Phenotypic Mutation 'rollo' (pdf version)
List |< first << previous [record 15 of 30] next >> last >|
Allelerollo
Mutation Type nonsense
Chromosome1
Coordinate52,153,923 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Stat1
Gene Name signal transducer and activator of transcription 1
Synonym(s) 2010005J02Rik
Chromosomal Location 52,119,440-52,161,865 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein can be activated by various ligands including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. This protein mediates the expression of a variety of genes, which is thought to be important for cell viability in response to different cell stimuli and pathogens. Two alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are largely unresponsive to interferon, fail to thrive, are susceptible to viral diseases and cutaneous leishmaniasis, and show excess osteoclastogenesis leading to increased bone mass. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001205313 (variant 1), NM_009283 (variant 2), NM_001205314 (variant 3); MGI:103063

Mapped Yes 
Limits of the Critical Region 52119440 - 52161865 bp
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000066743] [ENSMUSP00000141132] [ENSMUSP00000140518] [ENSMUSP00000140875] [ENSMUSP00000140482] [ENSMUSP00000141125] [ENSMUSP00000139746]
SMART Domains Protein: ENSMUSP00000066743
Gene: ENSMUSG00000026104
AA Change: Y651*

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 139 315 1.4e-56 PFAM
Pfam:STAT_bind 317 566 4.2e-82 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 2.4e-17 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000141132
Gene: ENSMUSG00000026104
AA Change: Y657*

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 136 315 3.4e-65 PFAM
Pfam:STAT_bind 317 573 3.9e-118 PFAM
SH2 577 693 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 721 745 2.3e-16 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000140518
Gene: ENSMUSG00000026104
AA Change: Y651*

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000140875
Gene: ENSMUSG00000026104
AA Change: Y651*

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 136 315 1.2e-64 PFAM
Pfam:STAT_bind 317 567 4.4e-121 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 3.1e-15 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000140482
Gene: ENSMUSG00000026104
AA Change: Y145*

DomainStartEndE-ValueType
Pfam:STAT_bind 13 61 2.6e-14 PFAM
SH2 65 181 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 209 233 7.8e-16 PFAM
Predicted Effect probably null
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000141125
Gene: ENSMUSG00000026104
AA Change: Y651*

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000139746
Gene: ENSMUSG00000026104
AA Change: Y651*

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
fasting hyperglycemia (female)
NK cell response - decreased 12370359
NK killing - decreased 12370359
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(23) : Chemically induced (ENU)(4) Chemically induced (other)(1) Radiation induced(1) Targeted(17)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Stat1 APN 1 52122595 start codon destroyed probably null 0.50
IGL01111:Stat1 APN 1 52142961 critical splice donor site probably null
IGL01451:Stat1 APN 1 52139343 missense probably damaging 1.00
IGL01469:Stat1 APN 1 52147370 missense possibly damaging 0.87
IGL01758:Stat1 APN 1 52136921 missense probably damaging 1.00
IGL01818:Stat1 APN 1 52151278 missense probably damaging 1.00
IGL01913:Stat1 APN 1 52126557 missense probably benign 0.08
IGL01914:Stat1 APN 1 52126557 missense probably benign 0.08
IGL02304:Stat1 APN 1 52132544 missense probably benign
IGL02428:Stat1 APN 1 52142966 splice site probably benign
domino UTSW 1 52140588 missense probably damaging 1.00
poison UTSW 1 52151225 splice acceptor site probably benign
roccoco UTSW 1 52123209 missense probably damaging 1.00
special UTSW 1 52139264 missense probably damaging 1.00
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0039:Stat1 UTSW 1 52140660 missense probably damaging 0.99
R0458:Stat1 UTSW 1 52149052 splice site probably benign
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R2998:Stat1 UTSW 1 52151249 missense probably benign 0.01
R4464:Stat1 UTSW 1 52137416 missense possibly damaging 0.52
R4709:Stat1 UTSW 1 52126521 missense probably damaging 0.97
R4934:Stat1 UTSW 1 52153923 nonsense probably null
R5038:Stat1 UTSW 1 52123209 missense probably damaging 1.00
R5075:Stat1 UTSW 1 52122712 missense possibly damaging 0.73
R5223:Stat1 UTSW 1 52144242 missense probably damaging 1.00
R5600:Stat1 UTSW 1 52148942 missense probably benign 0.06
R5866:Stat1 UTSW 1 52139264 missense probably damaging 1.00
X0027:Stat1 UTSW 1 52139271 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-03-29 12:49 PM by Diantha La Vine
Record Created 2016-12-30 2:27 PM by Evan Nair-Gill
Record Posted 2017-09-15
Phenotypic Description

Figure 1. Rollo mice exhibited decreased ability to kill beta-2-microglobulin deficient cells (NK cell targets) compared to heterozygous or reference mice. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The rollo phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4934 some of which showed reduced ability to kill beta-2-microglobulin deficient cells (NK cell targets) compared to heterozygous or reference mice (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced NK cell target killing using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 132 mutations (X-axis) identified in the G1 male of pedigree R4934. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 132 mutations. The NK killing phenotype was linked by continuous variable mapping to two mutations on chromosome 1: Col3a1 and Stat1. The mutation in Stat1 was presumed causative, and is a C to A transversion at base pair 52,153,923 (v38) on chromosome 1, or base pair 34,486 in the GenBank genomic region NC_000067 encoding Stat1. Linkage was found with a recessive model of inheritance, wherein four variant homozygotes departed phenotypically from nine homozygous reference mice and six heterozygous mice with a P value of 8.137 x 10-10 (Figure 2).  

 

The mutation corresponds to residue 2,270 in the mRNA sequence NM_001205313 within exon 22 of 25 total exons.

 

2253 GATATTATTCGCAACTACAAAGTCATGGCTGCC

646  -D--I--I--R--N--Y--K--V--M--A--A-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of tyrosine 651 for a premature stop codon (Y651*) in the STAT1 protein (Figure 3).

Protein Prediction
Figure 3. 3D and domain structure of the STAT1 protein. A) 3D representation of STAT1 based on crystalized structures of human STAT1 residues 1-683 (PDB 1YVL). The residue affected by the domino mutation is shown in red. 3D image was created using UCSF Chimera. B) Domain structure of STAT1. CC=Coiled Coil domain; DBD = DNA binding domain; LD = Linker domain; SH2=Src Homology 2 domain; TAD = Transcriptional activation domain. The critical tyrosine phosphorylation site is found at amino acid 701. The rollo mutation substitution of tyrosine 651 for a premature stop codon (Y651*) . This image is interactive. Other mutations found in STAT1 are noted in red. Click on the mutations for more specific information. Click on the 3D structure to view it rotate. 

Signal transducer and activator of transcription (STAT)-1 is one of seven STAT family members identified in mammals. The STAT proteins serve the dual functions of signal transduction and activation of transcription. STAT1 is a 755 amino acid protein, and like all STATs, contains an N-terminal helical domain (N-domain), a four helix bundle, a central Ig-like DNA binding domain, a helical linker domain, an SH2 domain, and a C-terminal transactivation domain (TAD) (Figure 3).

 

The rollo mutation results in substitution of tyrosine 651 for a premature stop codon (Y651*) in the STAT1 protein; amino acid 651 is within the SH2 domain.

 

Please see the record for domino for more information about Stat1.

Putative Mechanism

The STAT proteins are transcription factors found latent in the cytoplasm until they are activated by extracellular signaling proteins such as cytokines, growth factors and peptides. Stimulation by these extracellular signaling proteins leads to activation of intracellular tyrosine kinases that in turn phosphorylate STATs, causing them to move into the nucleus and activate transcription of target genes. STAT1 is required for IFN signaling.  NK cell function is enhanced by IFNs, and Stat1-/- NK cells have impaired cytotoxicity relative to wild type NK cells (1)Stat1-/- mice have no gross developmental abnormalities, but are highly sensitive to bacterial and viral infections such as Listeria monocytogenes and VSV infection (2;3). Cells from these mice are unresponsive to IFN-α and IFN-γ, although they respond normally to several other stimuli including EGF and interleukin 10 (2;3). In humans, rare STAT1 deficiency and several STAT1 point mutations have been identified in patients with recurrent bacterial and/or viral infections (4-6). Cells from these patients fail to respond to IFN-α or IFN-γ. Interestingly, one patient with complete STAT1 deficiency was able to clear at least some viruses including polio virus type III (from vaccination) and parainfluenza type II (6).

 

The phenotype observed in the rollo mice indicates loss of STAT1rollo function.

Primers PCR Primer
rollo(F):5'- TTAAAGCAGGAGTGTGATGCC -3'
rollo(R):5'- AACTTGTCTGGGAGCCATGG -3'

Sequencing Primer
rollo_seq(F):5'- AAAGTATGGCAGGCTCTCTG -3'
rollo_seq(R):5'- TCTGGGAGCCATGGAGCAC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine, Peter Jurek, Katherine Timer
AuthorsEvan Nair-Gill, Bruce Beutler
List |< first << previous [record 15 of 30] next >> last >|