Phenotypic Mutation 'splenda'

• Allele: splenda
• Mutation Type: missense
• Chromosome: 19
• Coordinate: 54,034,926 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Adra2a
• Gene Name: adrenergic receptor, alpha 2a
• Synonym(s): alpha2A-adrenergic receptor, Adra-2, alpha2A-AR, alpha(2A)AR, alpha2A, Adra-2a
• Chromosomal Location: 54,033,690-54,037,413 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-2-adrenergic receptors are members of the G protein-coupled receptor superfamily. They include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. These receptors have a critical role in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. Studies in mouse revealed that both the alpha2A and alpha2C subtypes were required for normal presynaptic control of transmitter release from sympathetic nerves in the heart and from central noradrenergic neurons; the alpha2A subtype inhibited transmitter release at high stimulation frequencies, whereas the alpha2C subtype modulated neurotransmission at lower levels of nerve activity. This gene encodes alpha2A subtype and it contains no introns in either its coding or untranslated sequences. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene fail to produce hypotensive responsiveness to alpha2AR agonists, including failure to inhibit voltage-gated Ca2+ currents and spontaneous neuronal firing. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Aspartic acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000036203]
• AlphaFold: Q01338
• SMART Domains: Protein: ENSMUSP00000036203; Gene: ENSMUSG00000033717; AA Change: D94G

Domain	Start	End	E-Value	Type
Pfam:7tm_4	55	237	1.5e-7	PFAM
Pfam:7TM_GPCR_Srx	56	188	2.5e-6	PFAM
Pfam:7TM_GPCR_Srsx	59	245	3.7e-7	PFAM
Pfam:7tm_1	65	441	1.5e-73	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000036700)
• Meta Mutation Damage Score: 0.6099
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2021-11-10 12:11 PM by Diantha La Vine
• Record Created: 2016-12-16 7:54 PM
• Record Posted: 2018-12-19
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_007417; MGI:87934

Alleles Listed at MGI

All Mutations and Alleles(6) : Targeted(5) Transgenic(1)

Phenotypic Description

Figure 1. Splenda mice exhibited decreased glucose levels in response to glucose stimulation. Log data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Splenda mice exhibited increased insulin levels in response to glucose stimulation. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The splenda phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4781, some of which showed diminished glucose (Figure 1) and slightly elevated insulin levels (Figure 2) 30 minutes after glucose challenge.

Nature of Mutation

Figure 3. Linkage mapping of the reduced glucose levels after glucose stimulation using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 70 mutations (X-axis) identified in the G1 male of pedigree R4781. Log phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 70 mutations. Both of the above anomalies were linked by continuous variable mapping to two genes on chromosome 19: Sorcs1 and Adra2a. The mutation in Adra2a was presumed causative, and is an A to G transition at base pair 54,046,495 (v38) on chromosome 19, or base pair 1,314 in the GenBank genomic region NC_000085 encoding Adra2a. The strongest association was found with a recessive model of inheritance to the glucose levels after glucose challenge, wherein six variant homozygotes departed phenotypically from 21 homozygous reference mice and 24 heterozygous mice with a P value of 4.732 x 10^-9 (Figure 3).  

The mutation corresponds to residue 1,314 in the mRNA sequence NM_007417 within exon 1 of 1 total exons.

1298 TCCCTGGCCTCAGCGGACATCCTGGTGGCCACG 89   -S--L--A--S--A--D--I--L--V--A--T-

The mutated nucleotide is indicated in red. The mutation results in an aspartic acid to glycine substitution at amino acid 94 (D94G) in the ADRA2A protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 4. Topology of α_2AAR. α_2AAR has seven transmembrane (TM) domains. Other mutations found in the α_2AAR protein are noted in red. 

Adra2a encodes the alpha-2a adrenergic receptor (α_2AAR), one of several adrenergic G protein-coupled receptors (GPCRs); other adrenergic GPCRs include α_1A, α_1B, α_1D, α_2B, α_2C, β₁, β₂, and β₃. GPCRs are the largest superfamily of proteins known, and consist of seven transmembrane-spanning α-helices connected by alternating intracellular (C-) and extracellular (E-) loops (Figure 4). The N-terminus is extracellular, while the C-terminus is intracellular (1). In vertebrates, three major GPCR subfamilies exist: class A, class B, and class C. Adrenergic and adenosine receptors as well as rhodopsin (see the record for Bemr3) belong to the class A subfamily, which are characterized by a highly conserved (E/D)RY motif at the cytoplasmic end of the third transmembrane helix (TM3) (1). Many GPCRs also contain an NPXXY motif located in the TM7, and a stabilizing Cys-Cys disulfide bond (2). 

Lys65 in the first intracellular loop of α_2AAR is required for the exit of α_2AAR from the endoplasmic reticulum (ER) and its subsequent transport to the cell surface (3). Lys65 putatively regulates α_2AAR folding or proper assembly of α_2AAR in the ER. The second and third intracellular loops interact with G protein-coupled receptor kinase-2 (GRK2) (4;5). α_2AAR is phosphorylated by GRK2 at four adjacent serines (residues 296–299) in the third intracellular loop in an agonist-dependent manner (6;7). α_2AAR is also putatively phosphorylated by protein kinase C (PKCα and/or PKCε), which causes rapid uncoupling from the G protein and receptor desensitization (8). In addition to mediating an interaction with GRK2, the third intracellular loop also interacts with arrestins (9;10), heterotrimeric G proteins (11-15), spinophilin (16), and 14-3-3 (17). An interaction between α_2AAR and spinophilin putatively antagonizes GRK2-associated α_2AAR phosphorylation (18). The third intracellular loop also functions in α_2AAR stabilization at the cell surface (19). The N-terminus of the third intracellular loop regulates agonist-associated downregulation of α_2AAR (20).

The α_2AAR is N-linked glycosylated at Asn10 and Asn14 within the N-terminal tail (21). Cys442 within the C-terminal tail is palmitoylated (22). The functional significance of α_2AAR posttranslational modifications is unknown. The palmitoylation and N-linked glycosylation are not required for proper α_2AAR trafficking in Madin-Darby canine kidney cells (21). Also, the functional coupling to the G protein is not dependent on receptor palmitoylation (23). However, mutation of Cys442 (Cys442Ala) prevented downregulation of receptor number after prolonged agonist exposure (23). The α_2AAR is able to heterodimerize with the β₁AR; the dimerization is blocked when either AR is N-linked glycosylated (24).

The splenda mutation results in an aspartic acid to glycine substitution at amino acid 94 (D94G); D94 is within the second transmembrane domain.

Expression/Localization

Adra2a is highly expressed in the brain, including the locus ceruleus, midbrain, hypothalamus, amygdala, hippocampus, spinal cord, cerebral cortex, cerebellum, septum, and brain stem (25-27). The α_2AAR is also expressed in human platelets, β cells of the pancreas, adrenal gland, intestinal epithelia, vascular endothelium, and smooth muscle cells (28). The α_2AAR is localized at both the pre- and post-synapses in several brain regions (28).

Background

Figure 5. GPCR activation cycle. In its inactive state, the GDP-bound α subunit and the βγ complex are associated. Upon agonist binding, GPCR undergoes confirmational change and exchanges GDP for GTP in the Gα subunit. GTP-Gα and βγ dissociate and modulate effectors. Hydrolysis of GTP to GDP by RGS leads to inactivation of the G-protein.

Figure 6. Insulin secretion regulated by α 2A AR. Neuronal norepinephrine (NE) or circulating epinephrine (EPI) activates α 2A AR in pancreatic β cells, resulting in G i coupling and inhibition of adenylyl cyclase (AC) and secretion of insulin.

GPCRs recruit and regulate the activity of heterotrimeric G proteins, which consist of an α subunit that binds and hydrolyzes GTP (Gα), and β and γ subunits that are constitutively associated in a complex [Figure 5; reviewed in (29)]. In the absence of a stimulus, the GDP-bound α subunit and the βγ complex are associated. Upon activation by ligand binding, the GPCR recruits its cognate heterotrimeric G protein, and undergoes a conformational change enabling it to act as guanine nucleotide exchange factor (GEF) for the G protein α subunit. GEFs promote the exchange of GDP for GTP, resulting in dissociation of the GTP-bound α subunit from the activated receptor and the βγ complex. Both the GTP-bound α subunit and the βγ complex mediate signaling by modulating the activities of other proteins, such as adenylyl cyclases, phospholipases, and ion channels. Gα signaling is terminated upon GTP hydrolysis, an activity intrinsic to Gα and which may be stimulated by GTPase activating proteins (GAPs) such as regulators of G protein signaling (RGS) proteins. The GDP-bound Gα subunit reassociates with the βγ complex and is ready for another activation cycle. Ligand-induced phosphorylation of the GPCR by G protein coupled receptor kinases (GRKs) leads to sequestration of the receptor from the cell surface thereby downregulating signaling.

The α₂-adrenergic receptors (α_2AAR, α_2BAR, and α_2CAR) mediate decreases in adenylyl cyclase activity, activation of receptor-mediated K⁺ channels, and inhibition of voltage-gated Ca²⁺ channels by coupling to G_i, G_s, and G_o proteins (30;31). The α₂-adrenergic receptors have critical roles in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. Epinephrine and norepinephrine activate the α₂-adrenergic receptors, resulting in suppression of pain perception, sedation and lowering of blood pressure (32). α_2AAR is the main inhibitory presynaptic feedback receptor (33-35). α_2A and α_2C served as heteroreceptors to inhibit the release of dopamine and serotonin in the central nervous system (36;37).

α_2AAR activation inhibits insulin secretion from pancreatic islets; increased α_2AAR expression depresses insulin release (Figure 6) (38). α_2AAR inhibits insulin secretion by modulating cAMP levels after being activated by neuronal norepinephrine, circulating epinephrine, or by spontaneous activation. α_2AAR activation results in receptor-G_i coupling and subsequent inhibition of adenylyl cyclase, reduced conversion of ATP to cAMP, and reduced protein kinase A-mediated exocytosis of insulin granules (39).

Mutations in human ADRA2A have been linked with increased fasting glucose levels and reduced insulin secretion during glucose challenge as well as obesity, high blood pressure, and increased type 2 diabetes risk (38;40-42). A 1291 C>G polymorphism in the promoter region of ADRA2A is associated with diarrhea predominant irritable bowel syndrome (IBS); however, the polymorphism was not significantly associated with constipation predominant IBS, alternating diarrhea and constipation IBS, ulcerative colitis, or microscopic colitis (43)

Adra2a-deficient (Adra2a^-/-) mice exhibit reduced fasted circulating glucose levels, increased plasma insulin and glucagon levels, improved glucose tolerance, reduced startle reflex, and reduced prepulse inhibition [(44) and MGI:5695965]. Glucose-stimulated insulin secretion was not increased in the Adra2a^-/-mice (44). A second Adra2a^-/-mouse model did not exhibit hyperglycemia after treatment with 3-iodothyronamine and/or 6-OH dopamine, but exhibited hypoglycemia after treatment with 3-iodothyronamine. Together, indicating abnormal glucose homeostasis (45). The Adra2a^-/- mice showed increased heart rates, resistance to the hypotensive agonist dexmedetomidine, impaired motor coordination skills, abnormal diurnal activity patterns, increased anxiety-like behaviors, increased release of synaptic norepinephrine release at high-frequency electrical stimulation, reduced synaptic norepinephrine release at low-frequency electrical stimulation, and inability to reduce burst frequency of induced epileptiform activity after epinephrine (33;34;46;47). Mice expressing a D79N mutation failed to show an immediate (transient) hypertensive response as well as a hypotensive response after administration of an α_2AAR agonist (48).

Putative Mechanism

The phenotype of the splenda mice is similar to that of Adra2a^-/- mice [(44) and MGI:5695965], indicating loss of α_2AAR-associated function in regulating insulin secretion.

Primers

PCR Primer
splenda_pcr_F: CCTCTTCCTTATGTGAGGCG
splenda_pcr_R: ATGGACCAGTAGCGGTCAAG

Sequencing Primer
splenda_seq_F: GCGTTCATGTTCCGCCAG
splenda_seq_R: TAGCGGTCAAGGCTGATGGC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 567 nucleotides is amplified (chromosome 19, + strand):

1   cctcttcctt atgtgaggcg cggcgggacg aaccccgcac cggaggaaga ggaggaccca
61  cggacgcggg gccggaaggc agctggcagc aggcccacga gaaccagcac ccgcgttcat
121 gttccgccag gagcagccgc tggccgaggg cagctttgcg cccatgggct cactgcagcc
181 ggatgccggc aacagcagct ggaacgggac cgaagcgccc ggaggcggca cccgagccac
241 cccttactcc ctgcaggtga cactgacgct ggtttgcctg gctggcctgc tcatgctgtt
301 cacagtattt ggcaacgtgc tggttattat cgcggtgttc accagtcgcg cgctcaaagc
361 tccccaaaac ctcttcctgg tgtccctggc ctcagcggac atcctggtgg ccacgctggt
421 cattcccttt tctttggcca acgaggttat gggttactgg tactttggta aggtgtggtg
481 tgagatctat ttggctctcg acgtgctctt ttgcacgtcg tccatagtgc acctgtgcgc
541 catcagcctt gaccgctact ggtccat

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Mustafi, D., and Palczewski, K. (2009) Topology of Class A G Protein-Coupled Receptors: Insights Gained from Crystal Structures of Rhodopsins, Adrenergic and Adenosine Receptors. Mol Pharmacol. 75, 1-12.

  2. Fotiadis, D., Jastrzebska, B., Philippsen, A., Muller, D. J., Palczewski, K., and Engel, A. (2006) Structure of the Rhodopsin Dimer: A Working Model for G-Protein-Coupled Receptors. Curr Opin Struct Biol. 16, 252-259.

  3. Fan, Y., Li, C., Guo, J., Hu, G., and Wu, G. (2012) A Single Lys Residue on the First Intracellular Loop Modulates the Endoplasmic Reticulum Export and Cell-Surface Expression of alpha2A-Adrenergic Receptor. PLoS One. 7, e50416.

  4. Pao, C. S., and Benovic, J. L. (2005) Structure/function Analysis of alpha2A-Adrenergic Receptor Interaction with G Protein-Coupled Receptor Kinase 2. J Biol Chem. 280, 11052-11058.

  5. Benovic, J. L., Onorato, J., Lohse, M. J., Dohlman, H. G., Staniszewski, C., Caron, M. G., and Lefkowitz, R. J. (1990) Synthetic Peptides of the Hamster Beta 2-Adrenoceptor as Substrates and Inhibitors of the Beta-Adrenoceptor Kinase. Br J Clin Pharmacol. 30 Suppl 1, 3S-12S.

  6. Eason, M. G., Moreira, S. P., and Liggett, S. B. (1995) Four Consecutive Serines in the Third Intracellular Loop are the Sites for Beta-Adrenergic Receptor Kinase-Mediated Phosphorylation and Desensitization of the Alpha 2A-Adrenergic Receptor. J Biol Chem. 270, 4681-4688.

  7. Liggett, S. B., Ostrowski, J., Chesnut, L. C., Kurose, H., Raymond, J. R., Caron, M. G., and Lefkowitz, R. J. (1992) Sites in the Third Intracellular Loop of the Alpha 2A-Adrenergic Receptor Confer Short Term Agonist-Promoted Desensitization. Evidence for a Receptor Kinase-Mediated Mechanism. J Biol Chem. 267, 4740-4746.

  8. Liang, M., Eason, M. G., Jewell-Motz, E. A., Williams, M. A., Theiss, C. T., Dorn, G. W.,2nd, and Liggett, S. B. (1998) Phosphorylation and Functional Desensitization of the alpha2A-Adrenergic Receptor by Protein Kinase C. Mol Pharmacol. 54, 44-49.

  9. Wu, G., Krupnick, J. G., Benovic, J. L., and Lanier, S. M. (1997) Interaction of Arrestins with Intracellular Domains of Muscarinic and alpha2-Adrenergic Receptors. J Biol Chem. 272, 17836-17842.

  10. DeGraff, J. L., Gurevich, V. V., and Benovic, J. L. (2002) The Third Intracellular Loop of Alpha 2-Adrenergic Receptors Determines Subtype Specificity of Arrestin Interaction. J Biol Chem. 277, 43247-43252.

  11. Wade, S. M., Dalman, H. M., Yang, S. Z., and Neubig, R. R. (1994) Multisite Interactions of Receptors and G Proteins: Enhanced Potency of Dimeric Receptor Peptides in Modifying G Protein Function. Mol Pharmacol. 45, 1191-1197.

  12. Dalman, H. M., and Neubig, R. R. (1991) Two Peptides from the Alpha 2A-Adrenergic Receptor Alter Receptor G Protein Coupling by Distinct Mechanisms. J Biol Chem. 266, 11025-11029.

  13. Eason, M. G., and Liggett, S. B. (1996) Chimeric Mutagenesis of Putative G-Protein Coupling Domains of the alpha2A-Adrenergic Receptor. Localization of Two Redundant and Fully Competent Gi Coupling Domains. J Biol Chem. 271, 12826-12832.

  14. Wade, S. M., Lim, W. K., Lan, K. L., Chung, D. A., Nanamori, M., and Neubig, R. R. (1999) G(i) Activator Region of Alpha(2A)-Adrenergic Receptors: Distinct Basic Residues Mediate G(i) Versus G(s) Activation. Mol Pharmacol. 56, 1005-1013.

  15. Eason, M. G., and Liggett, S. B. (1995) Identification of a Gs Coupling Domain in the Amino Terminus of the Third Intracellular Loop of the Alpha 2A-Adrenergic Receptor. Evidence for Distinct Structural Determinants that Confer Gs Versus Gi Coupling. J Biol Chem. 270, 24753-24760.

  16. Richman, J. G., Brady, A. E., Wang, Q., Hensel, J. L., Colbran, R. J., and Limbird, L. E. (2001) Agonist-Regulated Interaction between alpha2-Adrenergic Receptors and Spinophilin. J Biol Chem. 276, 15003-15008.

  17. Prezeau, L., Richman, J. G., Edwards, S. W., and Limbird, L. E. (1999) The Zeta Isoform of 14-3-3 Proteins Interacts with the Third Intracellular Loop of Different alpha2-Adrenergic Receptor Subtypes. J Biol Chem. 274, 13462-13469.

  18. Wang, Q., Zhao, J., Brady, A. E., Feng, J., Allen, P. B., Lefkowitz, R. J., Greengard, P., and Limbird, L. E. (2004) Spinophilin Blocks Arrestin Actions in Vitro and in Vivo at G Protein-Coupled Receptors. Science. 304, 1940-1944.

  19. Edwards, S. W., and Limbird, L. E. (1999) Role for the Third Intracellular Loop in Cell Surface Stabilization of the alpha2A-Adrenergic Receptor. J Biol Chem. 274, 16331-16336.

  20. Jewell-Motz, E. A., Donnelly, E. T., Eason, M. G., and Liggett, S. B. (1997) Role of the Amino Terminus of the Third Intracellular Loop in Agonist-Promoted Downregulation of the alpha2A-Adrenergic Receptor. Biochemistry. 36, 8858-8863.

  21. Keefer, J. R., Kennedy, M. E., and Limbird, L. E. (1994) Unique Structural Features Important for Stabilization Versus Polarization of the Alpha 2A-Adrenergic Receptor on the Basolateral Membrane of Madin-Darby Canine Kidney Cells. J Biol Chem. 269, 16425-16432.

  22. Kennedy, M. E., and Limbird, L. E. (1994) Palmitoylation of the Alpha 2A-Adrenergic Receptor. Analysis of the Sequence Requirements for and the Dynamic Properties of Alpha 2A-Adrenergic Receptor Palmitoylation. J Biol Chem. 269, 31915-31922.

  23. Eason, M. G., Jacinto, M. T., Theiss, C. T., and Liggett, S. B. (1994) The Palmitoylated Cysteine of the Cytoplasmic Tail of Alpha 2A-Adrenergic Receptors Confers Subtype-Specific Agonist-Promoted Downregulation. Proc Natl Acad Sci U S A. 91, 11178-11182.

  24. Xu, J., He, J., Castleberry, A. M., Balasubramanian, S., Lau, A. G., and Hall, R. A. (2003) Heterodimerization of Alpha 2A- and Beta 1-Adrenergic Receptors. J Biol Chem. 278, 10770-10777.

  25. Nicholas, A. P., Pieribone, V., and Hokfelt, T. (1993) Distributions of mRNAs for Alpha-2 Adrenergic Receptor Subtypes in Rat Brain: An in Situ Hybridization Study. J Comp Neurol. 328, 575-594.

  26. Scheinin, M., Lomasney, J. W., Hayden-Hixson, D. M., Schambra, U. B., Caron, M. G., Lefkowitz, R. J., and Fremeau, R. T.,Jr. (1994) Distribution of Alpha 2-Adrenergic Receptor Subtype Gene Expression in Rat Brain. Brain Res Mol Brain Res. 21, 133-149.

  27. Wang, R., Macmillan, L. B., Fremeau, R. T.,Jr, Magnuson, M. A., Lindner, J., and Limbird, L. E. (1996) Expression of Alpha 2-Adrenergic Receptor Subtypes in the Mouse Brain: Evaluation of Spatial and Temporal Information Imparted by 3 Kb of 5' Regulatory Sequence for the Alpha 2A AR-Receptor Gene in Transgenic Animals. Neuroscience. 74, 199-218.

  28. Saunders, C., and Limbird, L. E. (1999) Localization and Trafficking of alpha2-Adrenergic Receptor Subtypes in Cells and Tissues. Pharmacol Ther. 84, 193-205.

  29. Wettschureck, N., and Offermanns, S. (2005) Mammalian G Proteins and their Cell Type Specific Functions. Physiol Rev. 85, 1159-1204.

  30. Dorn, G. W.,2nd, Oswald, K. J., McCluskey, T. S., Kuhel, D. G., and Liggett, S. B. (1997) Alpha 2A-Adrenergic Receptor Stimulated Calcium Release is Transduced by Gi-Associated G(Beta Gamma)-Mediated Activation of Phospholipase C. Biochemistry. 36, 6415-6423.

  31. Eason, M. G., Kurose, H., Holt, B. D., Raymond, J. R., and Liggett, S. B. (1992) Simultaneous Coupling of Alpha 2-Adrenergic Receptors to Two G-Proteins with Opposing Effects. Subtype-Selective Coupling of Alpha 2C10, Alpha 2C4, and Alpha 2C2 Adrenergic Receptors to Gi and Gs. J Biol Chem. 267, 15795-15801.

  32. Ruffolo, R. R.,Jr, Nichols, A. J., Stadel, J. M., and Hieble, J. P. (1993) Pharmacologic and Therapeutic Applications of Alpha 2-Adrenoceptor Subtypes. Annu Rev Pharmacol Toxicol. 33, 243-279.

  33. Altman, J. D., Trendelenburg, A. U., MacMillan, L., Bernstein, D., Limbird, L., Starke, K., Kobilka, B. K., and Hein, L. (1999) Abnormal Regulation of the Sympathetic Nervous System in alpha2A-Adrenergic Receptor Knockout Mice. Mol Pharmacol. 56, 154-161.

  34. Hein, L., Altman, J. D., and Kobilka, B. K. (1999) Two Functionally Distinct alpha2-Adrenergic Receptors Regulate Sympathetic Neurotransmission. Nature. 402, 181-184.

  35. Vonend, O., Habbel, S., Stegbauer, J., Roth, J., Hein, L., and Rump, L. C. (2007) Alpha(2A)-Adrenoceptors Regulate Sympathetic Transmitter Release in Mice Kidneys. Br J Pharmacol. 150, 121-127.

  36. Scheibner, J., Trendelenburg, A. U., Hein, L., and Starke, K. (2001) Alpha2-Adrenoceptors Modulating Neuronal Serotonin Release: A Study in alpha2-Adrenoceptor Subtype-Deficient Mice. Br J Pharmacol. 132, 925-933.

  37. Bucheler, M. M., Hadamek, K., and Hein, L. (2002) Two Alpha(2)-Adrenergic Receptor Subtypes, Alpha(2A) and Alpha(2C), Inhibit Transmitter Release in the Brain of Gene-Targeted Mice. Neuroscience. 109, 819-826.

  38. Rosengren, A. H., Jokubka, R., Tojjar, D., Granhall, C., Hansson, O., Li, D. Q., Nagaraj, V., Reinbothe, T. M., Tuncel, J., Eliasson, L., Groop, L., Rorsman, P., Salehi, A., Lyssenko, V., Luthman, H., and Renstrom, E. (2010) Overexpression of alpha2A-Adrenergic Receptors Contributes to Type 2 Diabetes. Science. 327, 217-220.

  39. Liggett, S. B. (2009) Alpha2A-Adrenergic Receptors in the Genetics, Pathogenesis, and Treatment of Type 2 Diabetes. Sci Transl Med. 1, 12ps15.

  40. Langberg, E. C., Seed Ahmed, M., Efendic, S., Gu, H. F., and Ostenson, C. G. (2013) Genetic Association of Adrenergic Receptor Alpha 2A with Obesity and Type 2 Diabetes. Obesity (Silver Spring). 21, 1720-1725.

  41. Talmud, P. J., Cooper, J. A., Gaunt, T., Holmes, M. V., Shah, S., Palmen, J., Drenos, F., Shah, T., Kumari, M., Kivimaki, M., Whittaker, J., Lawlor, D. A., Day, I. N., Hingorani, A. D., Casas, J. P., and Humphries, S. E. (2011) Variants of ADRA2A are Associated with Fasting Glucose, Blood Pressure, Body Mass Index and Type 2 Diabetes Risk: Meta-Analysis of Four Prospective Studies. Diabetologia. 54, 1710-1719.

  42. Boesgaard, T. W., Grarup, N., Jorgensen, T., Borch-Johnsen, K., Meta-Analysis of Glucose and Insulin-Related Trait Consortium (MAGIC), Hansen, T., and Pedersen, O. (2010) Variants at DGKB/TMEM195, ADRA2A, GLIS3 and C2CD4B Loci are Associated with Reduced Glucose-Stimulated Beta Cell Function in Middle-Aged Danish People. Diabetologia. 53, 1647-1655.

  43. Sikander, A., Rana, S. V., Sharma, S. K., Sinha, S. K., Arora, S. K., Prasad, K. K., and Singh, K. (2010) Association of Alpha 2A Adrenergic Receptor Gene (ADRAlpha2A) Polymorphism with Irritable Bowel Syndrome, Microscopic and Ulcerative Colitis. Clin Chim Acta. 411, 59-63.

  44. Savontaus, E., Fagerholm, V., Rahkonen, O., and Scheinin, M. (2008) Reduced Blood Glucose Levels, Increased Insulin Levels and Improved Glucose Tolerance in alpha2A-Adrenoceptor Knockout Mice. Eur J Pharmacol. 578, 359-364.

  45. Regard, J. B., Kataoka, H., Cano, D. A., Camerer, E., Yin, L., Zheng, Y. W., Scanlan, T. S., Hebrok, M., and Coughlin, S. R. (2007) Probing Cell Type-Specific Functions of Gi in Vivo Identifies GPCR Regulators of Insulin Secretion. J Clin Invest. 117, 4034-4043.

  46. Goldenstein, B. L., Nelson, B. W., Xu, K., Luger, E. J., Pribula, J. A., Wald, J. M., O'Shea, L. A., Weinshenker, D., Charbeneau, R. A., Huang, X., Neubig, R. R., and Doze, V. A. (2009) Regulator of G Protein Signaling Protein Suppression of Galphao Protein-Mediated alpha2A Adrenergic Receptor Inhibition of Mouse Hippocampal CA3 Epileptiform Activity. Mol Pharmacol. 75, 1222-1230.

  47. Lahdesmaki, J., Sallinen, J., MacDonald, E., Kobilka, B. K., Fagerholm, V., and Scheinin, M. (2002) Behavioral and Neurochemical Characterization of Alpha(2A)-Adrenergic Receptor Knockout Mice. Neuroscience. 113, 289-299.

  48. MacMillan, L. B., Hein, L., Smith, M. S., Piascik, M. T., and Limbird, L. E. (1996) Central Hypotensive Effects of the alpha2a-Adrenergic Receptor Subtype. Science. 273, 801-803.