Phenotypic Mutation 'Dani_alves' (pdf version)
List |< first << previous [record 22 of 30] next >> last >|
AlleleDani_alves
Mutation Type missense
Chromosome9
Coordinate119,337,823 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Myd88
Gene Name myeloid differentiation primary response gene 88
Chromosomal Location 119,335,934-119,341,411 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010851; MGI:108005

Mapped Yes 
Amino Acid Change Valine changed to Phenylalanine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000035092] [ENSMUSP00000042351] [ENSMUSP00000115746] [ENSMUSP00000131982] [ENSMUSP00000135439] [ENSMUSP00000134926] [ENSMUSP00000135191] [ENSMUSP00000134981] [ENSMUSP00000135310]
SMART Domains Protein: ENSMUSP00000035092
Gene: ENSMUSG00000032508
AA Change: V223F

DomainStartEndE-ValueType
DEATH 19 109 7.17e-15 SMART
TIR 160 296 3.39e-25 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
(Using ENSMUST00000035092)
SMART Domains Protein: ENSMUSP00000115746
Gene: ENSMUSG00000032508

DomainStartEndE-ValueType
Pfam:Death 50 109 3.5e-13 PFAM
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
hyposensitivity to TLR CpGODN + IFNg
TLR signaling defect: hyposensitivity to CpG
TLR signaling defect: hyposensitivity to CpG + IFNg
TLR signaling defect: hyposensitivity to R848
TLR signaling defect: TNF production by macrophages
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(24) : Chemically induced (ENU)(5) Gene trapped(4) Targeted(12) Transgenic(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Myd88 APN 9 119337352 unclassified probably benign
lackadaisical UTSW 9 119338692 missense probably damaging 1.00
Myd88rev1 UTSW 9 119337394 missense probably damaging 0.99
pococurante UTSW 9 119338114 missense probably damaging 1.00
R1695:Myd88 UTSW 9 119337842 intron probably null
R1878:Myd88 UTSW 9 119338620 missense probably benign 0.00
R2413:Myd88 UTSW 9 119337418 missense probably benign 0.06
R3417:Myd88 UTSW 9 119337490 missense possibly damaging 0.90
R3836:Myd88 UTSW 9 119338193 unclassified probably benign
R3892:Myd88 UTSW 9 119337816 missense possibly damaging 0.93
R3917:Myd88 UTSW 9 119341398 utr 5 prime probably benign
R4081:Myd88 UTSW 9 119339987 unclassified probably benign
R4634:Myd88 UTSW 9 119338109 intron probably null
R4637:Myd88 UTSW 9 119338109 intron probably null
R5091:Myd88 UTSW 9 119337823 missense possibly damaging 0.69
R5604:Myd88 UTSW 9 119339763 missense possibly damaging 0.93
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2017-06-14 10:42 AM by Katherine Timer
Record Created 2017-02-03 9:00 AM
Record Posted 2017-04-13
Phenotypic Description
Figure 1. Dani_alves mice exhibited decreased TNFα secretion in response to TLR9 ligand, CpG ODN. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Dani_alves mice exhibited decreased TNFα secretion in response to TLR7 ligand, R848. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Dani_alves phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5091, some of which showed reduced TNFα secretion in response to the TLR9 ligand CpG oligodeoxynucleotides (CpG ODN) primed with IFNγ (Figure 1) and the TLR7 ligand R848 (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the reduced TNFα secretion after CpG ODN stimulation using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R5091. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 64 mutations. Both of the above phenotypes were linked by continuous variable mapping to a mutation in Myd88: a G to T transversion at base pair 119,337,823 (v38) on chromosome 9, or base pair 2,218 in the GenBank genomic region NC_000075 encoding Myd88. The strongest association was found with an additive model of inheritance to the TLR9 defect, wherein four variant homozygotes and 11 heterozygous mice departed phenotypically from three homozygous reference mice with a P value of 5.252 x 10-5 (Figure 3).  

 

The mutation corresponds to residue 748 in the mRNA sequence NM_010851 within exon 4 of 6 total exons.

 

733 CGCATGGTGGTGGTTGTTTCTGACGATTATCTA
218 -R--M--V--V--V--V--S--D--D--Y--L-

 

The mutated nucleotide is indicated in red.  The mutation results in a valine (V) to phenylalanine (F) substitution at position 223 (V223F) in the MYD88 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.693).

Protein Prediction
Figure 4. MyD88 is a 296 amino acid protein adapter. It contains an N-terminal death domain (DD) that acts as a protein-protein interaction domain that mediates homotypic interactions with other death domain-containing proteins in order to propagate signaling. The death domain of MyD88 is required for binding to IL-1 receptor associated kinase (IRAK) family proteins. The C-terminal portion of MyD88 contains a Toll/IL-1 receptor (TIR) domain, a conserved region which mediates homo- and heterotypic protein interactions during signal transduction. TIR domains in TLRs, IL receptors and the adapters MyD88 and TIRAP contain three conserved boxes (boxes 1, 2 and 3), which are required for signaling. Between the death domain and TIR domain is an “intermediate domain” that may be required for differential activation of distinct NF-κB- versus JNK-dependent transcriptional programs. The Dani_alves mutation results results in a valine (V) to phenylalanine (F) substitution at position 223 (V223F). This image is interactive. Click on the image to view other mutations found in MyD88 (red). Click on the mutations for more specific information.

MyD88 is a 296 amino acid protein adapter that relays signals from the IL-1 and IL-18 receptors and from most TLRs. It is a modular protein containing an N-terminal death domain encoded by the first exon (aa 1-109), which shares similarity with regions of the p55 tumor necrosis factor receptor type I and Fas antigen receptor (Figure 4). The death domain of MyD88 is required for binding to IL-1 receptor associated kinase (IRAK) family proteins (1). Following the MyD88 death domain is an “intermediate domain” encoded by exon 2. The C-terminal portion of MyD88 (exons 3-5) contains a Toll/IL-1 receptor (TIR) domain (1;2), a conserved region of approximately 200 amino acids which mediates homo- and heterotypic protein interactions during signal transduction.

 

The Dani_alves mutation results in a valine (V) to phenylalanine (F) substitution at position 223 (V223F) in the MYD88 protein. Amino acid 223 is within the TIR domain.

 

Please see the record for pococurante for information about Myd88.

Putative Mechanism

Figure 5. MyD88 signaling pathways. MyD88 is a protein adapter that relays signals from the IL-1 and IL-8 receptors (not shown) and from most TLRs. Activation of these receptors leads to MyD88 recruitment to the receptor complexes, where it recruits IRAK family proteins, first IRAK-4 and then IRAK-1, as well as TRAF6. The signaling pathway culminates in the activation of NF-κB-dependent transcription. MyD88 and TRAF6 may interact directly with IRF5 in a complex, activating IRF5 and promoting its translocation to the nucleus. MyD88, together with TRAF6 and IRAK4, has also been shown to bind IRF7 directly. This occurs downstream of TLR7, TLR8 and TLR9 in plasmacytoid dendritic cells and requires the phosphorylation of IRF7 by IRAK1.

The function of MyD88 in IL-1R and TLR signaling has been confirmed using MyD88-deficient mice. Myd88-/- mice display no response to IL-1, including T cell proliferation or cytokine induction, and fail to activate NF-κB (4). In TLR signaling, MyD88 is known to serve all the TLRs except for TLR3. Thus, TLR2/1, TLR2/6, TLR5, TLR7 and TLR9 signaling leading to activation of NF-κB is abolished in MyD88-deficient mice.

Primers PCR Primer
Dani_alves(F):5'- TACATAAGGAAGTACACAGGTCCG -3'
Dani_alves(R):5'- CCATTGCCAGCGAGCTAATTG -3'

Sequencing Primer
Dani_alves_seq(F):5'- AGGTCCGTCCTCAGAGATCTGTAG -3'
Dani_alves_seq(R):5'- TTGGTTAAACATCTAAGAGGGTAGG -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsCristhiaan Ochoa, Lei Sun, and Bruce Beutler
List |< first << previous [record 22 of 30] next >> last >|