 14), all in the peripheral blood. The expression of IgD on peripheral B cells was reduced (Figure 15). Some mice also showed increased TNFα secretion in response to TLR7 ligand, R848 (Figure 16).

Nature of Mutation

Figure 17. Linkage mapping of the B2 cell phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 75 mutations (X-axis) identified in the G1 male of pedigree R4904. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 75 mutations. All of the above phenotypes were linked by continuous variable mapping to a mutation in Ebf1:  a T to C transition at base pair 44,869,169 (v38) on chromosome 11, or base pair 251,070 in the GenBank genomic region NC_000077 encoding Ebf1. The mutation in Ebf1 was presumed causative as the phenotypes observed in the oregano mice mimic those observed in other Ebf1 mouse mutants (see Crater_lake). The strongest association was found with a recessive model of inheritance to the normalized frequency of B2 cells, wherein one variant homozygous mouse departed phenotypically from 10 homozygous reference mice and eight heterozygous mice with a P value of 1.659 x 10^-14 (Figure 17).  

The mutation corresponds to residue 711 in the mRNA sequence NM_007897 within exon 7 of 16 total exons.

695 CGTGACATGCGGAGATTCCAGGTCGTGGTGTCT 206 -R--D--M--R--R--F--Q--V--V--V--S-

The mutated nucleotide is indicated in red. The mutation results in substitution of phenylalanine 211 for a serine (F211S) in all variants of the EBF1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 18. Domain structure of the EBF1 protein. The oregano mutation results in substitution of phenylalanine 211 for a serine in all variants of the EBF1 protein. Other mutations found in EBF1 are noted. Click on each mutation for more information. DBD: DNA-binding domain; ZK: Zinc knuckle; TIG/IPT: transcription factor immunoglobulin/Ig plexin-like fold in transcription factors; HLHLH: helix-loop-helix-loop-helix.

Early B cell factor 1 (EBF1; alternatively, EBF, O/E-1, or COE1) is a member of the COE (Collier-Olf-EBF) family of transcription factors. EBF1 has a DNA-binding domain (DBD), a TIG/IPT (transcription factor immunoglobulin (Ig)/Ig plexin-like fold in transcription factors) domain, a dimerization region similar to those found in basic helix-loop-helix proteins (termed the helix-loop-helix-loop-helix (HLHLH) domain), and a putative activation/multimerization domain that is rich in serine, threonine, and proline residues (Figure 18) (1-4). A RRARR motif between the DBD and TIG/IPT domain is predicted to be a nuclear localization sequence (5). A histidine and three cysteines within a fourteen residue motif, termed the ‘zinc knuckle’, coordinates a zinc ion and mediates DNA recognition (2;6).

Ebf1 has two promoters, a distal promoter (α) and a proximal promoter (β), which produce two EBF1 proteins (7). The two proteins differ by 11 amino acids at the N-terminus. The proteins are predicted to have similar functions. Interleukin-7 signaling, E2A, and EBF1 activate the distal Ebf1 promoter, whereas Pax5, Ets1, and Pu.1 regulate the stronger proximal promoter (7).

The oregano mutation results in substitution of phenylalanine 211 for a serine (F211S) in all variants of the EBF1 protein; amino acid 211 is within the DBD.

For more information about EBF1, please see the record for crater_lake.

Putative Mechanism

During B cell differentiation from a common hematopoietic stem cell (HSC) progenitor to a mature B cell, PAX5 [see the record for glacier] and other lineage-specific B lymphoid transcription factors such as EBF1 and E2A function to both activate B lineage-specific genes as well as to repress the transcription of other lineage-inappropriate genes.

In the lymphoid lineage, common lymphoid progenitors (CLPs) are divided into Ly6D-negative all-lymphoid progenitors (ALPs) and Ly6D-positive B cell biased lymphoid progenitors (BLPs) (8). The ALPs generate B cells, T cells, natural killer cells, and lymphoid dendritic cells. The BLPs are biased towards the B cell lineage. Ebf1 expression is initially expressed in the BLPs (9). E2A/E47 and HEB activate the expression of FOXO1, which acts with E2A to induce the expression of EBF1 (10). Expression of EBF1 (and FOXO1) in common lymphoid progenitors biases the cells towards B cell lymphopoiesis. EBF1 subsequently activates the expression of PAX5, which commits cells to the B cell fate (11).

EBF1 is a transcription factor that is required for B cell commitment, pro-B cell development, the transition to the pre-B cell stage, germinal center formation, and class switch recombination as well as for the proliferation, survival, and signaling of pro-B cells and peripheral B-cell subsets (e.g., B1 cells, follicular, and marginal zone B cells) (9;12). Ebf1-deficient (Ebf1^-/-) mice exhibit premature death (incomplete penetrance), reduced body sizes, reduced subcutaneous adipose tissue amounts, reduced serum IgM levels, decreased numbers of pro-B cells, loss of mature B cells in the blood and spleen, increased osteoblast cell numbers, and abnormal bone ossification (13;14). The Ebf1^-/- mice show no V(D)J recombination.  Mice expressing a spontaneous Ebf1 mutation (Ebf1^Serv/+; MGI:5007783) also exhibited reduced B cell numbers. Exogenous expression of EBF1 in mouse hematopoietic stem cells promotes B cell development, but the development of other hematopoietic cell lineages is impaired (15).

The phenotype observed in oregano mice indicates loss of EBF1^oregano function in regulating EBF1 target genes.

Primers

PCR Primer
Oregano_pcr_F: TCCCTGGGATGCAATATCAAGC
Oregano_pcr_R: AGATTGCAGAGATGCCTGGG

Sequencing Primer
Oregano_seq_F: CCACCCTGAGTTTTGCAGGAAAG
Oregano_seq_R: GGACCAGTAGCCTCACCTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 442 nucleotides is amplified (chromosome 11, + strand):

1   tccctgggat gcaatatcaa gcaagacttg tgcctcaatt ataatatgga ttctaatccc
61  accctgagtt ttgcaggaaa gccaggaaga gaagagggtg tgtaacctgg aagcgatttc
121 tgactctgag ttccttgtta ggattgaaac actgaccacg atctttgttt ctccacaggt
181 tcttcctgaa gtttttcctt aaatgcaacc aaaattgcct aaagaatgca ggaaacccac
241 gtgacatgcg gagattccag gtgagtccct cttgcttttc ttatatctta atcatgactt
301 gaacatgaag atgaggggaa aacatttttt tttcttttct ttctttcttt tttttttttt
361 tggcagaagg tatggaggat aattgtttct ctagaggtga agagcaggtg aggctactgg
421 tccccaggca tctctgcaat ct

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Hagman, J., Belanger, C., Travis, A., Turck, C. W., and Grosschedl, R. (1993) Cloning and Functional Characterization of Early B-Cell Factor, a Regulator of Lymphocyte-Specific Gene Expression. Genes Dev. 7, 760-773.

  2. Hagman, J., Gutch, M. J., Lin, H., and Grosschedl, R. (1995) EBF Contains a Novel Zinc Coordination Motif and Multiple Dimerization and Transcriptional Activation Domains. EMBO J. 14, 2907-2916.

  3. Treiber, N., Treiber, T., Zocher, G., and Grosschedl, R. (2010) Structure of an Ebf1:DNA Complex Reveals Unusual DNA Recognition and Structural Homology with Rel Proteins. Genes Dev. 24, 2270-2275.

  4. Siponen, M. I., Wisniewska, M., Lehtio, L., Johansson, I., Svensson, L., Raszewski, G., Nilsson, L., Sigvardsson, M., and Berglund, H. (2010) Structural Determination of Functional Domains in Early B-Cell Factor (EBF) Family of Transcription Factors Reveals Similarities to Rel DNA-Binding Proteins and a Novel Dimerization Motif. J Biol Chem. 285, 25875-25879.

  5. Boller, S., and Grosschedl, R. (2014) The Regulatory Network of B-Cell Differentiation: A Focused View of Early B-Cell Factor 1 Function. Immunol Rev. 261, 102-115.

  6. Fields, S., Ternyak, K., Gao, H., Ostraat, R., Akerlund, J., and Hagman, J. (2008) The 'Zinc Knuckle' Motif of Early B Cell Factor is Required for Transcriptional Activation of B Cell-Specific Genes. Mol Immunol. 45, 3786-3796.

  7. Roessler, S., Gyory, I., Imhof, S., Spivakov, M., Williams, R. R., Busslinger, M., Fisher, A. G., and Grosschedl, R. (2007) Distinct Promoters Mediate the Regulation of Ebf1 Gene Expression by Interleukin-7 and Pax5. Mol Cell Biol. 27, 579-594.

  8. Inlay, M. A., Bhattacharya, D., Sahoo, D., Serwold, T., Seita, J., Karsunky, H., Plevritis, S. K., Dill, D. L., and Weissman, I. L. (2009) Ly6d Marks the Earliest Stage of B-Cell Specification and Identifies the Branchpoint between B-Cell and T-Cell Development. Genes Dev. 23, 2376-2381.

  9. Vilagos, B., Hoffmann, M., Souabni, A., Sun, Q., Werner, B., Medvedovic, J., Bilic, I., Minnich, M., Axelsson, E., Jaritz, M., and Busslinger, M. (2012) Essential Role of EBF1 in the Generation and Function of Distinct Mature B Cell Types. J Exp Med. 209, 775-792.

  10. Zandi, S., Mansson, R., Tsapogas, P., Zetterblad, J., Bryder, D., and Sigvardsson, M. (2008) EBF1 is Essential for B-Lineage Priming and Establishment of a Transcription Factor Network in Common Lymphoid Progenitors. J Immunol. 181, 3364-3372.

  11. Decker, T., Pasca di Magliano, M., McManus, S., Sun, Q., Bonifer, C., Tagoh, H., and Busslinger, M. (2009) Stepwise Activation of Enhancer and Promoter Regions of the B Cell Commitment Gene Pax5 in Early Lymphopoiesis. Immunity. 30, 508-520.

  12. Gyory, I., Boller, S., Nechanitzky, R., Mandel, E., Pott, S., Liu, E., and Grosschedl, R. (2012) Transcription Factor Ebf1 Regulates Differentiation Stage-Specific Signaling, Proliferation, and Survival of B Cells. Genes Dev. 26, 668-682.

  13. Lin, H., and Grosschedl, R. (1995) Failure of B-Cell Differentiation in Mice Lacking the Transcription Factor EBF. Nature. 376, 263-267.

  14. Hesslein, D. G., Fretz, J. A., Xi, Y., Nelson, T., Zhou, S., Lorenzo, J. A., Schatz, D. G., and Horowitz, M. C. (2009) Ebf1-Dependent Control of the Osteoblast and Adipocyte Lineages. Bone. 44, 537-546.

  15. Zhang, Z., Cotta, C. V., Stephan, R. P., deGuzman, C. G., and Klug, C. A. (2003) Enforced Expression of EBF in Hematopoietic Stem Cells Restricts Lymphopoiesis to the B Cell Lineage. EMBO J. 22, 4759-4769.