Phenotypic Mutation 'pam_gray'

• Allele: pam_gray
• Mutation Type: intron
• Chromosome: 3
• Coordinate: 20,017,173 bp (GRCm38)
• Base Change: A ⇒ T (forward strand)
• Gene: Hps3
• Gene Name: HPS3, biogenesis of lysosomal organelles complex 2 subunit 1
• Synonym(s): Hermansky-Pudlak syndrome 3
• Chromosomal Location: 20,050,109-20,089,478 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a potential clathrin-binding motif, consensus dileucine signals, and tyrosine-based sorting signals for targeting to vesicles of lysosomal lineage. The encoded protein may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 3. [provided by RefSeq, Apr 2015] ; PHENOTYPE: Homozygotes for spontaneous null mutations exhibit hypopigmentation and prolonged bleeding associated with a platelet defect. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q91VB4
• SMART Domains: Protein: ENSMUSP00000012580; Gene: ENSMUSG00000027615

Domain	Start	End	E-Value	Type
Pfam:HPS3_N	3	212	2.8e-74	PFAM
Pfam:HPS3_Mid	255	640	1.3e-167	PFAM
Pfam:HPS3_C	649	1000	1.8e-175	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000103957; Gene: ENSMUSG00000027615

Domain	Start	End	E-Value	Type
Pfam:HPS3_N	3	87	5.6e-25	PFAM
Pfam:HPS3_Mid	121	508	4.2e-161	PFAM
Pfam:HPS3_C	517	870	9.2e-199	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.072)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• Last Updated: 2016-10-11 6:15 PM by Bruce Beutler
• Record Created: unknown
• Record Posted: 2008-07-23
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Owen Siggs, Amanda L. Blasius, Bruce Beutler

Accession Number

NCBI RefSeq: NM_080634; MGI: 2153839

Alleles Listed at MGI

All alleles(7) : Spontaneous(6) Chemically induced(1)

Repository

none

Phenotypic Description

Pam gray was initially identified among N-ethyl-N-nitrosourea (ENU)-induced G3 animals as a hypopigmentation mutant (Figure 1). Pam gray homozygous animals have a gray coat, display normal MCMV resistance (see MCMV Susceptibility and Resistance Screen), and do not have any Toll-like receptor (TLR) signaling defects (see TLR Signaling Screen). Pam grey is allelic to cocoa (1). A second mutant with gray coat color, designated earl grey, was isolated independently as a descendant of the same ENU-mutagenized G0 male that gave rise to pam gray.  However, earl grey arose from a different G1 male founder than pam gray.  The Hps3 mutation found in pam gray was ultimately identified in earl grey.

Nature of Mutation

The pam gray mutation was mapped to Chromosome 3, and corresponds to a T to A transversion at position 1815 of the Hps3 transcript, in exon 10 of 17 total exons.

 

1797 AGTGAATCACAGAAATATGAGAGAGGACTAGTA

595  -S--E--S--Q--K--Y--E--R--G--L--V-

 

The mutated nucleotide is indicated in red lettering, and creates a premature stop codon at position 600 of the reading frame (normally a tyrosine) deleting 403 amino acids from the C-terminus of the protein.

Protein Prediction

Mouse Hps3 encodes a 113.1 kDa protein of 1002 amino acids (1).  The translated protein products of mouse Hps3 and its human homolog are 80% identical. The human protein is 113.7 kDa in molecular mass and 1004 amino acids long (2).  HPS3 forms part of the biogenesis of lysosome-related organelle complex 2 (BLOC-2; see Figure 2 and Background).

Figure 1. A, Predicted domains of HPS3. HPS3 contains a putative clathrin-binding (CB) motif, two consensus dileucine-based sorting motifs and an endoplasmic reticulum (ER) membrane retention signal. Amino acid locations are based on the human protein. The location of the pam gray mutation is indicated in red. Image is interactive: click to see other mutations in Hps3 (red indicates phenotypic mutations; green are incidental mutations). B, Components of the biogenesis of lysosomal-related organelle complex 2 (BLOC-2). All three proteins have been shown to co-immunoprecipitate, but only HSP5 and HSP6 bind together in two-hybrid studies suggesting the presence of unknown components of the complex (?).

The HPS3 protein is unrelated to any other known proteins, and contains a possible tyrosine phosphorylation site at codon 295 (1).  The human HPS3 protein is predicted to be 43% α-helix, 19% extended strand, 30% random coil, and 7% β-turn.  Human HPS3 contains a clathrin-binding motif at residues 172 to 176 (LLDFE), 2 consensus dileucine signals (GEKAELL, residues 542-548 and LEPRLLI, residues 711-717), and 12 tyrosine-based sorting signals for targeting to vesicles of lysosomal lineage (2-5).  Clathrin is the main component of protein coats that assist in the formation of vesicles budding from the trans-Golgi network (TGN), plasma membrane, and endosomes, and form clathrin triskelions composed of three heavy chains and three light chains (6).  The clathrin-binding motif is also found in the β subunits of the adaptor protein complexes (see record for bullet gray), and has been shown to be sufficient for binding to the amino terminal domain of the clathrin heavy chain (3).  Human HPS3 also contains a potential endoplasmic reticulum membrane retention signal (KKPL, residues 1000-1003) similar to dilysine motifs present in the carboxy-terminal regions of type Ia membrane proteins that traffic between the endoplasmic reticulum and the Golgi apparatus (7).  Although not always identical, most of these motifs have been conserved in the mouse protein (1;2;8).  A peroxisomal matrix targeting signal (RLDSQHSHL) is found at residues 565-574 of the human protein, but this motif is not conserved in the mouse and may not be significant due to its location in the middle of the protein. This motif is known to function in the amino-terminus of peroxisomal matrix proteins (9). 

 

The pam gray mutation results in protein truncation after amino acid 599.  The truncated protein would retain the clathrin-binding motif and most of the tyrosine-based sorting signals, but it is unknown whether this protein is expressed and localizes appropriately.

Expression/Localization

Northern blot analysis in humans demonstrated a 4.4 kb message in all tissues tested, including heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas.  Expression was greatest in kidney, with strong bands in liver and placenta (2).

 

In mice, Northern blot analysis indicates a 4.0 kb transcript is expressed in all mouse tissues and cell types tested, including heart, brain, spleen, liver, lung, kidney and testis.  Expression is very low in skeletal muscle (1).

 

Because HPS6, another member of the BLOC-2 complex, can be immunoprecipitated from both membrane-associated and soluble fractions of cell lysates, it has been inferred that all components of the BLOC-2 complex, including HPS3, may be both cytosolic and membrane-associated (10).  A FLAG-tagged HPS3 protein transfected into NIH3 and a melanocyte cell line was found in a cytoplasmic distribution with a somewhat reticular appearance and slight perinuclear concentration.  The tagged protein did not colocalize with markers of the endoplasmic reticulum, vesicles and organelles, or the TGN and endosomes (1).  Another study using transfected GFP-tagged HPS3 found that the tagged protein partially co-localized with clathrin predominantly on small vesicles in the perinuclear region following a low-temperature block (8).

Background

Hermansky-Pudlak syndrome (HPS; OMIM #203300) is a disorder with an array of clinical symptoms that are caused by alterations at numerous independent loci.  HPS is commonly characterized by oculocutaneous albinism (OCA), prolonged bleeding, and lysosomal hyposecretion.  In addition, subsets of patients exhibit pulmonary fibrosis, immunodeficiency, and inner-ear abnormalities.  Most of these conditions are known to arise from defects in the biogenesis and/or function of lysosome-related organelles, such as melanosomes and platelet dense granules (11).  These organelles are cell-type specific modifications of the post-Golgi endomembrane system, and may share various characteristics with lysosomes, such as integral membrane proteins and an acidic intralumenal pH (12).  At least eight types of human HPS have been described, and mutations affecting at least 15 loci in mice create HPS-like disease.  The human HPS loci and their mouse equivalents are as follows: HPS1/pale ear (13); HPS2/pearl (14); HPS3/cocoa (2); HPS4/light ear (15); HPS5/ruby-eye 2 (16); HPS6/ruby-eye (16); HPS7/sandy (17); and HPS8/reduced pigmentation (18).  

 

Most of the genes associated with HPS encode subunits of protein complexes involved in intracellular trafficking, and are important for the trafficking of lysosomes, lysosomal-related organelles or components of these organelles.  Based on biochemical studies, it has been proposed that HPS proteins assemble into four stable complexes, BLOCs (biogenesis of lysosome-related organelle complex) 1, 2, and 3, and the adaptor protein 3 (AP-3) complex (Figure 2).  Mutation of the β3A subunit of the AP-3 complex causes HPS2 (19-22) (mutated in bullet gray).  The following components make up the 200-230 kD BLOC-1 complex: pallidin, dysbindin (HPS7; mutated in salt and pepper), BLOC subunit 1 (BLOS1), BLOS2, BLOS3 (HPS8), cappuccino, muted (mutated in minnie), and snapin.  The proteins HPS3, HPS5 (mutated in toffee and dorian gray), and HPS6 (mutated in stamper-coat) comprise BLOC-2 (350 kD) (10;16;23). BLOC-3 (175 kD) is composed of HPS1 and HPS4 (9;24).  

 

All of the BLOC-2 components cause HPS in humans and HPS-like disease in mice. While all HPS patients suffer from OCA and prolonged bleeding, different subtypes of HPS are now recognized by their distinct clinical features.  HPS3 patients exhibit a mild form of HPS, with mild oculocutaneous albinism and prolonged bleeding, but no other symptoms (2;25).  Mild forms of HPS also occur in HPS5 and HPS6 patients (2;16;26).  Similarly, ruby-eye (ru), ruby-eye 2 (ru2), and cocoa (coa) mice, with mutations in Hps6, Hps5, and Hps3 respectively, all have very similar to identical phenotypes (16;23;27;28).  Coa mice are characterized by a diluted coat color that darkens with age, light eyes that darken with age to a ruby or maroon color, and platelet storage pool deficiency that causes prolonged bleeding time.  Although platelet numbers are normal, platelets are unable to accumulate dense granule contents resulting in decreased serotonin (28).  In a melanocyte line derived from coa mice, little pigment is observed and melanosomes are reduced in number, small, abnormally shaped, and immature (1).  Similar findings are observed in vivo in melanosomes of the retinal pigment epithelia (RPE) and choroids of the eye (1;23).  In cultured melanocytes derived from human HPS3 patients, melanosomes were immature and unpigmented, but otherwise morphologically normal (29).  Unlike ru and ru2 mice, coa mice have normal secretion of lysosomal enzymes from kidney proximal tubule cells and platelets, suggesting that the HPS3 protein is necessary for melanosomes and platelet dense granules but not lysosomes (28;30).  This result suggests that HPS5 and HPS6 may function independently of HPS3 in some contexts.

 

Several lines of evidence suggest that HPS3, HPS5 and HPS6 are components of the BLOC-2 complex.  All three proteins coimmunoprecipitate, while in yeast two-hybrid experiments HPS6 was found to bind HPS5 (10;16;23).  Similar interactions were not found for HPS3 in these studies, suggesting the presence of additional, unknown components of the complex (16;23).  Double homozygous combinations of Hps3, Hps5, and Hps6 animals exhibited identical phenotypes to each other and to single homozygotes.  Furthermore, HPS6 and HPS5 proteins are destabilized in protein extracts derived from mice mutated in Hps3, Hps5, and Hps6, but are not destabilized in protein extracts derived from other HPS mouse models (23).

Putative Mechanism

The precise molecular function of the BLOC-2 complex remains unknown.  In addition to a yet undefined role in regulating lysosome-related organelle secretion, recent studies suggest that both HPS3 and HPS5 may also regulate protein trafficking during the maturation of melanosomes (29;31;32).  Both tyrosinase (mutated in ghost) and Tyrp1 (tyrosinase-related protein 1) are reduced in HPS5 mutant melanocyte dendrites as measured by immunofluorescence and immunoelectron microscopy (32).  In HPS3 mutant melanocytes, tyrosinase, Tyrp1, and Tyrp2 (tyrosinase-related protein 2) were mislocalized, as were the lysosome associated membrane proteins, LAMP1 and LAMP3 (29;31).  In addition, HPS3, HPS5, and HPS6 mutant melanosomes are predominantly in the early stages of maturation, suggesting that improper trafficking of melanosome proteins impairs the normal maturation of this organelle (1;16;29;32).  In agreement with this hypothesis, BLOC-1 has been shown to physically interact with BLOC-2 to facilitate Tyrp1 trafficking (33).  Another study demonstrates that BLOC-1 regulates Tyrp1 exit from early endosomes toward melanosomes, but interestingly, BLOC-2 affects Tyrp1 trafficking to melanosomes from an endosomal compartment distinct and downstream from that regulated by BLOC-1 (34). Furthermore, HPS3 is able to bind to clathrin through its clathrin-binding domain (8).  Thus, accumulating evidence suggests a role for BLOC-2 in regulating selective cargo trafficking from endosomes to melanosomes.  The step(s) at which BLOC-2 functions and the compartments between which cargo is transferred remain to be more precisely defined. 

 

Mutations in some HPS proteins cause immunodeficiency.  For example, in HPS2, mutation of the β3A subunit of the AP-3 complex results in immunodeficiency because of defects in natural killer (NK) cells, cytotoxic T lymphocytes (CTLs) and neutrophils (see bullet gray) (19-22). However, BLOC-1 complex mutant mice pallid, muted and sandy have normal CTL function, as measured by ability to kill targets (35), and patients with HPS7 and HPS8 do not display any immunological defects (17;18).  These results contrast with the MCMV susceptibility and impaired NK cell cytotoxicity of the salt and pepper mutation, which is allelic to sandy.  A similar NK cell defect has been reported for pallid mice (36).  These results are similar to mixed immunological phenotypes seen in mice and patients mutant in BLOC-2 components.  HPS3/5/6 patients do not exhibit immunological defects and ru mice display normal CTL activity (2;16;25;26;35), consistent with the normal MCMV resistance seen in pam gray and stamper-coat mice.  However, toffee mice defective in HPS5 are susceptible to infection by MCMV or Listeria monocytogenes, and ru mice are reported to have an increase in transient fusion events at the plasma membrane of mast cells, resulting in a depletion of secretory products (37).  It is likely this defect also causes the decreased quantities of intragranular components of platelet dense granules seen in Hps3, Hps5, and Hps6 mutants (28;38).

 

Mouse mutants of BLOC-2 components typically have milder pigmentation defects than other HPS mouse models, consistent with the milder phenotypes seen in patients with HPS3, HPS5 and HPS6 (2;16;23;25;26).  It is possible the truncated HPS3 protein in pam gray mice may retain some function as the clathrin-binding site is retained.  However, the coa^5J and the coa^6J mutation both result in alterations of the HPS3 gene in exon 10, similar to pam gray.  The coa^5J mutation is a nonsense mutation at codon 627, while coa^6J is an antisense insertion of an intracisternal A particle (IAP) transposable element into exon 10.  These mutants display identical phenotypes to the original coa mutation, which abolishes the 3’ splice site of intron 14 and uses a cryptic splice site in exon 15.  The aberrant coa mRNA produced by this splicing was nearly undetectable in all tissues, suggesting that the coa mutant does not express any HPS3 protein (1). 

Primers

Primers cannot be located by automatic search.

Genotyping

Pam gray genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  The KAPA2G Fast DNA polymerase was needed using the KAPA2G Fast HotStart kit from KAPABIOSYSTEMS.

 

Primers for PCR amplification

Pam(F): 5’- AGGCATATTAAGGTCAATCGAGTTTTGTATTTCTGAGAACCA -3’

Pam(R): 5’- GGACGTTGAAAATAGGGCACATGGAGTTATGGG -3’

 

PCR program

1) 95°C             1:00

2) 95°C             0:10

3) 56°C             0:10

4) 72°C             0:15

5) repeat steps (2-4) 40X

6) 72°C             2:00

7) 4°C               ∞

 

Primers for sequencing

Pam_seq(F1): 5’- GACAGCTCTCCAGTTCTGAGAATC -3’

Pam_seq(F2): 5’- CGCCTTGCCGTACTATAAGATG -3’

 

The following sequence of 1694 nucleotides (from Genbank genomic region NC_000069 for linear DNA sequence of Hps3) is amplified:

 

19893                                    aggcatat taaggtcaat cgagttttgt
19921 atttctgaga accatttttt ttaaattttg tattgattct ttgtgcattt catgtcacgc
19981 actctaatcc cctcatcgcc ctgtcccttc acacccactc ccccccaaaa gaaacaaaca
20041 aaataaaaca aaaaaaatcc acaaaaataa cacaaaacat ctcttcatgg aagctctagt
20101 gtatcccagt gtgtcacaca gtgtacactt ttgtctacac atctttactt gtaaatgttt
20161 attacagcca ggcatggtga tgcacacctt taatcccagc actcgggggg caggggcagg
20221 ggcaggggca ggggcagggg caggggcagg ggcatttctg agtttgaggc cagcctggtc
20281 tacagagtga gtttcaggac atcccagggc tacacagaga aaccctgtct caaaaaaaaa
20341 aaaaccaaat aatgtttatt gcagtgagta attggcatgt gcgacagtat gaacactgca
20401 tgctcaccgg tctgatctcc tgttgtggcc ctgtgtcaga agatcctgaa gctttggatc
20461 tgctgaacca gccccttcac aaggtccatt acttcataga tgaggtagat gttggagcgg
20521 tccaacatct gtatctgccc tgggtctagt tggcagctgg gttggtcagc ctgccaaagc
20581 tgtcccacac cctcacaacc agagccagca ctgtcctggc tagctcaccc agtgctgcag
20641 caggtaagga cccaggccag ctctcctgct ctcctgccct cagggccagc cacactgtgc
20701 tgcccaggtg aagggcgggg ctggcttctc ctcagtgcta taggtgctga gggccaggga
20761 cagctctcca gttctgagaa tcatgcttat agaatttttg tagacagtgt atcataggct
20821 tacttcacct gtgtaagaga ttgtcgatga ctgagatgag gtagactata aatgccattt
20881 ataatattaa atattaatga atgattgctt ttctaccttt gatatgctca ggaaaaatgc
20941 tactgagagt ggctttataa aagtcaagct gtgaggctta tgcctttgaa aagtgtgatc
21001 tgttttatta cttactgtgt taagtagctg ccacacaaat gcacatttga agccctttaa
21061 catttctctc tctctaggct taccactgag caatcccatc tcgccttgcc gtactataag
21121 atgtctggtt tgtctctggc tgaagtcttg gcccgtgtgg actggacaga agagagtgaa
21181 tcacagaaat atgagagagg actagtattt tatattaatc attctcttta tgaaaacctg
21241 gatgaagaat taagtaaagt gaatataatt ttctataaag ttatagcttc tctttttaac
21301 ttttagtagt atttagaatt taagttccaa aattttcttt tttttttttc ctgaaaaaat
21361 tagcatgccc tttacttctt taatggtctt agaattatag cttggaaaag aatttaggtg
21421 tgactttccc atgtgtcctt agtattcagc atggaggcta ttgtggctga ggggcctgcc
21481 caggcacagt gagatctatt ctcaagtgaa gacagaatgc tggtccctgc cttcctctgc
21541 agtatgtttt ttccccataa ctccatgtgc cctattttca acgtcc

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References

   1.  Suzuki, T., Li, W., Zhang, Q., Novak, E. K., Sviderskaya, E. V., Wilson, A., Bennett, D. C., Roe, B. A., Swank, R. T., and Spritz, R. A. (2001) The gene mutated in cocoa mice, carrying a defect of organelle biogenesis, is a homologue of the human Hermansky-Pudlak syndrome-3 gene, Genom. 78, 30-37.

   2.  Anikster, Y., Huizing, M., White, J., Shevchenko, Y. O., Fitzpatrick, D. L., Touchman, J. W., Compton, J. G., Bale, S. J., Swank, R. T., Gahl, W. A., and Toro, J. R. (2001) Mutation of a new gene causes a unique form of Hermansky-Pudlak syndrome in a genetic isolate of central Puerto Rico, Nat. Genet. 28, 376-380.  

   3.  Dell'angelica, E. C., Klumperman, J., Stoorvogel, W., and Bonifacino, J. S. (1998) Association of the AP-3 adaptor complex with clathrin, Science 280, 431-434.

   4.  Honing, S., Sandoval, I. V., and von, F. K. (1998) A di-leucine-based motif in the cytoplasmic tail of LIMP-II and tyrosinase mediates selective binding of AP-3, EMBO J. 17, 1304-1314.

   5.  Ohno, H., Fournier, M. C., Poy, G., and Bonifacino, J. S. (1996) Structural determinants of interaction of tyrosine-based sorting signals with the adaptor medium chains, J Biol. Chem. 271, 29009-29015.

   6.  Schmid, S. L. (1997) Clathrin-coated vesicle formation and protein sorting: an integrated process, Annu. Rev. Biochem. 66, 511-548.

   7.  Teasdale, R. D. and Jackson, M. R. (1996) Signal-mediated sorting of membrane proteins between the endoplasmic reticulum and the golgi apparatus, Annu. Rev. Cell Dev. Biol. 12, 27-54.

   8.  Helip-Wooley, A., Westbroek, W., Dorward, H., Mommaas, M., Boissy, R. E., Gahl, W. A., and Huizing, M. (2005) Association of the Hermansky-Pudlak syndrome type-3 protein with clathrin, BMC. Cell Biol. 6, 33.

   9.  McNew, J. A. and Goodman, J. M. (1996) The targeting and assembly of peroxisomal proteins: some old rules do not apply, Trends Biochem. Sci. 21, 54-58.

 10.  Di Pietro, S. M., Falcon-Perez, J. M., and Dell'angelica, E. C. (2004) Characterization of BLOC-2, a complex containing the Hermansky-Pudlak syndrome proteins HPS3, HPS5 and HPS6, Traffic. 5, 276-283.

 11.  Di Pietro, S. M. and Dell'angelica, E. C. (2005) The cell biology of Hermansky-Pudlak syndrome: recent advances, Traffic. 6, 525-533.

 12.  Cutler, D. F. (2002) Introduction: lysosome-related organelles, Semin. Cell Dev. Biol. 13, 261-262.

 13.  Oh, J., Bailin, T., Fukai, K., Feng, G. H., Ho, L., Mao, J. I., Frenk, E., Tamura, N., and Spritz, R. A. (1996) Positional cloning of a gene for Hermansky-Pudlak syndrome, a disorder of cytoplasmic organelles, Nat. Genet. 14, 300-306.

 14.  Dell'angelica, E. C., Shotelersuk, V., Aguilar, R. C., Gahl, W. A., and Bonifacino, J. S. (1999) Altered trafficking of lysosomal proteins in Hermansky-Pudlak syndrome due to mutations in the beta 3A subunit of the AP-3 adaptor, Mol. Cell 3, 11-21.

 15.  Suzuki, T., Li, W., Zhang, Q., Karim, A., Novak, E. K., Sviderskaya, E. V., Hill, S. P., Bennett, D. C., Levin, A. V., Nieuwenhuis, H. K., Fong, C. T., Castellan, C., Miterski, B., Swank, R. T., and Spritz, R. A. (2002) Hermansky-Pudlak syndrome is caused by mutations in HPS4, the human homolog of the mouse light-ear gene, Nat. Genet. 30, 321-324.

 16.  Zhang, Q., Zhao, B., Li, W., Oiso, N., Novak, E. K., Rusiniak, M. E., Gautam, R., Chintala, S., O'Brien, E. P., Zhang, Y., Roe, B. A., Elliott, R. W., Eicher, E. M., Liang, P., Kratz, C., Legius, E., Spritz, R. A., O'Sullivan, T. N., Copeland, N. G., Jenkins, N. A., and Swank, R. T. (2003) Ru2 and Ru encode mouse orthologs of the genes mutated in human Hermansky-Pudlak syndrome types 5 and 6, Nat. Genet. 33, 145-153.

 17.  Li, W., Zhang, Q., Oiso, N., Novak, E. K., Gautam, R., O'Brien, E. P., Tinsley, C. L., Blake, D. J., Spritz, R. A., Copeland, N. G., Jenkins, N. A., Amato, D., Roe, B. A., Starcevic, M., Dell'angelica, E. C., Elliott, R. W., Mishra, V., Kingsmore, S. F., Paylor, R. E., and Swank, R. T. (2003) Hermansky-Pudlak syndrome type 7 (HPS-7) results from mutant dysbindin, a member of the biogenesis of lysosome-related organelles complex 1 (BLOC-1), Nat. Genet. 35, 84-89.

 18.  Morgan, N. V., Pasha, S., Johnson, C. A., Ainsworth, J. R., Eady, R. A., Dawood, B., McKeown, C., Trembath, R. C., Wilde, J., Watson, S. P., and Maher, E. R. (2006) A germline mutation in BLOC1S3/reduced pigmentation causes a novel variant of Hermansky-Pudlak syndrome (HPS8), Am. J Hum. Genet. 78, 160-166.

 19.  Kotzot, D., Richter, K., and Gierth-Fiebig, K. (1994) Oculocutaneous albinism, immunodeficiency, hematological disorders, and minor anomalies: a new autosomal recessive syndrome?, Am. J. Med. Genet. 50, 224-227.

 20.  Jung, J., Bohn, G., Allroth, A., Boztug, K., Brandes, G., Sandrock, I., Schaffer, A. A., Rathinam, C., Kollner, I., Beger, C., Schilke, R., Welte, K., Grimbacher, B., and Klein, C. (2006) Identification of a homozygous deletion in the AP3B1 gene causing Hermansky-Pudlak syndrome, type 2, Blood 108, 362-369.

 21.  Huizing, M., Scher, C. D., Strovel, E., Fitzpatrick, D. L., Hartnell, L. M., Anikster, Y., and Gahl, W. A. (2002) Nonsense mutations in ADTB3A cause complete deficiency of the beta3A subunit of adaptor complex-3 and severe Hermansky-Pudlak syndrome type 2, Pediatr. Res. 51, 150-158.

 22.  Enders, A., Zieger, B., Schwarz, K., Yoshimi, A., Speckmann, C., Knoepfle, E. M., Kontny, U., Muller, C., Nurden, A., Rohr, J., Henschen, M., Pannicke, U., Niemeyer, C., Nurden, P., and Ehl, S. (2006) Lethal hemophagocytic lymphohistiocytosis in Hermansky-Pudlak syndrome type II, Blood 108, 81-87.

 23.  Gautam, R., Chintala, S., Li, W., Zhang, Q., Tan, J., Novak, E. K., Di Pietro, S. M., Dell'angelica, E. C., and Swank, R. T. (2004) The Hermansky-Pudlak syndrome 3 (cocoa) protein is a component of the biogenesis of lysosome-related organelles complex-2 (BLOC-2), J Biol. Chem. 279, 12935-12942.

 24.  Martina, J. A., Moriyama, K., and Bonifacino, J. S. (2003) BLOC-3, a protein complex containing the Hermansky-Pudlak syndrome gene products HPS1 and HPS4, J Biol. Chem. 278, 29376-29384.

 25.  Huizing, M., Anikster, Y., Fitzpatrick, D. L., Jeong, A. B., D'Souza, M., Rausche, M., Toro, J. R., Kaiser-Kupfer, M. I., White, J. G., and Gahl, W. A. (2001) Hermansky-Pudlak syndrome type 3 in Ashkenazi Jews and other non-Puerto Rican patients with hypopigmentation and platelet storage-pool deficiency, Am. J Hum. Genet 69, 1022-1032.

 26.  Huizing, M., Hess, R., Dorward, H., Claassen, D. A., Helip-Wooley, A., Kleta, R., Kaiser-Kupfer, M. I., White, J. G., and Gahl, W. A. (2004) Cellular, molecular and clinical characterization of patients with Hermansky-Pudlak syndrome type 5, Traffic. 5, 711-722.

 27.  Silvers, W. K. (1979) The Coat Colors of Mice.

 28.  Novak, E. K., Sweet, H. O., Prochazka, M., Parentis, M., Soble, R., Reddington, M., Cairo, A., and Swank, R. T. (1988) Cocoa: a new mouse model for platelet storage pool deficiency, Br. J Haematol. 69, 371-378.

 29.  Boissy, R. E., Richmond, B., Huizing, M., Helip-Wooley, A., Zhao, Y., Koshoffer, A., and Gahl, W. A. (2005) Melanocyte-specific proteins are aberrantly trafficked in melanocytes of Hermansky-Pudlak syndrome-type 3, Am. J Pathol. 166, 231-240.

 30.  Novak, E. K., Wieland, F., Jahreis, G. P., and Swank, R. T. (1980) Altered secretion of kidney lysosomal enzymes in the mouse pigment mutants ruby-eye, ruby-eye-2-J, and maroon, Biochem. Genet. 18, 549-561.

 31.  Richmond, B., Huizing, M., Knapp, J., Koshoffer, A., Zhao, Y., Gahl, W. A., and Boissy, R. E. (2005) Melanocytes derived from patients with Hermansky-Pudlak Syndrome types 1, 2, and 3 have distinct defects in cargo trafficking, J Invest Dermatol. 124, 420-427.

 32.  Helip-Wooley, A., Westbroek, W., Dorward, H. M., Koshoffer, A., Huizing, M., Boissy, R. E., and Gahl, W. A. (2007) Improper trafficking of melanocyte-specific proteins in Hermansky-Pudlak syndrome type-5, J Invest Dermatol. 127, 1471-1478.

 33.  Di Pietro, S. M., Falcon-Perez, J. M., Tenza, D., Setty, S. R., Marks, M. S., Raposo, G., and Dell'angelica, E. C. (2006) BLOC-1 interacts with BLOC-2 and the AP-3 complex to facilitate protein trafficking on endosomes, Mol. Biol. Cell 17, 4027-4038.

 34.  Setty, S. R., Tenza, D., Truschel, S. T., Chou, E., Sviderskaya, E. V., Theos, A. C., Lamoreux, M. L., Di Pietro, S. M., Starcevic, M., Bennett, D. C., Dell'angelica, E. C., Raposo, G., and Marks, M. S. (2007) BLOC-1 is required for cargo-specific sorting from vacuolar early endosomes toward lysosome-related organelles, Mol. Biol. Cell 18, 768-780.

 35.  Bossi, G., Booth, S., Clark, R., Davis, E. G., Liesner, R., Richards, K., Starcevic, M., Stinchcombe, J., Trambas, C., Dell'angelica, E. C., and Griffiths, G. M. (2005) Normal lytic granule secretion by cytotoxic T lymphocytes deficient in BLOC-1, -2 and -3 and myosins Va, VIIa and XV, Traffic. 6, 243-251.

 36.  Orn, A., Hakansson, E. M., Gidlund, M., Ramstedt, U., Axberg, I., Wigzell, H., and Lundin, L. G. (1982) Pigment mutations in the mouse which also affect lysosomal functions lead to suppressed natural killer cell activity, Scand. J Immunol. 15, 305-310.

 37.  Oberhauser, A. F. and Fernandez, J. M. (1996) A fusion pore phenotype in mast cells of the ruby-eye mouse, Proc. Natl. Acad. Sci. U. S A 93, 14349-14354.

 38.  Reddington, M., Novak, E. K., Hurley, E., Medda, C., McGarry, M. P., and Swank, R. T. (1987) Immature dense granules in platelets from mice with platelet storage pool disease, Blood 69, 1300-1306.

39.  Wei, M. L. (2006) Hermansky-Pudlak syndrome: a disease of protein trafficking and organelle function, Pigment Cell Res. 19, 19-42.