Phenotypic Mutation 'splenda' (pdf version)
Allelesplenda
Mutation Type missense
Chromosome19
Coordinate54,046,495 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Adra2a
Gene Name adrenergic receptor, alpha 2a
Synonym(s) alpha2A-AR, Adra-2a, Adra-2, alpha2A, alpha2A-adrenergic receptor, alpha(2A)AR
Chromosomal Location 54,045,182-54,048,982 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-2-adrenergic receptors are members of the G protein-coupled receptor superfamily. They include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. These receptors have a critical role in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. Studies in mouse revealed that both the alpha2A and alpha2C subtypes were required for normal presynaptic control of transmitter release from sympathetic nerves in the heart and from central noradrenergic neurons; the alpha2A subtype inhibited transmitter release at high stimulation frequencies, whereas the alpha2C subtype modulated neurotransmission at lower levels of nerve activity. This gene encodes alpha2A subtype and it contains no introns in either its coding or untranslated sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene fail to produce hypotensive responsiveness to alpha2AR agonists, including failure to inhibit voltage-gated Ca2+ currents and spontaneous neuronal firing. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007417; MGI:87934

Mapped Yes 
Amino Acid Change Aspartic acid changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000036203]
SMART Domains Protein: ENSMUSP00000036203
Gene: ENSMUSG00000033717
AA Change: D94G

DomainStartEndE-ValueType
Pfam:7tm_4 55 237 1.5e-7 PFAM
Pfam:7TM_GPCR_Srx 56 188 2.5e-6 PFAM
Pfam:7TM_GPCR_Srsx 59 245 3.7e-7 PFAM
Pfam:7tm_1 65 441 1.5e-73 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000036700)
Phenotypic Category
Phenotypequestion? Literature verified References
30 min GTT hypoglycemic 17964569
30 min GTT hypoglycemic (female) 17964569
30 min GTT hypoglycemic (male) 17964569
30 Min. Insulin - increased 17964569 19965390
30 Min. Insulin (Female) - increased 17964569 19965390
30 Min. Insulin (Male) - increased 17964569 19965390
Body Weight (Female) - decreased
Fasting Insulin (Male) - increased 17964569
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(6) : Targeted(5) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
splenda2 UTSW 19 54046639 missense probably damaging 1.00
R0245:Adra2a UTSW 19 54047409 missense probably damaging 1.00
R1933:Adra2a UTSW 19 54046406 missense probably damaging 1.00
R2175:Adra2a UTSW 19 54046362 missense probably benign 0.04
R4553:Adra2a UTSW 19 54046735 missense possibly damaging 0.86
R4781:Adra2a UTSW 19 54046495 missense probably damaging 1.00
R4984:Adra2a UTSW 19 54046639 missense probably damaging 1.00
R5260:Adra2a UTSW 19 54046608 missense probably damaging 1.00
R5326:Adra2a UTSW 19 54046681 missense probably damaging 1.00
R5585:Adra2a UTSW 19 54046239 missense probably benign 0.00
R6861:Adra2a UTSW 19 54046387 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-12-19 9:16 AM by Anne Murray
Record Created 2016-12-16 7:54 PM
Record Posted 2018-12-19
Phenotypic Description

Figure 1. Splenda mice exhibited decreased glucose levels in response to glucose stimulation. Log data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Splenda mice exhibited increased insulin levels in response to glucose stimulation. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The splenda phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4781, some of which showed diminished glucose (Figure 1) and slightly elevated insulin levels (Figure 2) 30 minutes after glucose challenge.

Nature of Mutation

Figure 3. Linkage mapping of the reduced glucose levels after glucose stimulation using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 70 mutations (X-axis) identified in the G1 male of pedigree R4781. Log phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 70 mutations. Both of the above anomalies were linked by continuous variable mapping to two genes on chromosome 19: Sorcs1 and Adra2a. The mutation in Adra2a was presumed causative, and is an A to G transition at base pair 54,046,495 (v38) on chromosome 19, or base pair 1,314 in the GenBank genomic region NC_000085 encoding Adra2a. The strongest association was found with a recessive model of inheritance to the glucose levels after glucose challenge, wherein six variant homozygotes departed phenotypically from 21 homozygous reference mice and 24 heterozygous mice with a P value of 4.732 x 10-9 (Figure 3).  

 

The mutation corresponds to residue 1,314 in the mRNA sequence NM_007417 within exon 1 of 1 total exons.

 

1298 TCCCTGGCCTCAGCGGACATCCTGGTGGCCACG

89   -S--L--A--S--A--D--I--L--V--A--T-

 

The mutated nucleotide is indicated in red. The mutation results in an aspartic acid to glycine substitution at amino acid 94 (D94G) in the ADRA2A protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 4. Domain organization and topology of α2AAR. α2AAR has seven transmembrane (TM) domains. The splenda mutation results in an aspartic acid to glycine substitution at amino acid 94 (D94G). This image is interactive. Other mutations found in the α2AAR protein are noted in red. Click on each mutation for more information.

Adra2a encodes the alpha-2a adrenergic receptor (α2AAR), one of several adrenergic G protein-coupled receptors (GPCRs); other adrenergic GPCRs include α1A, α1B, α1D, α2B, α2C, β1, β2, and β3. GPCRs are the largest superfamily of proteins known, and consist of seven transmembrane-spanning α-helices connected by alternating intracellular (C-) and extracellular (E-) loops (Figure 4). The N-terminus is extracellular, while the C-terminus is intracellular (1). In vertebrates, three major GPCR subfamilies exist: class A, class B, and class C. Adrenergic and adenosine receptors as well as rhodopsin (see the record for Bemr3) belong to the class A subfamily, which are characterized by a highly conserved (E/D)RY motif at the cytoplasmic end of the third transmembrane helix (TM3) (1). Many GPCRs also contain an NPXXY motif located in the TM7, and a stabilizing Cys-Cys disulfide bond (2)

 

Lys65 in the first intracellular loop of α2AAR is required for the exit of α2AAR from the endoplasmic reticulum (ER) and its subsequent transport to the cell surface (3). Lys65 putatively regulates α2AAR folding or proper assembly of α2AAR in the ER. The second and third intracellular loops interact with G protein-coupled receptor kinase-2 (GRK2) (4;5). α2AAR is phosphorylated by GRK2 at four adjacent serines (residues 296–299) in the third intracellular loop in an agonist-dependent manner (6;7). α2AAR is also putatively phosphorylated by protein kinase C (PKCα and/or PKCε), which causes rapid uncoupling from the G protein and receptor desensitization (8). In addition to mediating an interaction with GRK2, the third intracellular loop also interacts with arrestins (9;10), heterotrimeric G proteins (11-15), spinophilin (16), and 14-3-3 (17). An interaction between α2AAR and spinophilin putatively antagonizes GRK2-associated α2AAR phosphorylation (18). The third intracellular loop also functions in α2AAR stabilization at the cell surface (19). The N-terminus of the third intracellular loop regulates agonist-associated downregulation of α2AAR (20).

 

The α2AAR is N-linked glycosylated at Asn10 and Asn14 within the N-terminal tail (21). Cys442 within the C-terminal tail is palmitoylated (22). The functional significance of α2AAR posttranslational modifications is unknown. The palmitoylation and N-linked glycosylation are not required for proper α2AAR trafficking in Madin-Darby canine kidney cells (21). Also, the functional coupling to the G protein is not dependent on receptor palmitoylation (23). However, mutation of Cys442 (Cys442Ala) prevented downregulation of receptor number after prolonged agonist exposure (23). The α2AAR is able to heterodimerize with the β1AR; the dimerization is blocked when either AR is N-linked glycosylated (24).

 

The splenda mutation results in an aspartic acid to glycine substitution at amino acid 94 (D94G); D94 is within the second transmembrane domain.

Expression/Localization

Adra2a is highly expressed in the brain, including the locus ceruleus, midbrain, hypothalamus, amygdala, hippocampus, spinal cord, cerebral cortex, cerebellum, septum, and brain stem (25-27). The α2AAR is also expressed in human platelets, β cells of the pancreas, adrenal gland, intestinal epithelia, vascular endothelium, and smooth muscle cells (28). The α2AAR is localized at both the pre- and post-synapses in several brain regions (28).

Background
Figure 5. GPCR activation cycle. In its inactive state, the GDP-bound α subunit and the βγ complex are associated. Upon agonist binding, GPCR undergoes confirmational change and exchanges GDP for GTP in the Gα subunit. GTP-Gα and βγ dissociate and modulate effectors. Hydrolysis of GTP to GDP by RGS leads to inactivation of the G-protein.
Figure 6. Insulin secretion regulated by α2AAR. Neuronal norepinephrine (NE) or circulating epinephrine (EPI) activates α2AAR in pancreatic β cells, resulting in Gi coupling and inhibition of adenylyl cyclase (AC) and secretion of insulin.

GPCRs recruit and regulate the activity of heterotrimeric G proteins, which consist of an α subunit that binds and hydrolyzes GTP (Gα), and β and γ subunits that are constitutively associated in a complex [Figure 5; reviewed in (29)]. In the absence of a stimulus, the GDP-bound α subunit and the βγ complex are associated. Upon activation by ligand binding, the GPCR recruits its cognate heterotrimeric G protein, and undergoes a conformational change enabling it to act as guanine nucleotide exchange factor (GEF) for the G protein α subunit. GEFs promote the exchange of GDP for GTP, resulting in dissociation of the GTP-bound α subunit from the activated receptor and the βγ complex. Both the GTP-bound α subunit and the βγ complex mediate signaling by modulating the activities of other proteins, such as adenylyl cyclases, phospholipases, and ion channels. Gα signaling is terminated upon GTP hydrolysis, an activity intrinsic to Gα and which may be stimulated by GTPase activating proteins (GAPs) such as regulators of G protein signaling (RGS) proteins. The GDP-bound Gα subunit reassociates with the βγ complex and is ready for another activation cycle. Ligand-induced phosphorylation of the GPCR by G protein coupled receptor kinases (GRKs) leads to sequestration of the receptor from the cell surface thereby downregulating signaling.

 

The α2-adrenergic receptors (α2AAR, α2BAR, and α2CAR) mediate decreases in adenylyl cyclase activity, activation of receptor-mediated K+ channels, and inhibition of voltage-gated Ca2+ channels by coupling to Gi, Gs, and Go proteins (30;31). The α2-adrenergic receptors have critical roles in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. Epinephrine and norepinephrine activate the α2-adrenergic receptors, resulting in suppression of pain perception, sedation and lowering of blood pressure (32). α2AAR is the main inhibitory presynaptic feedback receptor (33-35). α2A and α2C served as heteroreceptors to inhibit the release of dopamine and serotonin in the central nervous system (36;37).

 

α2AAR activation inhibits insulin secretion from pancreatic islets; increased α2AAR expression depresses insulin release (Figure 6) (38). α2AAR inhibits insulin secretion by modulating cAMP levels after being activated by neuronal norepinephrine, circulating epinephrine, or by spontaneous activation. α2AAR activation results in receptor-Gi coupling and subsequent inhibition of adenylyl cyclase, reduced conversion of ATP to cAMP, and reduced protein kinase A-mediated exocytosis of insulin granules (39).

 

Mutations in human ADRA2A have been linked with increased fasting glucose levels and reduced insulin secretion during glucose challenge as well as obesity, high blood pressure, and increased type 2 diabetes risk (38;40-42). A 1291 C>G polymorphism in the promoter region of ADRA2A is associated with diarrhea predominant irritable bowel syndrome (IBS); however, the polymorphism was not significantly associated with constipation predominant IBS, alternating diarrhea and constipation IBS, ulcerative colitis, or microscopic colitis (43)

 

Adra2a-deficient (Adra2a-/-) mice exhibit reduced fasted circulating glucose levels, increased plasma insulin and glucagon levels, improved glucose tolerance, reduced startle reflex, and reduced prepulse inhibition [(44) and MGI:5695965]. Glucose-stimulated insulin secretion was not increased in the Adra2a-/-mice (44). A second Adra2a-/-mouse model did not exhibit hyperglycemia after treatment with 3-iodothyronamine and/or 6-OH dopamine, but exhibited hypoglycemia after treatment with 3-iodothyronamine. Together, indicating abnormal glucose homeostasis (45). The Adra2a-/- mice showed increased heart rates, resistance to the hypotensive agonist dexmedetomidine, impaired motor coordination skills, abnormal diurnal activity patterns, increased anxiety-like behaviors, increased release of synaptic norepinephrine release at high-frequency electrical stimulation, reduced synaptic norepinephrine release at low-frequency electrical stimulation, and inability to reduce burst frequency of induced epileptiform activity after epinephrine (33;34;46;47). Mice expressing a D79N mutation failed to show an immediate (transient) hypertensive response as well as a hypotensive response after administration of an α2AAR agonist (48).

Putative Mechanism

The phenotype of the splenda mice is similar to that of Adra2a-/- mice [(44) and MGI:5695965], indicating loss of α2AAR-associated function in regulating insulin secretion.

Primers PCR Primer
splenda(F):5'- CCTCTTCCTTATGTGAGGCG -3'
splenda(R):5'- ATGGACCAGTAGCGGTCAAG -3'

Sequencing Primer
splenda_seq(F):5'- GCGTTCATGTTCCGCCAG -3'
splenda_seq(R):5'- TAGCGGTCAAGGCTGATGGC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsEmre Turer and Bruce Beutler