Allele | puny | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 30,712,377 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | A ⇒ G (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Ntmt1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | N-terminal Xaa-Pro-Lys N-methyltransferase 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Mettl11a, 2610205E22Rik | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 30,697,838-30,713,045 bp (+) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The METTL11A gene encodes an N-terminal methyltransferase for the RAN (MIM 601179) guanine nucleotide exchange factor regulator of chromosome condensation 1 (RCC1; MIM 179710). METTL11A enzyme alpha-N-methylates other protein targets such as SET (MIM 600960) and RB (MIM 180200).[supplied by OMIM, Nov 2010] PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality and premature death associated with premature aging, decreased body size and weight, skin thinning, liver degeneration, increased sensitivity to oxidative stress and female infertility. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Histidine changed to Arginine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000035303] [ENSMUSP00000142189] [ENSMUSP00000123140] [ENSMUSP00000141222] [ENSMUSP00000141905] [ENSMUSP00000116760] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q8R2U4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000035303 Gene: ENSMUSG00000026857 AA Change: H140R
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000142189 Gene: ENSMUSG00000026857
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000123140 Gene: ENSMUSG00000026857
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000141222 Gene: ENSMUSG00000026857
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000141905 Gene: ENSMUSG00000026857
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000116760 Gene: ENSMUSG00000026857 AA Change: H140R
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.8580 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Possibly nonessential (E-score: 0.371) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:41 PM by Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2017-01-05 2:46 PM | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2018-08-08 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The puny phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2859 some of which showed reduced body weights compared to wild-type littermates (Figure 1). |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 40 mutations. The body weight phenotype was linked to two mutations on chromosome 2: Setx and Ntmt1. The mutation in Ntmt1 was presumed causative, and is an A to G transversion at base pair 30,822,365 (v38) on chromosome 2, or base pair 12,924 in the GenBank genomic region NC_000068 encoding Ntmt1. Linkage was found with a recessive model of inheritance, wherein four variant homozygotes departed phenotypically from 11 homozygous reference mice and 24 heterozygous mice with a P value of 3.673 x 10-12 (Figure 2). The mutation corresponds to residue 568 in the mRNA sequence NM_170592 within exon 4 of 4 total exons.
The mutated nucleotide is indicated in red. The mutation results in a histidine to arginine substitution at amino acid 140 (H140R) in the NTMT1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.995). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Ntmt1 encodes N-terminal Xaa-Pro-Lys N-methyltransferase 1 [NTMT1; alternatively, NRMT1 or METTL11A]. NTMT1 does not have defined domains, regions, or repeats. NTMT1 folds as a single domain [Figure 3; PDB:5CVE,(1); PDB:5E2B,(2)]. NTMT1 folds in a canonical S-adenosyl-L-methionine-dependent methyltransferase (SAM-MTase) Rossman fold with a seven-stranded β-sheet sandwiched by five flanking α-helices (1;2). Three helices [two α-helixes (α1 and α2) and one 310 helix (η1)] from the N-terminus and a pair of β-hairpins insert between β5 and α7 of the core domain. The β-hairpins and N-terminal extension promote substrate specificity (2). NTMT1 cofactors bind NTMT1 in an extended conformation, and a conserved DxGxGxG motif in NTMT1 surrounds the ribosyl and methionyl moieties of the cofactor (2). The carboxylate moiety of the cofactor forms a salt bridge with Arg74, and the ribosyl group stacks with the indole ring of Trp20 (2). The NTMT1 substrate binds to a negatively charged channel of NTMT1 that is connected to the cofactor-binding pocket (2). The substrate peptide inserts into the channel with the α-N-amino group pointing toward the methyl group of the cofactor to accept the methyl transfer (2). The puny mutation results in a histidine to arginine substitution at amino acid 140 (H140R) in the NTMT1 protein. His140 is within α6. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | Ntmt1 is ubiquitously expressed (NCBI). NTMT1 expression is often reduced in non-small cell lung carcinoma, breast cancer, glioblastoma, and leukemia [(3-5); reviewed in (6)], but NTMT1 was overexpressed in several colon cancer samples (7;8). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
NTMT1 functions in N-terminal α-methylation, a highly conserved posttranslational modification that regulates protein-DNA interactions. N-terminal α-methylation is necessary for both accurate mitotic division (i.e., spindle assembly and chromosome segregation), nucleotide excision repair, and signal transduction (9;10). In N-terminal α-methylation, the initiator methionine is cleaved and the exposed α-amino group is mono-, di-, or trimethylated by NTMT1 (Figure 4). NTMT1 catalyzes the transfer of a methyl group from the cofactor S-adenosyl-l-methionine (SAM; alternatively, AdoMet) to the protein target’s α-amine. NTMT1 target proteins have an N-terminal methylation motif (M)XPK [(Met)[Ala/Pro/Ser]-Pro-Lys] (9). NTMT1 also recognizes (with variable methylation efficiencies) peptides that do not contain the canonical XPK motif (i.e., X is Gly, Phe, Tyr, Cys, Met, Lys, Arg, Asn, Gln or His), indicating potentially broad substrate specificity (11). Several NTMT1 target proteins are listed in Table 1 (1;9-11). Table 1. Select NTMT1 targets
NTMT1 also functions as a tumor suppressor in breast cancer cells; loss of NTMT1 expression sensitizes cells to DNA damage and causes increased proliferation, cell invasion, and migration (6;17). Conversely, NTMT1 putatively functions as an oncogene in colon cancer (7;8). Mutations in NRMT1 have been identified in lung cancer (Q144H), endometrial cancer (N209I), and lung cancer (P211S) (1). Most Ntmt1-deficient mice (Ntmt1tm1(NCOM)Mfgc/tm1(NCOM)Mfgc) exhibit premature death by approximately three months of age; 40% of the mice die by one month of age (18). The surviving female mice exhibit infertility with small ovaries, absent corpus luteum, and ovary cysts, but male mice exhibit normal fertility (18). The skin of the Ntmt1-deficient mice is thin, with an increase in the appearance of skin fibrosis (18). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | Ntmt1-deficient mice have reduced body weights and kyphosis (18). The reduced body weight phenotype observed in the puny mice indicates loss of NTMT1 function. The puny mice did not exhibit premature death, indicating that some NTMT1 function is retained. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer puny_pcr_F: GGCACCCAGTCAGCTTAAATC puny_pcr_R: AGACATGGTAGATCTCATCTGGC Sequencing Primer puny_seq_F: AGTCAGCTTAAATCCCAGCTTCTG puny_seq_R: GTAGATCTCATCTGGCAGGTTCTC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 401 nucleotides is amplified (chromosome 2, + strand): 1 ggcacccagt cagcttaaat cccagcttct gactctgctt ttgtgtggat aacgtcagaa Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Emre Turer and Bruce Beutler |