Phenotypic Mutation 'Tumnus' (pdf version)
AlleleTumnus
Mutation Type missense
Chromosome5
Coordinate140,885,945 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Card11
Gene Name caspase recruitment domain family, member 11
Synonym(s) CARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
Chromosomal Location 140,872,990-141,000,582 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_175362; MGI:1916978

Mapped Yes 
Amino Acid Change Glutamine changed to Arginine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000082941]
SMART Domains Protein: ENSMUSP00000082941
Gene: ENSMUSG00000036526
AA Change: Q667R

DomainStartEndE-ValueType
Pfam:CARD 23 109 1.3e-23 PFAM
coiled coil region 176 440 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
PDZ 674 755 2.73e-1 SMART
Blast:SH3 776 838 1e-10 BLAST
low complexity region 839 850 N/A INTRINSIC
low complexity region 920 934 N/A INTRINSIC
SCOP:d1kjwa2 970 1149 1e-18 SMART
Blast:GuKc 973 1139 1e-102 BLAST
Predicted Effect possibly damaging

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
(Using ENSMUST00000085786)
Meta Mutation Damage Score 0.09 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B1 cells - increased
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Candidate Explorer Status CE: not good candidate; human score: -3; ML prob: 0.376
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(13) : Chemically induced (ENU)(4) Gene trapped(1) Spontaneous(1) Targeted(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
unmodulated APN 5 140897997 intron probably benign
IGL00961:Card11 APN 5 140899709 missense probably damaging 0.97
IGL01645:Card11 APN 5 140878023 missense probably benign 0.00
IGL01731:Card11 APN 5 140882302 missense possibly damaging 0.89
IGL01782:Card11 APN 5 140927726 start codon destroyed probably null 0.02
IGL01935:Card11 APN 5 140883546 missense possibly damaging 0.62
IGL01991:Card11 APN 5 140913378 missense possibly damaging 0.63
IGL02447:Card11 APN 5 140906924 missense possibly damaging 0.93
IGL02583:Card11 APN 5 140878126 missense probably benign 0.10
IGL03255:Card11 APN 5 140898331 missense possibly damaging 0.73
Caravaggio UTSW 5 140913309 missense probably damaging 1.00
Dealer UTSW 5 140885877 missense probably damaging 1.00
hubei UTSW 5 140906767 missense probably damaging 0.96
king UTSW 5 140891080 splice site probably benign
may UTSW 5 140876495 nonsense probably null
poker UTSW 5 140878082 missense probably benign
Sharp UTSW 5 140876425 missense possibly damaging 0.93
unmodulated2 UTSW 5 140883782 splice site probably null
PIT4243001:Card11 UTSW 5 140908604 missense possibly damaging 0.95
PIT4486001:Card11 UTSW 5 140876408 missense probably damaging 1.00
PIT4531001:Card11 UTSW 5 140906660 missense probably damaging 0.99
R0046:Card11 UTSW 5 140908524 missense possibly damaging 0.92
R0285:Card11 UTSW 5 140887101 missense probably damaging 1.00
R0452:Card11 UTSW 5 140880370 missense probably benign 0.01
R1486:Card11 UTSW 5 140876519 missense probably benign
R1710:Card11 UTSW 5 140902905 nonsense probably null
R1733:Card11 UTSW 5 140906633 missense possibly damaging 0.88
R1817:Card11 UTSW 5 140885560 missense probably benign 0.00
R1818:Card11 UTSW 5 140885560 missense probably benign 0.00
R2027:Card11 UTSW 5 140906767 missense probably damaging 0.96
R2436:Card11 UTSW 5 140882362 missense possibly damaging 0.89
R2904:Card11 UTSW 5 140889133 missense probably benign 0.09
R3706:Card11 UTSW 5 140887135 missense probably damaging 0.99
R3708:Card11 UTSW 5 140887135 missense probably damaging 0.99
R4778:Card11 UTSW 5 140883782 splice site probably null
R4877:Card11 UTSW 5 140885877 missense probably damaging 1.00
R4889:Card11 UTSW 5 140885945 missense possibly damaging 0.75
R4910:Card11 UTSW 5 140874414 missense probably damaging 1.00
R5011:Card11 UTSW 5 140876520 missense possibly damaging 0.93
R5257:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5258:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5682:Card11 UTSW 5 140902911 nonsense probably null
R5754:Card11 UTSW 5 140899769 missense probably damaging 0.99
R5873:Card11 UTSW 5 140908638 missense probably damaging 1.00
R6184:Card11 UTSW 5 140898278 missense probably damaging 1.00
R6792:Card11 UTSW 5 140913309 missense probably damaging 1.00
R6825:Card11 UTSW 5 140878082 missense probably benign
R7008:Card11 UTSW 5 140873393 missense probably damaging 1.00
R7291:Card11 UTSW 5 140901070 missense probably damaging 1.00
R7376:Card11 UTSW 5 140898238 missense probably benign 0.01
V7732:Card11 UTSW 5 140876495 nonsense probably null
X0067:Card11 UTSW 5 140885592 missense possibly damaging 0.60
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2019-09-04 9:41 PM by Diantha La Vine
Record Created 2016-12-08 8:38 AM
Record Posted 2017-02-27
Phenotypic Description
Figure 1. Tumnus mice exhibit increased frequencies of peripheral B1a cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Tumnus phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4889, some of which showed an increased frequency of B1 cells (Figure 1) in the peripheral blood.

Nature of Mutation
Figure 2. Linkage mapping of the increased peripheral B1a cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 51 mutations (X-axis) identified in the G1 male of pedigree R4889. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 51 mutations. The increased frequency of B1 cells was linked by continuous variable mapping to a mutation in Card11:  an A to G transition at base pair 140,885,945 (v38) on chromosome 5, or base pair 114,652 in the GenBank genomic region NC_000071 encoding Card11. Linkage was found with an additive model of inheritance to the normalized frequency of B1 cells, wherein eight variant homozygotes and 28 heterozygous mice departed phenotypically from 21 homozygous reference mice with a P value of 1.799 x 10-7 (Figure 3).  

 

The mutation corresponds to residue 2,321 in the mRNA sequence NM_175362 within exon 16 of 25 total exons.


 

2305 ACCGGGCCCTTGGTCCAGCACACAACTCTGAAT

662  -T--G--P--L--V--Q--H--T--T--L--N-

 

The mutated nucleotide is indicated in red.  The mutation results in a glutamine (Q) to arginine (R) substitution at position 667 (Q667R) in the CARMA1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.755).

Protein Prediction
Figure 3. Domain structure of CARMA1. The Tumnus mutation results in a glutamine to arginine substitution at position 667. Four predicted α-helices are represented in pink. This image is interactive. Other mutations found in CARMA1 are noted in red. Click on each mututation for more specific information.

CARMA1 contains no catalytic domains, but several protein interaction domains [Figure 3; reviewed in (1)]. The N-terminal half of CARMA1 contains a caspase recruitment domain (CARD) (residues 19-105) and a coiled-coil domain (residues 116-439). A membrane-associated guanylate kinase (MAGUK) domain occupies the bulk of the C-terminal half of CARMA1 (2;3). MAGUK family proteins contain 3 modular protein interaction domains, of which the hallmark is an approximately 300 amino acid region with homology to yeast guanylate kinase (GUK), but which is catalytically inactive. In addition, up to three PDZ domains and an SH3 domain are always present in tandem with the guanylate kinase domain. CARMA1 contains one PDZ (residues 660-742), one SH3 (residues 766-834) and one GUK domain (residues 954-1142) (2;3). The N- and C-terminal halves of CARMA1 are connected by a region of 232 amino acids between the CARD and coiled-coil domains designated the linker domain (residues 440-671). A NORS (no regular secondary structure) subdomain is found at the N-terminus of the linker domain (residues 44-519). The Tumnus mutation results in a glutamine (Q) to arginine (R) substitution at position 667 (Q667R) in CARMA1; residue 667 is within the PDZ domain. 

 

Please see the record for king for more information about Card11.

Putative Mechanism

CARMA1 belongs to the membrane-associated guanylate kinase (MAGUK) protein family, whose members function as molecular scaffolds for the localized assembly of such multiprotein complexes [reviewed in (4)]. Upon T cell activation by the T cell receptor (TCR) and costimulatory molecule engagement, CARMA1 associates with a complex containing Bcl10 and MALT1 (Mucosa-Associated Lymphoid tissue lymphoma Translocation-associated gene 1; also known as MLT or Paracaspase) and recruits these proteins to lipid rafts of the immunological synapse, where they activate the IKK complex, leading to degradation of IκB and subsequent activation of NF-κB (5-8). The CARMA1/Bcl10/MALT1 complex functions similarly in B cells to activate NF-κB in response to BCR engagement (9). NF-κB controls the proliferation, differentiation and survival of B and T cells by activating the transcription of target genes, including various cytokines.

 

CARMA1 mutants have normal numbers and differentiation of B cells in the bone marrow, but IgDhighIgMlow splenocytes and serum immunoglobulins (IgM, IgG1, IgG2a, IgG2b, IgG3, and IgA) are reduced in CARMA1 mutants. Peritoneal CD5+ B1 B cells are absent, and NK cells are reduced in number in CARMA1 mutant mice. CARMA1 mutant B cells fail to proliferate in response to BCR stimulation with anti-IgM, or upon CD40 stimulation. T cell development is largely normal in CARMA1 mutants, which have normal numbers of single- and double-positive thymocytes. However, within the double negative (CD4-CD8-) compartment, the proportion of DN3 cells (CD25+CD44lo) is reduced, while that of DN4 cells (CD25-CD44lo) is increased. Activating mutations in CARD11 (e.g., Gly123Asp, Glu127Gly, and Gly116Ser) have been linked to a disorder in humans associated with persisten polyclonal B cell lymphocytosis [PPBL; OMIM: #606445(10;11). PPBL is also often referred to as B cell expansion with NF-κB and T-cell anergy (BENTA). PPBL onset occurs in infancy with patients exhibiting splenomegaly and polyclonal expansion of B cells, subsequently leading to peripheral lymphocytosis (11). PPBL patients may also exhibit mild immune dysfunction (e.g., defective antibody responses and T cell anergy) as well as the development of B cell malignancy (11). Patients with B cell lymphocytosis exhibit high expression of cell cycle progression genes as well as increased proliferation and improved B cell survival after BCR stimulation (10)

Primers PCR Primer
Tumnus_pcr_F: GCATGCGTGTACGTAGAAGTGG
Tumnus_pcr_R: GAATCCCTTAGAACCCAGAGGC

Sequencing Primer
Tumnus_seq_F: TACGTAGAAGTGGAGGGCCTG
Tumnus_seq_R: TTAGAACCCAGAGGCCTCCAAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 400 nucleotides is amplified (chromosome 5, - strand):


1   gaatccctta gaacccagag gcctccaagc ctcaaggaca catacagcca tgccaccagc
61  atccttcccc aacctactag catgttcagc tcttctcttt tgagtccaac tgcctatttt
121 atttcccacc tcaggccctt ccggccatcg gtcacatctg ggggtcacgt gcggggcacc
181 gggcccttgg tccagcacac aactctgaat ggcgatgggc tcatcacgca gctcaccctt
241 ctgggcggca atgcacgcgg gagcttcatt cactctgtca agccaggctc actggctgag
301 agggccggac tgcgtgaggg ccaccaactc ctgctggtga gacatagagg gagaagctac
361 gggttgtccc caggccctcc acttctacgt acacgcatgc 


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsXue Zhong and Bruce Beutler