Phenotypic Mutation 'Scallion'

• Allele: Scallion
• Mutation Type: missense
• Chromosome: 17
• Coordinate: 57,708,977 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Adgre1
• Gene Name: adhesion G protein-coupled receptor E1
• Synonym(s): DD7A5-7, EGF-TM7, Emr1, Ly71, F4/80, TM7LN3
• Chromosomal Location: 57,665,691-57,790,527 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012] ; PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000004850] [ENSMUSP00000083971]
• AlphaFold: Q61549
• SMART Domains: Protein: ENSMUSP00000004850; Gene: ENSMUSG00000004730; AA Change: Y56C

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
EGF	35	80	1.43e-1	SMART
EGF_CA	81	122	3.59e-7	SMART
EGF_CA	133	172	4.56e-9	SMART
EGF_CA	173	221	1.29e-8	SMART
EGF_CA	222	271	2.31e-10	SMART
EGF_CA	272	318	1.06e-9	SMART
EGF_CA	319	367	1.18e-7	SMART
GPS	591	641	2.57e-19	SMART
Pfam:7tm_2	644	885	2.1e-63	PFAM

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
  (Using ENSMUST00000004850)
• SMART Domains: Protein: ENSMUSP00000083971; Gene: ENSMUSG00000004730; AA Change: Y56C

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
EGF	35	80	1.43e-1	SMART
EGF_CA	81	122	3.59e-7	SMART
EGF_CA	133	172	4.56e-9	SMART
EGF_CA	173	221	1.29e-8	SMART
EGF_CA	222	271	2.31e-10	SMART
EGF_CA	272	318	1.06e-9	SMART
EGF_CA	319	367	1.18e-7	SMART
GPS	591	641	2.57e-19	SMART
Pfam:7tm_2	644	885	2.1e-63	PFAM

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
  (Using ENSMUST00000086763)
• Meta Mutation Damage Score: 0.1667
• Is this an essential gene?: Probably nonessential (E-score: 0.188)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Last Updated: 2021-11-01 7:48 AM by Diantha La Vine
• Record Created: 2017-01-27 1:07 PM
• Record Posted: 2017-02-23
• Science Writers: Anne Murray
• Authors: Xue Zhong and Bruce Beutler

Accession Number

NCBI RefSeq: NM_010130; MGI: 106912

Alleles Listed at MGI

All alleles(6) : Targeted(3) Chemically induced(3)

Phenotypic Description

Figure 1. Scallion mice exhibit decreased frequencies of peripheral macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Scallion phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5107, some of which showed reduced frequencies of macrophages in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced frequency of peripheral blood macrophage using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 53 mutations (X-axis) identified in the G1 male of pedigree R5107. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 53 mutations. The reduced frequency of peripheral blood macrophages phenotype was linked by continuous variable mapping to a mutation in Adgre1 (alternatively, Emr1):  an A to G transition at base pair 57,401,977 (v38) on chromosome 17, or base pair 43,327 in the GenBank genomic region NC_000083 encoding Adgre1.  Linkage was found with an additive model of inheritance, wherein four variant homozygotes and 15 heterozygous mice departed phenotypically from 16 homozygous reference mice with a P value of 1.127 x 10^-10 (Figure 2).  

The mutation corresponds to residue 207 in the mRNA sequence NM_010130 within exon 13 of 22 total exons.

191 ACCACAGACAGTTATTACTGCACCTGTAAACGA 51  -T--T--D--S--Y--Y--C--T--C--K--R-

The mutated nucleotide is indicated in red.  The mutation results in a tyrosine (Y) to cysteine (C) substitution at position 56 (Y56C) in the F4/80 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.899).

Protein Prediction

Emr1 encodes the F4/80 glycoprotein, which is a cell surface receptor that contains seven transmembrane (TM7) domains (Figure 3). F4/80 is a member of the B2 class of TM7 receptors, which are characterized by a long N-terminal extracellular region. Following a signal peptide, the extracellular N-terminal third of F4/80 (amino acids 32-367) contains seven tandem EGF-like domains (1), approximately 50 amino acids in length and characterized by the presence of six cysteine residues positioned to form three disulfide bonds within each domain. The EGF-like domains mediate protein-protein interactions. Five of the seven EGF-like domains of F4/80 contain consensus Ca²⁺-binding motifs. The C-terminal third of F4/80 (amino acids ~645-931) contains seven transmembrane segments, three extracellular loops, and three intracellular loops, with the C-terminus of the protein located intracellularly. Between the EGF-like domains at the N-terminus and the TM7 structure at the C-terminus, the middle third, or stalk region, of F4/80 has no significant similarity to other known protein domains. This portion of the protein (amino acids ~399-642) contains 4 potential N-glycosylation sites and 47 potential O-glycosylation sites (i.e. approximately 20% serine/threonine content). The Scallion mutation results in a tyrosine (Y) to cysteine (C) substitution at position 56 (Y56C); residue 56 is within the first EGF-l domain in the extracellular N-terminal region.

Putative Mechanism

F4/80 is best known as a macrophage-specific marker. The physiological function of F4/80 has only begun to be investigated, and evidence of its function remains sparse. F4/80^-/- mice are healthy and fertile, and display no gross abnormalities or phenotypes (2;3). Histological analysis showed that immune tissues appear normal, and flow cytometric analysis demonstrated normal populations of B and T cells. Furthermore, F4/80^-/- macrophage development, as determined by examination of expression profiles of several macrophage-restricted cell surface proteins, is comparable to that of wild type mice. F4/80^-/- macrophages phagocytose target cells normally, and produce normal levels of nitric oxide and cytokines stimulated by lipopolysaccharide (LPS) or IFN-γ (2).  F4/80^-/- mice (and the ENU-induced Emr1^F4/80/F4/80 mutants) also display normal resistance to infection by Listeria monocytogenes (3). This finding contrasts with previous work demonstrating that treatment with anti-F4/80 mAb impairs splenic macrophage production of tumor necrosis factor (TNF)-α and interleukin (IL)-12 induced by exposure to heat-killed Listeria (4). However, whether Listeria infection modulates the expression of F4/80 is unknown, as is the molecular effect of anti-F4/80 mAb treatment on cells. F4/80 protein and mRNA expression have not been examined in the Scallion mice, the Scallion mutation may alter the surface expression of F4/80 or an interaction with another protein, leading to the phenotype observed.

Primers

PCR Primer
Scallion_pcr_F: CTTCATAGGCAGGAGACTCTAGG
Scallion_pcr_R: CAGATTCACAAGGTTCCTTCCC

Sequencing Primer
Scallion_seq_F: AGACTCTAGGGTGTGACTCCTC
Scallion_seq_R: AAGGTTCCTTCCCTTGGACATATG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 401 nucleotides is amplified (chromosome 17, + strand):

1   cttcataggc aggagactct agggtgtgac tcctccattc ctttttgtga ctccttgaaa
61  gtgctattcc agtgttttac acacatccat atgcttctct gcatgctacc taggtgtgaa
121 tgagtgtcaa gatactacca cttgcccagc ttatgccacc tgcactgaca ccacagacag
181 ttattactgc acctgtaaac gaggcttcct gtccagcaat ggacaaacca actttcaagg
241 cccaggagtg gaatgtcaag gtgagtttat gttgtatggc ttcctgggga gacatgaata
301 aacatctact ctcactactg aagaaattat ccctacatca cactcaggca gcttaattgt
361 gtattaatca tatgtccaag ggaaggaacc ttgtgaatct g

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. McKnight, A. J., Macfarlane, A. J., Dri, P., Turley, L., Willis, A. C., and Gordon, S. (1996) Molecular Cloning of F4/80, a Murine Macrophage-Restricted Cell Surface Glycoprotein with Homology to the G-Protein-Linked Transmembrane 7 Hormone Receptor Family. J Biol Chem. 271, 486-489.

  2. Lin, H. H., Faunce, D. E., Stacey, M., Terajewicz, A., Nakamura, T., Zhang-Hoover, J., Kerley, M., Mucenski, M. L., Gordon, S., and Stein-Streilein, J. (2005) The Macrophage F4/80 Receptor is Required for the Induction of Antigen-Specific Efferent Regulatory T Cells in Peripheral Tolerance. J Exp Med. 201, 1615-1625.

  3. Schaller, E., Macfarlane, A. J., Rupec, R. A., Gordon, S., McKnight, A. J., and Pfeffer, K. (2002) Inactivation of the F4/80 Glycoprotein in the Mouse Germ Line. Mol Cell Biol. 22, 8035-8043.

  4. Warschkau, H., and Kiderlen, A. F. (1999) A Monoclonal Antibody Directed Against the Murine Macrophage Surface Molecule F4/80 Modulates Natural Immune Response to Listeria Monocytogenes. J Immunol. 163, 3409-3416.