Phenotypic Mutation 'rigged2'

• Allele: rigged2
• Mutation Type: missense
• Chromosome: 14
• Coordinate: 30,321,700 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Prkcd
• Gene Name: protein kinase C, delta
• Synonym(s): PKC[d], D14Ertd420e, Pkcd, PKCdelta
• Chromosomal Location: 30,317,311-30,348,167 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. Studies both in human and mice demonstrate that this kinase is involved in B cell signaling and in the regulation of growth, apoptosis, and differentiation of a variety of cell types. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a null allele exhibit decreased neutrophil cell numbers and activity, increased B cell numbers and proliferation, increased acute inflammation, and increased IgG1 and IgA serum levels. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000022521] [ENSMUSP00000107821] [ENSMUSP00000107822] [ENSMUSP00000107825] [ENSMUSP00000107826] [ENSMUSP00000107829] [ENSMUSP00000107830]
• AlphaFold: P28867
• PDB Structure: PROTEIN KINASE C DELTA CYS2 DOMAIN [X-RAY DIFFRACTION] ; PROTEIN KINASE C DELTA CYS2 DOMAIN COMPLEXED WITH PHORBOL-13-ACETATE [X-RAY DIFFRACTION] ; Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase Cdelta [X-RAY DIFFRACTION] ; Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase Cdelta [X-RAY DIFFRACTION] ; Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase Cdelta [X-RAY DIFFRACTION] ; Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase C delta [X-RAY DIFFRACTION] ; Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase C delta [X-RAY DIFFRACTION] ; Structural and functional characterization of an anesthetic binding site in the second cysteine-rich domain of protein kinase C delta [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000022521; Gene: ENSMUSG00000021948; AA Change: L498P

Domain	Start	End	E-Value	Type
C2	11	100	1.28e0	SMART
C1	159	208	1.38e-13	SMART
C1	231	280	3.19e-18	SMART
S_TKc	373	627	1.17e-97	SMART
S_TK_X	628	691	8.92e-25	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000022521)
• SMART Domains: Protein: ENSMUSP00000107821; Gene: ENSMUSG00000021948; AA Change: L383P

Domain	Start	End	E-Value	Type
C1	44	93	1.38e-13	SMART
C1	116	165	3.19e-18	SMART
S_TKc	258	512	1.17e-97	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000112202)
• SMART Domains: Protein: ENSMUSP00000107822; Gene: ENSMUSG00000021948; AA Change: L357P

Domain	Start	End	E-Value	Type
C1	44	93	1.38e-13	SMART
C1	116	165	3.19e-18	SMART
S_TKc	232	486	1.17e-97	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000112203)
• SMART Domains: Protein: ENSMUSP00000107825; Gene: ENSMUSG00000021948; AA Change: L383P

Domain	Start	End	E-Value	Type
C1	44	93	1.38e-13	SMART
C1	116	165	3.19e-18	SMART
S_TKc	258	512	1.17e-97	SMART
S_TK_X	513	576	8.92e-25	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000112206)
• SMART Domains: Protein: ENSMUSP00000107826; Gene: ENSMUSG00000021948; AA Change: L357P

Domain	Start	End	E-Value	Type
C1	44	93	1.38e-13	SMART
C1	116	165	3.19e-18	SMART
S_TKc	232	486	1.17e-97	SMART
S_TK_X	487	550	8.92e-25	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000112207)
• SMART Domains: Protein: ENSMUSP00000107827; Gene: ENSMUSG00000021948; AA Change: L472P

Domain	Start	End	E-Value	Type
C2	11	100	1.28e0	SMART
C1	159	208	1.38e-13	SMART
C1	231	280	3.19e-18	SMART
S_TKc	347	601	1.17e-97	SMART
S_TK_X	602	665	8.92e-25	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000112208)
• SMART Domains: Protein: ENSMUSP00000107829; Gene: ENSMUSG00000021948; AA Change: L472P

Domain	Start	End	E-Value	Type
C2	11	100	1.28e0	SMART
C1	159	208	1.38e-13	SMART
C1	231	280	3.19e-18	SMART
S_TKc	347	601	1.17e-97	SMART
S_TK_X	602	665	8.92e-25	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000112210)
• SMART Domains: Protein: ENSMUSP00000107830; Gene: ENSMUSG00000021948; AA Change: L498P

Domain	Start	End	E-Value	Type
C2	11	100	1.28e0	SMART
C1	159	208	1.38e-13	SMART
C1	231	280	3.19e-18	SMART
S_TKc	373	627	1.17e-97	SMART
S_TK_X	628	691	8.92e-25	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000112211)
• Meta Mutation Damage Score: 0.9738
• Is this an essential gene?: Possibly nonessential (E-score: 0.420)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:41 PM by Anne Murray
• Record Created: 2017-01-20 9:33 AM
• Record Posted: 2018-07-18
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001310682 (variant 1), NM_011103 (variant 2); MGI:97598

Alleles Listed at MGI

All Mutations and Alleles(11) : Gene trapped(2) Targeted(8) Transgenic(1)

Phenotypic Description

Figure 1. Rigged2 mice exhibited susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 days post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Rigged2 mice exhibited susceptibility to dextran sodium sulfate (DSS)-induced colitis at 10 days post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The rigged2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4849, some of which showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 (Figure 1) and 10 days (Figure 2) post-DSS treatment.

Nature of Mutation

Figure 3. Linkage mapping of the DSS susceptibility phenotype (day 10) using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 90 mutations (X-axis) identified in the G1 male of pedigree R4849. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 90 mutations. The DSS susceptibility phenotype was linked by continuous variable mapping to a mutation in Prkcd: a T to C transition at base pair 30,599,743 (v38) on chromosome 14, or base pair 26,672 in the GenBank genomic region NC_000080 encoding Prkcd. The strongest association was found with a recessive model of inheritance to the day 10 DSS phenotype, wherein two variant homozygotes departed phenotypically from 19 homozygous reference mice and 23 heterozygous mice with a P value of 3.5 x 10^-7 (Figure 3).  

The mutation corresponds to residue 1,501 in the mRNA sequence NM_001310682 within exon 14 of 17 total exons and to residue 1,668 in the mRNA sequence NM_011103 within exon 15 of 18 total exons.

25236 ATTATTTACAGGGACCTCAAGCTGGACAATGTG 493 -I--I--Y--R--D--L--K--L--D--N--V- (NP_001297611) 467 -I--I--Y--R--D--L--K--L--D--N--V- (NP_035233)

Genomic numbering corresponds to NC_000080. The mutated nucleotide is indicated in red. The mutation results in a leucine to proline substitution at position 498 (L498P) in variant 1 of the PRKCD protein and a L472P substitution in variant 2 of the PRKCD protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 4. Domain organization of PRKCD. The location of the rigged2 mutation is indicated. Orange ovals represent phosphorylation sites. Additional mutations found in PRKCD are noted in red. Click on each mutation for more information.

Prkcd encodes PKCδ, a member of the protein kinase C (PKC) family of serine-threonine kinases. PKC kinases share certain structural features including a highly conserved catalytic domain consisting of motifs required for ATP-substrate binding and catalysis, and a regulatory domain that maintains the enzyme in an inactive conformation. The regulatory and catalytic domains are attached to each other by a hinge region. Similar to other members of the PKC family (see the record for celina [Prkcq] and Untied [Prkcb]), PKCδ has a C2-like domain, two tandem cysteine-rich zinc finger C1 domains (C1a and C1b), a kinase (C3/C4) domain, and a AGC-kinase C-terminal domain (Figure 4).

The rigged2 mutation results in a leucine to proline substitution at position 498 (L498P) in variant 1 of the PKCδ protein and a L472P substitution in variant 2 of the PKCδ protein; the residues are within the kinase domain of both isoforms.

Please see the record rigged for more information about Prkcd.

Putative Mechanism

PKCs are involved in receptor desensitization, modulating membrane structure events, regulating transcription, mediating immune responses, regulating cell growth, and in learning and memory. Members of the PKC family play important roles in signaling for various growth factors, cytokines, and hormones including those involved in the regulation of cell growth, apoptosis, and differentiation of hematopoietic cells. 

PKCδ functions in B-cell receptor-mediated signaling. Engagement of the BCR initiates receptor aggregation, resulting in activation of receptor-associated Src-family kinases, as well as Syk and Bruton’s tyrosine kinase (Btk)/Tec family kinases. These initial events facilitate the recruitment and activation of additional kinases and adaptor proteins within membrane raft microdomains leading to the formation of a mature BCR ‘signalosome’ and promoting the full activation of several downstream signaling cascades including the generation of the second messengers DAG and IP₃. Soluble IP₃ and membrane-bound DAG initiate downstream signal transduction pathways involving Ca²⁺ and PKC isoforms, respectively. These, together with additional signal transduction cascades, lead to the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), NF-κB and activator protein 1, which subsequently regulate biological responses including cell proliferation, differentiation and apoptosis, as well as the secretion of antigen-specific antibodies.

Mutations in PRKCD are linked to autoimmune lymphoproliferative syndrome, type III (ALPS3; OMIM: #615559; (1-3)). ALPS3 patients exhibit variable phenotypes, but most have lymphadenopathy associated with variable autoimmune manifestations. Some patients may have recurrent infections. Lymphocyte accumulation results from a combination of impaired apoptosis and excessive proliferation.

Prkcd-deficient (Prkcd^-/-) mice are viable, but often develop autoimmune disease as well as enlarged lymph nodes and spleens with multiple germinal centers (4). Prkcd^-/- mice have increased numbers of IgM+ B cells in the spleen and lymph nodes, but normal numbers of splenic and peritoneal CD5+ B cells (4;5). The number of neutrophils in the cerebral cortex and striatum of the Prkcd^-/- mice was reduced compared to wild-type mice (6). The levels of IgG1, IgM, and IgA were elevated in the serum from the mice (4;5;7). Some mice exhibited reduced glucose-stimulated insulin secretion compared to wild-type mice (8). Prkcd^-/- mice exhibited normal B-cell receptor-mediated activation in response to stimulation, but the induction of tolerance was defective (5). Prkcd^-/- mice exhibited less ossification and delayed chondrocyte maturation in long bones compared to wild-type controls (9).

PKCδ mediates intestinal inflammatory responses to specific challenges. PKCδ expression levels increase in response to endotoxin or 2,4,6-trinitrobenzenesulfonic acid (TNBS) challenge, and PKCδ is activated in intestinal epithelial cells in response to TNF-α treatment. In addition, PKCδ functions in oxidant-induced disruption of the microtubule cytoskeleton and permeability barrier of colonic epithelia in vitro (10). PKCδ activation is also associated with increased injury susceptibility in neonatal rat colon (11). The phenotype observed in the rigged2 mice indicate loss of PKCδ function.

Primers

PCR Primer
rigged2_pcr_F: TCTGGTTCTACCCACCCAAG
rigged2_pcr_R: GGACTAAGGTACTGTGTGTCAC

Sequencing Primer
rigged2_seq_F: CAAGGCCAAAAGCATAGCTG
rigged2_seq_R: GGTACTGTGTGTCACATTTAACACCG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 404 nucleotides is amplified (chromosome 14, - strand):

1   ggactaaggt actgtgtgtc acatttaaca ccgtaggtgg ctaccagaag gcacctgctt
61  acccccccac ccccaccccc tttctcctct gtattctctc gtgctctgag aaaaaggtgt
121 ggacttgcag ggctaaaatc cagcgtgtgg cagcaacgct agggaaggtt agaacttgtg
181 cccagggatg ttctgtcctg tcctctcatc agggacctca agctggacaa tgtgatgcta
241 gacagggacg gccacatcaa gatcgctgac tttgggatgt gcaaagagaa tatatttggg
301 gagggccggg ccagcacatt ctgcggcact cctgactaca tcgcccctga ggtaagaggt
361 ctctctctca gctatgcttt tggccttggg tgggtagaac caga

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Kuehn, H. S., Niemela, J. E., Rangel-Santos, A., Zhang, M., Pittaluga, S., Stoddard, J. L., Hussey, A. A., Evbuomwan, M. O., Priel, D. A., Kuhns, D. B., Park, C. L., Fleisher, T. A., Uzel, G., and Oliveira, J. B. (2013) Loss-of-Function of the Protein Kinase C Delta (PKCdelta) Causes a B-Cell Lymphoproliferative Syndrome in Humans. Blood. 121, 3117-3125.

  2. Belot, A., Kasher, P. R., Trotter, E. W., Foray, A. P., Debaud, A. L., Rice, G. I., Szynkiewicz, M., Zabot, M. T., Rouvet, I., Bhaskar, S. S., Daly, S. B., Dickerson, J. E., Mayer, J., O'Sullivan, J., Juillard, L., Urquhart, J. E., Fawdar, S., Marusiak, A. A., Stephenson, N., Waszkowycz, B., W Beresford, M., Biesecker, L. G., C M Black, G., Rene, C., Eliaou, J. F., Fabien, N., Ranchin, B., Cochat, P., Gaffney, P. M., Rozenberg, F., Lebon, P., Malcus, C., Crow, Y. J., Brognard, J., and Bonnefoy, N. (2013) Protein Kinase Cdelta Deficiency Causes Mendelian Systemic Lupus Erythematosus with B Cell-Defective Apoptosis and Hyperproliferation. Arthritis Rheum. 65, 2161-2171.

  3. Salzer, E., Santos-Valente, E., Klaver, S., Ban, S. A., Emminger, W., Prengemann, N. K., Garncarz, W., Mullauer, L., Kain, R., Boztug, H., Heitger, A., Arbeiter, K., Eitelberger, F., Seidel, M. G., Holter, W., Pollak, A., Pickl, W. F., Forster-Waldl, E., and Boztug, K. (2013) B-Cell Deficiency and Severe Autoimmunity Caused by Deficiency of Protein Kinase C Delta. Blood. 121, 3112-3116.

  4. Miyamoto, A., Nakayama, K., Imaki, H., Hirose, S., Jiang, Y., Abe, M., Tsukiyama, T., Nagahama, H., Ohno, S., Hatakeyama, S., and Nakayama, K. I. (2002) Increased Proliferation of B Cells and Auto-Immunity in Mice Lacking Protein Kinase Cdelta. Nature. 416, 865-869.

  5. Mecklenbrauker, I., Saijo, K., Zheng, N. Y., Leitges, M., and Tarakhovsky, A. (2002) Protein Kinase Cdelta Controls Self-Antigen-Induced B-Cell Tolerance. Nature. 416, 860-865.

  6. Chou, W. H., Choi, D. S., Zhang, H., Mu, D., McMahon, T., Kharazia, V. N., Lowell, C. A., Ferriero, D. M., and Messing, R. O. (2004) Neutrophil Protein Kinase Cdelta as a Mediator of Stroke-Reperfusion Injury. J Clin Invest. 114, 49-56.

  7. Nojima, T., Hayashi, K., Goitsuka, R., Nakayama, K., Nakayama, K., and Kitamura, D. (2006) Double Knockout Mice show BASH and PKCdelta have Different Epistatic Relationships in B Cell Maturation and CD40-Mediated Activation. Immunol Lett. 105, 48-54.

  8. Uchida, T., Iwashita, N., Ohara-Imaizumi, M., Ogihara, T., Nagai, S., Choi, J. B., Tamura, Y., Tada, N., Kawamori, R., Nakayama, K. I., Nagamatsu, S., and Watada, H. (2007) Protein Kinase Cdelta Plays a Non-Redundant Role in Insulin Secretion in Pancreatic Beta Cells. J Biol Chem. 282, 2707-2716.

  9. Tu, X., Joeng, K. S., Nakayama, K. I., Nakayama, K., Rajagopal, J., Carroll, T. J., McMahon, A. P., and Long, F. (2007) Noncanonical Wnt Signaling through G Protein-Linked PKCdelta Activation Promotes Bone Formation. Dev Cell. 12, 113-127.

  10. Banan, A., Fields, J. Z., Farhadi, A., Talmage, D. A., Zhang, L., and Keshavarzian, A. (2002) Activation of Delta-Isoform of Protein Kinase C is Required for Oxidant-Induced Disruption of both the Microtubule Cytoskeleton and Permeability Barrier of Intestinal Epithelia. J Pharmacol Exp Ther. 303, 17-28.

  11. Conte, M., Soper, B., Chang, Q., and Tepperman, B. (2004) The Role of PKCdelta and PKCepsilon in the Neonatal Rat Colon in Response to Hypoxia Challenge. Pediatr Res. 55, 27-33.