Phenotypic Mutation 'creeper'

• Allele: creeper
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 122,538,826 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Aicda
• Gene Name: activation-induced cytidine deaminase
• Synonym(s): Aid
• Chromosomal Location: 122,530,768-122,541,139 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RNA-editing deaminase that is a member of the cytidine deaminase family. The protein is involved in somatic hypermutation, gene conversion, and class-switch recombination of immunoglobulin genes. Defects in this gene are the cause of autosomal recessive hyper-IgM immunodeficiency syndrome type 2 (HIGM2). [provided by RefSeq, Feb 2009] ; PHENOTYPE: Homozygous mutation of this gene results in elevated IgM levels and impairment of B cell class switching. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 122553801 - 122564180 bp
• Amino Acid Change: Valine changed to Isoleucine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000040524] [ENSMUSP00000125093]
• AlphaFold: Q9WVE0
• SMART Domains: Protein: ENSMUSP00000040524; Gene: ENSMUSG00000040627; AA Change: V152I

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	11	178	4.6e-66	PFAM
Pfam:APOBEC_C	120	171	1.8e-23	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000043301)
• SMART Domains: Protein: ENSMUSP00000125093; Gene: ENSMUSG00000040627; AA Change: V14I

Domain	Start	End	E-Value	Type
Pfam:APOBEC_C	1	35	6.3e-17	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000160685)
• Meta Mutation Damage Score: 0.9310
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:41 PM by Anne Murray
• Record Created: 2017-01-05 9:13 PM by Jin Huk Choi
• Record Posted: 2018-07-18
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Tao Yue, Jin Huk Choi, James Butler, Bruce Beutler

Accession Number

NCBI RefSeq: NM_009645; MGI:1342279

Alleles Listed at MGI

All Mutations and Alleles(18) : Targeted(16) Transgenic(2)

Phenotypic Description

Figure 1. Creeper mice exhibited an increase in the OVA-specific IgE to total IgE ratio . IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Creeper mice exhibited a decrease in total IgE levels in the serum . IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Creeper mice exhibited a decrease in total IgE levels seven days after second OVA/Alum challenge . IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Homozygous creeper mice exhibit diminished T-dependent IgG responses to OVA/alum. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Homozygous creeper mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The creeper phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5000, some of which showed an increase in the ratio of OVA-specific IgE to total IgE levels (Figure 1) due to decrease in total IgE levels in the serum (Figure 2). Some mice also showed a decrease in total IgE levels seven days after second OVA/Alum challenge (Figure 3). The T-dependent antibody responses to ovalbumin administered with aluminum hydroxide (Figure 4) and to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) were also diminished (Figure 5). 

Nature of Mutation

Figure 6. Linkage mapping of the normalized T-dependent antibody response to rSFV-β-gal using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 96 mutations (X-axis) identified in the G1 male of pedigree R5000. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 96 mutations. All of the above phenotypes were linked by continuous variable mapping to three genes on chromosome 6: Usp18, Aicda, and Atf7ip. The mutation in Aicda was presumed causative due to its known effects on immunology, and is a G to A transition at base pair 122,561,867 (v38) on chromosome 6, or base pair 8,059 in the GenBank genomic region NC_000072 encoding Aicda. The strongest association was found with a recessive model of inheritance to the normalized T-dependent antibody response to rSFV-β-gal, wherein three variant homozygous mice departed phenotypically from 10 homozygous reference and 16 heterozygous mice with a P value of 1.701 x 10^-12 (Figure 6).  

The mutation corresponds to residue 547 in the mRNA sequence NM_009645 within exon 4 of 5 total exons.

532 TGCTGGAATACATTTGTAGAAAATCGTGAAAGA 147 -C--W--N--T--F--V--E--N--R--E--R-

The mutated nucleotide is indicated in red. The mutation results in a valine to isoleucine substitution at residue 152 (V152I) in the AICDA protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999).

Protein Prediction

Figure 7. Domain organization of AID. The location of the creeper mutation is indicated. Mutations found in AID are noted in red. Click on each mutation to view more information.

Activation-induced cytidine deaminase (AID) is a member of the polynucleotide deaminase families, which also includes the APOBEC enzymes. The AID/APOBEC proteins share a characteristic zinc coordination motif at the core of the catalytic site (1).

AID has a bipartite nuclear localization signal (amino acids 1 to 30), a catalytic domain (amino acids 56 to 94), an APOBEC-like domain (amino acids 112 to 184), CMP/dCMP-type deaminase domain (amino acids 23 to 129), and a nuclear export signal (amino acid 183 to 190) [reviewed in (2)]. The catalytic domain contains Glu58, which serves as a general acid-base catalyst. The catalytic domain also contains His56, Cys87, and Cys90, which bind zinc and are required for catalytic activity. The APOPBEC-like domain binds DNA surrounding cytosines to be deaminated and influences substrate specificity. Amino acids 13 to 26 mediate DNA binding. Amino acids 113 to 123 constitute the hotspot recognition loop (corresponding to loop 7; see below), which dictates substrate specificity (3;4). Several regions of AID are required for protein-protein interactions.

The creeper mutation results in a valine to isoleucine substitution at residue 152 (V152I) in the AICDA protein. Amino acid 152 is within the APOBEC-like domain.

Please see the record bellezza for more information about Aicda.

Putative Mechanism

AID is a single-stranded (ss) DNA-specific cytidine deaminase expressed in germinal center B cells that functions in class-switch recombination, somatic hypermutation, and gene conversion of immunoglobulin genes in B cells (5-7). In all processes, AID deaminates cytosines, converting them to uracils. The uracil conversion results in U:G mismatch DNA lesions that are converted into point mutations during SHM and into DNA double-stranded breaks (DSBs) during CSR or aberrant chromosomal translocations.

Mutations in human AICDA are linked to type 2 immunodeficiency with hyper-IgM (HIGM2; OMIM: #605258; (8)), which is characterized by normal or elevated serum IgM levels with absence of IgG, IgA, and IgE. HIGM2 patients exhibit increased susceptibility to bacterial infections. When acting off-target, AID can also generate non-Ig genomic mutations, which cause B-cell lymphoma or leukemia (9;10).

Aicda deficient mice exhibit reduced class switch recombination to IgG1 and IgG3 as well as reduced somatic hypermutation frequency in Peyer’s patch B cells (11). Mice carrying a knock-in point mutation in Aicda had much less SHM but had normal amounts of immunoglobulin in both serum and intestinal secretions (12). In addition, the knock-in mice had absent class switching in B cells as well as defects in IgG1 and IgG3 CSR (13). 

Primers

PCR Primer
creeper_pcr_F: TCAGAGAGATGGTTCCGTGG
creeper_pcr_R: GGGTTGTAAGTGCCTTGAAGTAATC

Sequencing Primer
creeper_seq_F: TTCCGTGGGGGCCCTTG
creeper_seq_R: TAACTAAGAGGCTCCAGGTGTGTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 468 nucleotides is amplified (chromosome 6, + strand):

1   tcagagagat ggttccgtgg gggcccttgc ctttgtacct taagtttaac ccctaaaaca
61  ctctgacttt ctgaccttca cctacacaca cacacacaca cacacacaca cacacacaca
121 cacctccttc ttatttatct atttattttt cttttaagac tatttttact gctggaatac
181 atttgtagaa aatcgtgaaa gaactttcaa agcctgggaa gggctacatg aaaattctgt
241 ccggctaacc agacaacttc ggcgcatcct tttggtaagt ctgcctgtct gtctgcctgt
301 ctctctgtct gtctctgtct ctctgtctgt ctctgtctct ctctctctct ctcatacaca
361 cacacataca tacactcaca cacacacaca cacacctgga gcctcttagt tatttgtttg
421 tattatgcat tattttatac aatgattact tcaaggcact tacaaccc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Conticello, S. G., Langlois, M. A., Yang, Z., and Neuberger, M. S. (2007) DNA Deamination in Immunity: AID in the Context of its APOBEC Relatives. Adv Immunol. 94, 37-73.

  2. Zan, H., and Casali, P. (2013) Regulation of Aicda Expression and AID Activity. Autoimmunity. 46, 83-101.

  3. Wang, M., Rada, C., and Neuberger, M. S. (2010) Altering the Spectrum of Immunoglobulin V Gene Somatic Hypermutation by Modifying the Active Site of AID. J Exp Med. 207, 141-153.

  4. Kohli, R. M., Abrams, S. R., Gajula, K. S., Maul, R. W., Gearhart, P. J., and Stivers, J. T. (2009) A Portable Hot Spot Recognition Loop Transfers Sequence Preferences from APOBEC Family Members to Activation-Induced Cytidine Deaminase. J Biol Chem. 284, 22898-22904.

  5. Petersen, S., Casellas, R., Reina-San-Martin, B., Chen, H. T., Difilippantonio, M. J., Wilson, P. C., Hanitsch, L., Celeste, A., Muramatsu, M., Pilch, D. R., Redon, C., Ried, T., Bonner, W. M., Honjo, T., Nussenzweig, M. C., and Nussenzweig, A. (2001) AID is Required to Initiate Nbs1/gamma-H2AX Focus Formation and Mutations at Sites of Class Switching. Nature. 414, 660-665.

  6. Okazaki, I. M., Kinoshita, K., Muramatsu, M., Yoshikawa, K., and Honjo, T. (2002) The AID Enzyme Induces Class Switch Recombination in Fibroblasts. Nature. 416, 340-345.

  7. Yoshikawa, K., Okazaki, I. M., Eto, T., Kinoshita, K., Muramatsu, M., Nagaoka, H., and Honjo, T. (2002) AID Enzyme-Induced Hypermutation in an Actively Transcribed Gene in Fibroblasts. Science. 296, 2033-2036.

  8. Revy, P., Muto, T., Levy, Y., Geissmann, F., Plebani, A., Sanal, O., Catalan, N., Forveille, M., Dufourcq-Labelouse, R., Gennery, A., Tezcan, I., Ersoy, F., Kayserili, H., Ugazio, A. G., Brousse, N., Muramatsu, M., Notarangelo, L. D., Kinoshita, K., Honjo, T., Fischer, A., and Durandy, A. (2000) Activation-Induced Cytidine Deaminase (AID) Deficiency Causes the Autosomal Recessive Form of the Hyper-IgM Syndrome (HIGM2). Cell. 102, 565-575.

  9. Pasqualucci, L., Bhagat, G., Jankovic, M., Compagno, M., Smith, P., Muramatsu, M., Honjo, T., Morse, H. C.,3rd, Nussenzweig, M. C., and Dalla-Favera, R. (2008) AID is Required for Germinal Center-Derived Lymphomagenesis. Nat Genet. 40, 108-112.

  10. Robbiani, D. F., and Nussenzweig, M. C. (2013) Chromosome Translocation, B Cell Lymphoma, and Activation-Induced Cytidine Deaminase. Annu Rev Pathol. 8, 79-103.

  11. Cheng, H. L., Vuong, B. Q., Basu, U., Franklin, A., Schwer, B., Astarita, J., Phan, R. T., Datta, A., Manis, J., Alt, F. W., and Chaudhuri, J. (2009) Integrity of the AID Serine-38 Phosphorylation Site is Critical for Class Switch Recombination and Somatic Hypermutation in Mice. Proc Natl Acad Sci U S A. 106, 2717-2722.

  12. Wei, M., Shinkura, R., Doi, Y., Maruya, M., Fagarasan, S., and Honjo, T. (2011) Mice Carrying a Knock-in Mutation of Aicda Resulting in a Defect in Somatic Hypermutation have Impaired Gut Homeostasis and Compromised Mucosal Defense. Nat Immunol. 12, 264-270.

  13. Muramatsu, M., Kinoshita, K., Fagarasan, S., Yamada, S., Shinkai, Y., and Honjo, T. (2000) Class Switch Recombination and Hypermutation Require Activation-Induced Cytidine Deaminase (AID), a Potential RNA Editing Enzyme. Cell. 102, 553-563.