Phenotypic Mutation 'Tootsie' (pdf version)
Allele | Tootsie |
Mutation Type |
missense
|
Chromosome | 11 |
Coordinate | 5,859,150 bp (GRCm39) |
Base Change | A ⇒ T (forward strand) |
Gene |
Gck
|
Gene Name | glucokinase |
Synonym(s) | Gls006, hexokinase 4, HK4, MODY2, Hlb62 |
Chromosomal Location |
5,850,820-5,900,081 bp (-) (GRCm39)
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. Alternative splicing of this gene results in three tissue-specific forms of glucokinase, one found in pancreatic islet beta cells and two found in liver. The protein localizes to the outer membrane of mitochondria. In contrast to other forms of hexokinase, this enzyme is not inhibited by its product glucose-6-phosphate but remains active while glucose is abundant. Mutations in this gene have been associated with non-insulin dependent diabetes mellitus (NIDDM), maturity onset diabetes of the young, type 2 (MODY2) and persistent hyperinsulinemic hypoglycemia of infancy (PHHI). [provided by RefSeq, Apr 2009] PHENOTYPE: Targeted disruption of this gene causes mild hyperglycemia in heterozygous mice and extreme hyperglycemia and embryonic to postnatal lethality in homozygous mice. Hyperglycemic knock-out or ENU-induced mutants may show reduced body weight and liver glycogen level, hepatic steatosis, and glucosuria. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_010292 (variant 1), NM_001287386 (variant 2); MGI:1270854
|
Mapped | Yes |
Amino Acid Change |
Methionine changed to Lysine
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000099984]
[ENSMUSP00000105447]
[ENSMUSP00000105448]
|
AlphaFold |
P52792 |
SMART Domains |
Protein: ENSMUSP00000099984 Gene: ENSMUSG00000041798 AA Change: M139K
Domain | Start | End | E-Value | Type |
Pfam:Hexokinase_1
|
10 |
217 |
4.3e-80 |
PFAM |
Pfam:Hexokinase_2
|
219 |
458 |
1.3e-100 |
PFAM |
|
Predicted Effect |
possibly damaging
PolyPhen 2
Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
(Using ENSMUST00000102920)
|
SMART Domains |
Protein: ENSMUSP00000105447 Gene: ENSMUSG00000041798 AA Change: M139K
Domain | Start | End | E-Value | Type |
Pfam:Hexokinase_1
|
10 |
217 |
1e-79 |
PFAM |
Pfam:Hexokinase_2
|
219 |
458 |
7.8e-101 |
PFAM |
|
Predicted Effect |
possibly damaging
PolyPhen 2
Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
(Using ENSMUST00000109822)
|
SMART Domains |
Protein: ENSMUSP00000105448 Gene: ENSMUSG00000041798 AA Change: M139K
Domain | Start | End | E-Value | Type |
Pfam:Hexokinase_1
|
15 |
216 |
1.9e-74 |
PFAM |
Pfam:Hexokinase_2
|
221 |
455 |
2.2e-79 |
PFAM |
|
Predicted Effect |
possibly damaging
PolyPhen 2
Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
(Using ENSMUST00000109823)
|
Meta Mutation Damage Score |
0.8231 |
Is this an essential gene? |
Essential (E-score: 1.000) |
Phenotypic Category |
Autosomal Dominant |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All Mutations and Alleles(35) : Chemically induced (ENU)(19) Gene trapped(5) Targeted(11)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL01624:Gck
|
APN |
11 |
5853106 |
missense |
possibly damaging |
0.67 |
IGL01647:Gck
|
APN |
11 |
5854472 |
missense |
probably damaging |
0.97 |
IGL03145:Gck
|
APN |
11 |
5859093 |
missense |
probably damaging |
0.99 |
Grahamcracker
|
UTSW |
11 |
5852165 |
missense |
probably damaging |
1.00 |
R0139:Gck
|
UTSW |
11 |
5860370 |
missense |
probably damaging |
1.00 |
R0139:Gck
|
UTSW |
11 |
5859139 |
nonsense |
probably null |
|
R0691:Gck
|
UTSW |
11 |
5856691 |
missense |
probably damaging |
1.00 |
R1829:Gck
|
UTSW |
11 |
5860984 |
missense |
probably damaging |
0.97 |
R1866:Gck
|
UTSW |
11 |
5853253 |
missense |
probably benign |
0.02 |
R1868:Gck
|
UTSW |
11 |
5852165 |
missense |
probably damaging |
1.00 |
R1992:Gck
|
UTSW |
11 |
5856515 |
missense |
probably damaging |
1.00 |
R3885:Gck
|
UTSW |
11 |
5860318 |
missense |
probably damaging |
1.00 |
R4179:Gck
|
UTSW |
11 |
5860295 |
missense |
probably benign |
0.43 |
R4888:Gck
|
UTSW |
11 |
5859150 |
missense |
possibly damaging |
0.63 |
R7034:Gck
|
UTSW |
11 |
5851747 |
missense |
probably damaging |
1.00 |
R7155:Gck
|
UTSW |
11 |
5899705 |
start gained |
probably benign |
|
R7548:Gck
|
UTSW |
11 |
5852040 |
missense |
|
|
R8039:Gck
|
UTSW |
11 |
5860301 |
missense |
probably benign |
0.12 |
R8891:Gck
|
UTSW |
11 |
5851733 |
missense |
probably damaging |
1.00 |
R9100:Gck
|
UTSW |
11 |
5856516 |
missense |
probably damaging |
1.00 |
R9101:Gck
|
UTSW |
11 |
5856516 |
missense |
probably damaging |
1.00 |
R9102:Gck
|
UTSW |
11 |
5856516 |
missense |
probably damaging |
1.00 |
R9116:Gck
|
UTSW |
11 |
5854377 |
missense |
possibly damaging |
0.71 |
R9370:Gck
|
UTSW |
11 |
5852244 |
missense |
possibly damaging |
0.78 |
R9420:Gck
|
UTSW |
11 |
5899553 |
critical splice donor site |
probably null |
|
R9536:Gck
|
UTSW |
11 |
5852307 |
missense |
possibly damaging |
0.92 |
Z1176:Gck
|
UTSW |
11 |
5856526 |
missense |
probably damaging |
1.00 |
Z1177:Gck
|
UTSW |
11 |
5860958 |
missense |
possibly damaging |
0.81 |
|
Mode of Inheritance |
Autosomal Dominant |
Local Stock | |
Repository | |
Last Updated |
2019-09-04 9:41 PM
by Anne Murray
|
Record Created |
2016-12-16 8:19 PM
|
Record Posted |
2018-09-13 |
Phenotypic Description |
The Tootsie phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4888, some of which showed high blood glucose levels 30 minutes after glucose challenge (Figure 1).
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 154 mutations. The hyperglycemia phenotype was linked by continuous variable mapping to a mutation in Gck: a T to A transversion at base pair 5,909,150 (v38) on chromosome 11, or base pair 40,932 in the GenBank genomic region NC_000077 encoding Gck. Linkage was found with an additive/dominant model of inheritance, wherein 10 heterozygous mice departed phenotypically from eight homozygous reference mice with a P value of 3.116 x 10-5 (Figure 2); no homozygous variant mice were observed in pedigree R4888. The mutation corresponds to residue 898 in the mRNA sequence NM_010292 within exon 4 of 10 total exons.
882 CTGGACAAGCATCAGATGAAACACAAGAAACTA
134 -L--D--K--H--Q--M--K--H--K--K--L-
|
The mutated nucleotide is indicated in red. The mutation results in a methionine to lysine substitution at amino acid 139 (M139K) in the GCK protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.633).
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
Glucokinase [GCK; alternatively, hexokinase 4 (HK4)] is a member of the hexokinase family (Figure 3). Alternative splicing of Gck generates three tissue-specific 465-amino acid GCK isoforms: GCK-B1, GCK-B2, and GCK-L1 (1-4). GCK-B1 and GCK-B2 are specific to pancreatic β-cells, while GCK-L1 is specific to the liver. At present, it is unknown whether it is the B1 or B2 isoform (or both) that generate the pancreatic GCK enzymatic activity. The GCK-L1 isoform differs from the GCK-B isoforms within the 16 N-terminal amino acids; the functional significance of the N-terminus of all of the isoforms is unknown. The crystal of GK(Δ1-11) in complex with glucose and compound A, an activator, folded into a large and small subdomain corresponding to amino acids 67-203 and 204-443 in mouse GCK, respectively (5). The large and small subdomains are separated by a deep cleft which forms the active site (5). The Tootsie mutation results in a methionine to lysine substitution at amino acid 139 (M139K) in the GCK protein. M139 is within the GK small subdomain. Please see the record Grahamcracker for more information about Gck.
|
Putative Mechanism | GCK is one of four members of the hexokinase family. In the gut, GCK may promote the secretion of enteroincretins, which are hormones that stimulate a decrease in blood glucose levels (e.g., GLP-1) (6). In the brain, GCK may assist in the regulation of feeding behavior and counter regulatory responses by functioning as a glucose sensor (6;7). In the liver and pancreas, GCK is a component of the ‘glucose sensor’ that regulates plasma glucose levels. Mutations in GCK are linked to gestational diabetes mellitus [OMIM: #125851; (8)], reduced birth rate (9), late onset noninsulin-dependent diabetes mellitus [OMIM: #125853; (10)], permanent neonatal diabetes mellitus [OMIM: #606176; (11-13)], familial hyperinsulinemic hypoglycemia 3 [OMIM: #602485; (14;15)], and type II maturity-onset diabetes of the young [MODY 2 (alternatively, GCK-MODY); OMIM: #125851; (12;16-18)]. All of the above-mentioned conditions are the result of variable degrees of glucose intolerance due to impaired glucose-responsive insulin secretion. Beta cell-specific Gck heterozygous (β-Gck+/-) mice exhibit moderate hyperglycemia and defective insulin secretion in response to glucose (19;20). Pancreatic beta cells from the β-Gck+/- mice exhibited impaired glucose sensitivity that worsened with age (21). β-Gck+/- mice fed a high-fat diet exhibited reduced beta cell replication and beta cell hyperplasia compared to wild-type mice (22). In addition, islets from the β-Gck+/- mice had diminished expression of IRS-2 compared to that in wild-type mice (22). In the liver, GCK function mediates hepatic glucose uptake, the synthesis and subsequent storage of glycogen in the liver, and the regulation of glucose-responsive genes (19;23). Hepatocyte-specific conditional Gck knockout (Liver-Gck-/- ) mice were mildly hyperglycemic, but exhibited defects in glycogen synthesis, glucose turnover rates during hyperglycemic clamp, and impaired insulin secretion in response to glucose (19;24;25). Hepatocyte-specific Gck knockdown in obesity-prone mice attenuated weight gain with a concomitant increase in adaptive thermogenesis (26). Gck knockout (Gck-/-) mice are not viable and die from approximately embryonic day (E) 9 until shortly before birth from severe hyperglycemia (23;27;28). Gck heterozygous (Gck+/-) mice survive, but exhibit reduced islet GCK activity and subsequent elevation in fasting blood glucose levels (27-29). After hyperglycemic clamp, the Gck+/- mice exhibited reduced glucose tolerance and defective liver glucose metabolism (27;29). In addition, Gck+/- mice exhibited reduced fertility, increased levels of plasma corticosterone, increased food intake, and hypothalamic gene expression (e.g., increased hypothalamic neuropeptide Y mRNA and reduced hypothalamic proopiomelanocortin mRNA) (23). ENU-induced mutations in Gck resulted in variable reduced viability, reduced GCK activity, and subsequent impaired glucose-responsive insulin secretion (30-33). Several homozygote ENU-induced models (GckGENA348/GENA348 and GckD217VD217V/D217V) exhibited increased viability (e.g., 5-12 weeks of age) compared to the Gck-/- mice (31;34). However, the ENU-induced mutant Munich GckM210R/M210R mice exhibited growth retardation and perinatal lethality (33). All heterozygote ENU-induced models exhibited elevated plasma glucose levels, impaired glucose tolerance, and reduced glucose-induced insulin secretion compared to wild-type mice (31;33;34). Similar to other ENU-induced mutants, the Tootsie mice exhibit impaired glucose tolerance indicating that the mutation may result in almost complete loss of GCKTootsie function.
|
Primers |
PCR Primer
Tootsie_pcr_F: ACAGTTGCAATCCCCACTCG
Tootsie_pcr_R: GTCCCTAAGAGTGTGGATGAG
Sequencing Primer
Tootsie_seq_F: AATCCCCACTCGGCATGG
Tootsie_seq_R: AAGATGCTCTAAGTGGGAATTTGG
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 417 nucleotides is amplified (chromosome 11, - strand):
1 gtccctaaga gtgtggatga ggggagaaga tgctctaagt gggaatttgg tgaggcagaa 61 ctggagctgc ctcaggggtc aaatgtctta acatctccaa gagacacttt ggtacagttc 121 ctggggagag agaactgcta ctgtcccagc cctgacctaa tgccacactg gtgcaactcc 181 tagctctttg actacatctc tgagtgcatc tctgacttcc tggacaagca tcagatgaaa 241 cacaagaaac tacccctggg cttcaccttc tccttccctg taaggcacga agacatagac 301 aaggtgagca ggtggaggag agaggagatg aatgggtgga aacacttggg aagaactctg 361 ccgagactgc cttcagttgc agctccccaa cccatgccga gtggggattg caactgt
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References | 1. Iynedjian, P. B., Pilot, P. R., Nouspikel, T., Milburn, J. L., Quaade, C., Hughes, S., Ucla, C., and Newgard, C. B. (1989) Differential Expression and Regulation of the Glucokinase Gene in Liver and Islets of Langerhans. Proc Natl Acad Sci U S A. 86, 7838-7842.
5. Kamata, K., Mitsuya, M., Nishimura, T., Eiki, J., and Nagata, Y. (2004) Structural Basis for Allosteric Regulation of the Monomeric Allosteric Enzyme Human Glucokinase. Structure. 12, 429-438.
6. Jetton, T. L., Liang, Y., Pettepher, C. C., Zimmerman, E. C., Cox, F. G., Horvath, K., Matschinsky, F. M., and Magnuson, M. A. (1994) Analysis of Upstream Glucokinase Promoter Activity in Transgenic Mice and Identification of Glucokinase in Rare Neuroendocrine Cells in the Brain and Gut. J Biol Chem. 269, 3641-3654.
7. Zelent, D., Golson, M. L., Koeberlein, B., Quintens, R., van Lommel, L., Buettger, C., Weik-Collins, H., Taub, R., Grimsby, J., Schuit, F., Kaestner, K. H., and Matschinsky, F. M. (2006) A Glucose Sensor Role for Glucokinase in Anterior Pituitary Cells. Diabetes. 55, 1923-1929.
8. Stoffel, M., Bell, K. L., Blackburn, C. L., Powell, K. L., Seo, T. S., Takeda, J., Vionnet, N., Xiang, K. S., Gidh-Jain, M., and Pilkis, S. J. (1993) Identification of Glucokinase Mutations in Subjects with Gestational Diabetes Mellitus. Diabetes. 42, 937-940.
9. Hattersley, A. T., Beards, F., Ballantyne, E., Appleton, M., Harvey, R., and Ellard, S. (1998) Mutations in the Glucokinase Gene of the Fetus Result in Reduced Birth Weight. Nat Genet. 19, 268-270.
10. Katagiri, H., Asano, T., Ishihara, H., Inukai, K., Anai, M., Miyazaki, J., Tsukuda, K., Kikuchi, M., Yazaki, Y., and Oka, Y. (1992) Nonsense Mutation of Glucokinase Gene in Late-Onset Non-Insulin-Dependent Diabetes Mellitus. Lancet. 340, 1316-1317.
11. Njolstad, P. R., Sovik, O., Cuesta-Munoz, A., Bjorkhaug, L., Massa, O., Barbetti, F., Undlien, D. E., Shiota, C., Magnuson, M. A., Molven, A., Matschinsky, F. M., and Bell, G. I. (2001) Neonatal Diabetes Mellitus due to Complete Glucokinase Deficiency. N Engl J Med. 344, 1588-1592.
13. Rowe, R. E., Wapelhorst, B., Bell, G. I., Risch, N., Spielman, R. S., and Concannon, P. (1995) Linkage and Association between Insulin-Dependent Diabetes Mellitus (IDDM) Susceptibility and Markers Near the Glucokinase Gene on Chromosome 7. Nat Genet. 10, 240-242.
14. Thornton, P. S., Satin-Smith, M. S., Herold, K., Glaser, B., Chiu, K. C., Nestorowicz, A., Permutt, M. A., Baker, L., and Stanley, C. A. (1998) Familial Hyperinsulinism with Apparent Autosomal Dominant Inheritance: Clinical and Genetic Differences from the Autosomal Recessive Variant. J Pediatr. 132, 9-14.
15. Glaser, B., Kesavan, P., Heyman, M., Davis, E., Cuesta, A., Buchs, A., Stanley, C. A., Thornton, P. S., Permutt, M. A., Matschinsky, F. M., and Herold, K. C. (1998) Familial Hyperinsulinism Caused by an Activating Glucokinase Mutation. N Engl J Med. 338, 226-230.
16. Byrne, M. M., Sturis, J., Clement, K., Vionnet, N., Pueyo, M. E., Stoffel, M., Takeda, J., Passa, P., Cohen, D., and Bell, G. I. (1994) Insulin Secretory Abnormalities in Subjects with Hyperglycemia due to Glucokinase Mutations. J Clin Invest. 93, 1120-1130.
17. Froguel, P., Zouali, H., Vionnet, N., Velho, G., Vaxillaire, M., Sun, F., Lesage, S., Stoffel, M., Takeda, J., and Passa, P. (1993) Familial Hyperglycemia due to Mutations in Glucokinase. Definition of a Subtype of Diabetes Mellitus. N Engl J Med. 328, 697-702.
18. Froguel, P., Vaxillaire, M., Sun, F., Velho, G., Zouali, H., Butel, M. O., Lesage, S., Vionnet, N., Clement, K., and Fougerousse, F. (1992) Close Linkage of Glucokinase Locus on Chromosome 7p to Early-Onset Non-Insulin-Dependent Diabetes Mellitus. Nature. 356, 162-164.
19. Postic, C., Shiota, M., Niswender, K. D., Jetton, T. L., Chen, Y., Moates, J. M., Shelton, K. D., Lindner, J., Cherrington, A. D., and Magnuson, M. A. (1999) Dual Roles for Glucokinase in Glucose Homeostasis as Determined by Liver and Pancreatic Beta Cell-Specific Gene Knock-Outs using Cre Recombinase. J Biol Chem. 274, 305-315.
20. Terauchi, Y., Sakura, H., Yasuda, K., Iwamoto, K., Takahashi, N., Ito, K., Kasai, H., Suzuki, H., Ueda, O., and Kamada, N. (1995) Pancreatic Beta-Cell-Specific Targeted Disruption of Glucokinase Gene. Diabetes Mellitus due to Defective Insulin Secretion to Glucose. J Biol Chem. 270, 30253-30256.
21. Aizawa, T., Asanuma, N., Terauchi, Y., Suzuki, N., Komatsu, M., Itoh, N., Nakabayashi, T., Hidaka, H., Ohnota, H., Yamauchi, K., Yasuda, K., Yazaki, Y., Kadowaki, T., and Hashizume, K. (1996) Analysis of the Pancreatic Beta Cell in the Mouse with Targeted Disruption of the Pancreatic Beta Cell-Specific Glucokinase Gene. Biochem Biophys Res Commun. 229, 460-465.
22. Terauchi, Y., Takamoto, I., Kubota, N., Matsui, J., Suzuki, R., Komeda, K., Hara, A., Toyoda, Y., Miwa, I., Aizawa, S., Tsutsumi, S., Tsubamoto, Y., Hashimoto, S., Eto, K., Nakamura, A., Noda, M., Tobe, K., Aburatani, H., Nagai, R., and Kadowaki, T. (2007) Glucokinase and IRS-2 are Required for Compensatory Beta Cell Hyperplasia in Response to High-Fat Diet-Induced Insulin Resistance. J Clin Invest. 117, 246-257.
23. Yang, X. J., Mastaitis, J., Mizuno, T., and Mobbs, C. V. (2007) Glucokinase Regulates Reproductive Function, Glucocorticoid Secretion, Food Intake, and Hypothalamic Gene Expression. Endocrinology. 148, 1928-1932.
24. Zhang, Y. L., Tan, X. H., Xiao, M. F., Li, H., Mao, Y. Q., Yang, X., and Tan, H. R. (2004) Establishment of Liver Specific Glucokinase Gene Knockout Mice: A New Animal Model for Screening Anti-Diabetic Drugs. Acta Pharmacol Sin. 25, 1659-1665.
25. Wang, R., Gao, H., Xu, W., Li, H., Mao, Y., Wang, Y., Guo, T., Wang, X., Song, R., Li, Z., Irwin, D. M., Niu, G., and Tan, H. (2013) Differential Expression of Genes and Changes in Glucose Metabolism in the Liver of Liver-Specific Glucokinase Gene Knockout Mice. Gene. 516, 248-254.
26. Tsukita, S., Yamada, T., Uno, K., Takahashi, K., Kaneko, K., Ishigaki, Y., Imai, J., Hasegawa, Y., Sawada, S., Ishihara, H., Oka, Y., and Katagiri, H. (2012) Hepatic Glucokinase Modulates Obesity Predisposition by Regulating BAT Thermogenesis Via Neural Signals. Cell Metab. 16, 825-832.
27. Bali, D., Svetlanov, A., Lee, H. W., Fusco-DeMane, D., Leiser, M., Li, B., Barzilai, N., Surana, M., Hou, H., and Fleischer, N. (1995) Animal Model for Maturity-Onset Diabetes of the Young Generated by Disruption of the Mouse Glucokinase Gene. J Biol Chem. 270, 21464-21467.
28. Grupe, A., Hultgren, B., Ryan, A., Ma, Y. H., Bauer, M., and Stewart, T. A. (1995) Transgenic Knockouts Reveal a Critical Requirement for Pancreatic Beta Cell Glucokinase in Maintaining Glucose Homeostasis. Cell. 83, 69-78.
29. Rossetti, L., Chen, W., Hu, M., Hawkins, M., Barzilai, N., and Efrat, S. (1997) Abnormal Regulation of HGP by Hyperglycemia in Mice with a Disrupted Glucokinase Allele. Am J Physiol. 273, E743-50.
30. Fenner, D., Odili, S., Hong, H. K., Kobayashi, Y., Kohsaka, A., Siepka, S. M., Vitaterna, M. H., Chen, P., Zelent, B., Grimsby, J., Takahashi, J. S., Matschinsky, F. M., and Bass, J. (2011) Generation of N-Ethyl-N-Nitrosourea (ENU) Diabetes Models in Mice Demonstrates Genotype-Specific Action of Glucokinase Activators. J Biol Chem. 286, 39560-39572.
31. Toye, A. A., Moir, L., Hugill, A., Bentley, L., Quarterman, J., Mijat, V., Hough, T., Goldsworthy, M., Haynes, A., Hunter, A. J., Browne, M., Spurr, N., and Cox, R. D. (2004) A New Mouse Model of Type 2 Diabetes, Produced by N-Ethyl-Nitrosourea Mutagenesis, is the Result of a Missense Mutation in the Glucokinase Gene. Diabetes. 53, 1577-1583.
32. Inoue, M., Sakuraba, Y., Motegi, H., Kubota, N., Toki, H., Matsui, J., Toyoda, Y., Miwa, I., Terauchi, Y., Kadowaki, T., Shigeyama, Y., Kasuga, M., Adachi, T., Fujimoto, N., Matsumoto, R., Tsuchihashi, K., Kagami, T., Inoue, A., Kaneda, H., Ishijima, J., Masuya, H., Suzuki, T., Wakana, S., Gondo, Y., Minowa, O., Shiroishi, T., and Noda, T. (2004) A Series of Maturity Onset Diabetes of the Young, Type 2 (MODY2) Mouse Models Generated by a Large-Scale ENU Mutagenesis Program. Hum Mol Genet. 13, 1147-1157.
33. van Burck, L., Blutke, A., Kautz, S., Rathkolb, B., Klaften, M., Wagner, S., Kemter, E., Hrabe de Angelis, M., Wolf, E., Aigner, B., Wanke, R., and Herbach, N. (2010) Phenotypic and Pathomorphological Characteristics of a Novel Mutant Mouse Model for Maturity-Onset Diabetes of the Young Type 2 (MODY 2). Am J Physiol Endocrinol Metab. 298, E512-23.
34. van Buerck, L., Schuster, M., Rathkolb, B., Sabrautzki, S., Hrabe de Angelis, M., Wolf, E., Aigner, B., Wanke, R., and Herbach, N. (2012) Enhanced Oxidative Stress and Endocrine Pancreas Alterations are Linked to a Novel Glucokinase Missense Mutation in ENU-Derived Munich Gck(D217V) Mutants. Mol Cell Endocrinol. 362, 139-148.
|
Science Writers | Anne Murray |
Illustrators | Katherine Timer |
Authors | Emre Turer and Bruce Beutler |