Phenotypic Mutation '4-limb_clasper' (pdf version)
List |< first << previous [record 3 of 511] next >> last >|
Allele4-limb_clasper
Mutation Type missense
Chromosome19
Coordinate18,983,351 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Rorb
Gene Name RAR-related orphan receptor beta
Synonym(s) Nr1f2, Rorbeta, RZR-beta
Chromosomal Location 18,930,605-19,111,196 bp (-)
MGI Phenotype Mice homozygous for disruptions in this gene have impaired vision and a variety of behavioral abnormalities.
Accession Number

NCBI RefSeq: NM_001043354.1 (isoform 1), NM_146095.3 (isoform 2); MGI: 1343464

Mapped Yes 
Amino Acid Change Serine changed to Proline
Institutional SourceBeutler Lab
Ref Sequences
S87P in Ensembl: ENSMUSP00000047597 (fasta)
S76P in Ensembl: ENSMUSP00000108451 (fasta)
S76P in Ensembl: ENSMUSP00000108451 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
ZnF_C4 18 89 1.51e-39 SMART
coiled coil region 95 133 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
HOLI 275 431 1.83e-29 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using Ensembl: ENSMUSP00000047597)
Phenotypic Category behavior/neurological, nervous system
Penetrance 100% 
Alleles Listed at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(1) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rorb APN 19 18957328 nonsense probably null 0.00
IGL01576:Rorb APN 19 18957334 missense probably damaging 1.00
IGL02863:Rorb APN 19 18952253 missense probably benign 0.02
IGL02886:Rorb APN 19 18977579 splice site 0.00
IGL02988:Rorb APN 19 18937972 missense probably damaging 1.00
dee-no UTSW 19 18955053 missense probably damaging 1.00
grasshopper UTSW 19 19110557 missense probably benign 0.18
IGL02988:Rorb UTSW 19 18937972 missense probably damaging 1.00
R0748:Rorb UTSW 19 18977800 missense probably damaging 0.98
R1087:Rorb UTSW 19 18960414 missense probably damaging 1.00
R1438:Rorb UTSW 19 18955053 missense probably damaging 1.00
R1710:Rorb UTSW 19 18960501 missense probably damaging 1.00
R1846:Rorb UTSW 19 18955081 missense probably damaging 1.00
R1852:Rorb UTSW 19 18962083 missense probably damaging 1.00
R1972:Rorb UTSW 19 18952203 missense probably benign 0.04
R1987:Rorb UTSW 19 18952152 splice donor site probably benign
R3547:Rorb UTSW 19 18977657 missense noncoding transcript
R3903:Rorb UTSW 19 18962099 missense probably damaging 1.00
R3978:Rorb UTSW 19 18937890 missense probably benign 0.00
R4497:Rorb UTSW 19 18977628 missense possibly damaging 0.95
R4982:Rorb UTSW 19 18977688 nonsense probably benign 0.08
R5602:Rorb UTSW 19 18977937 missense probably damaging 0.98
R5733:Rorb UTSW 19 18988107 missense probably damaging 0.99
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 031040-UCD
Last Updated 05/17/2017 3:20 PM by Katherine Timer
Record Created unknown
Record Posted 03/11/2009
Phenotypic Description
Figure 1. Phenotype of 4-limb clasper mice.
The 4-limb clasper phenotype was identified as an independently segregating phenotype from the lps3 pedigree, in which a mutation in Tlr4 was identified. 4-limb clasper mice clasp all four limbs together when held by the tail, and lift hind legs excessively high when walking. Males have not been observed to breed.

 

Nature of Mutation
The 4-limb clasper phenotype was mapped to Chromosome 19 by intercrossing F1 offspring from crosses of 4-limb clasper females and C3H males. Sequencing of Rorb revealed a T to C transition at position 127846 of the genomic DNA sequence (Genbank genomic region NC_000085 for linear genomic DNA sequence of Rorb). The mutation occurs in the third exon of either of the two Rorb splice variants, each of which contains 10 total exons. The mutated residue corresponds to nucleotide 864 and nucleotide 330, respectively, in the cDNA sequences of Rorb isoform 1 and isoform 2.
 
                       <--exon 3 intron 3-->
127831 CTTGCCCTAGGAATGTCAAGAGATG GTAAGC……
71     -L--A--L--G--M--S--R--D--                (isoform 1)
82     -L--A--L--G--M--S--R--D--                (isoform 2)
 
Complement genomic sequence and numbering are shown.  The mutated nucleotide is indicated in red lettering, and results in a serine to proline substitution at amino acid 76 and amino acid 87, respectively, of RORβ-isoform 1 (RORβ-1) and RORβ-2.
Protein Prediction
Figure 2. Domain of RORb. The N-terminal domain varies between the two isoforms of RORb; only the shorter isoform 1 is shown. The position of the 4-limb clasper mutation is indicated in red, and results in a serine to proline substitution at amino acid 76 in RORβ-1 and amino acid 87 in RORβ-2 (not shown). This image is interactive. Click on the image to view other mutations found in the Rorb gene (red). Click on the mutations for more specific information. 
The RAR-related orphan receptor β (RORβ) belongs to the large nuclear hormone receptor superfamily, a group of structurally related, ligand-dependent transcription factors. The family includes the retinoic acid receptors (RARs), retinoic X receptors (RXRs) (see record for pinkie, an RXRα mutant), thyroid hormone receptor, and vitamin D3 receptor. RORβ was initially identified as an “orphan” receptor, for which no ligand was known, and is a member of a subfamily of orphan receptors which includes RORα and RORγ [reviewed in (1)]. The protein sequences of human and mouse RORβ, isoform 1 are 98% identical.
 
Figure 3. Crystal structure of two monomers of the Rev-Erbα DNA binding domain (DBD) and portion of the C-terminal extension (CTE) bound to their response elements. The DBDs of RORb and Rev-Erbα are 64% identical; the CTE domains (yellow) are also highly conserved. Note the zinc finger bound in the major groove, and the CTE bound in the minor groove. The residue corresponding to the serine mytated in 4-limb clasper (also a serine Rev-Erba) is shown. UCSD Chimera model based on Sierk et al. Biochemistry 40, 12833-12843 (2001). This image is interactive. Click on the structure to view it rotate.
Nuclear hormone receptors, including the RORs, share a similar structural architecture composed of four major functional domains: the N-terminal domain (A/B region), DNA-binding domain (DBD or C region), a hinge region (D region), and a ligand-binding domain (LBD or E region) (Figure 2) (1;2). Some receptors, not including RORβ, contain an extended C-terminal domain with unknown function, as well as an N-terminal domain with ligand-independent transactivation function. The DNA-binding domain (DBD) is the most highly conserved region among nuclear receptors; within the RORα/β/γ subfamily, the DBDs are approximately 90% identical. The two zinc finger motifs present in the DBD recognize ROR response elements (ROREs) typically located in the upstream promoters of target genes (3;4). ROREs contain the consensus motif AGGTCA preceded by an AT-rich sequence (3;4). A motif called the P-box, located within the first zinc finger of the DBD, contacts this RORE core motif in the major groove (2;5;6). Adjacent to the DBD is a highly conserved region designated the carboxy-terminal extension (CTE) that influences the binding specificity of RORs (6). The CTE makes contact with the 5’ AT-rich segment of the RORE in the minor groove. Unlike other nuclear hormone receptors, RORs bind to ROREs as monomers (Figure 3; PDB ID 1HLZ) (3;4;7;8).
 
The LBDs of nuclear hormone receptors share a similar structure containing twelve α-helices (H1-H12) (1). Helices 3-5 form the interaction surface for several coactivators and corepressors. Helix 12 contains the transactivation function 2 (AF-2) consensus motif ΦΦXE/DΦΦ (where Φ is a hydrophobic amino acid, and X is any amino acid) that binds coactivators, and functions critically in the control of transcriptional activity.  For many receptors, the structure of the agonist-bound and unliganded receptor forms differ significantly in the position of helix 12 (9;10). Ligand binding acts as a switch, inducing a shift in the position of helix 12 that disfavors corepressor binding and promotes recruitment of coactivator complexes that induce local chromatin remodeling to enhance transcription (11;12). Individual RORs may recruit different coactivator complexes in the context of the different promoters to which they bind.
 
X-ray crystallographic analysis of the RORβ LBD bound to stearate and complexed with a coactivator peptide demonstrates that it adopts the canonical agonist-bound fold (Figure 4; PDB ID 1N4H(13;14). In this study (13), stearic acid was co-purified fortuitously from the expression host and co-crystallized in the ligand binding pocket.  It is thought to act as a filler/stabilizer for the structure rather than a functional ligand, as it does not activate RORβ in a reporter assay. Further studies identified all-trans retinoic acid (ATRA) and the synthetic retinoid ALRT 1550 as functional ligands for RORβ in vitro (14). Both ATRA and ALRT 1550 inhibit RORβ-mediated transactivation of a reporter gene, suggesting that these retinoids act as antagonists. Whether they act as physiological ligands remains unknown. The RORβ LBD contains two extra helices (H2’ and H11’). Unlike those of other retinoid receptors, helix 10 in RORβ cannot mediate dimerization because of a kink at Ala411-Lys412, supporting studies demonstrating the function of RORβ as a monomer.
 
A nonconserved linker region connects the DBD and LBD, and is required for several functions in repression and activation. For example, mutations within the hinge region of RORα can inhibit proper DNA bending and interactions with the DNA (5), and a mutation near the N-terminus of the hinge in RORγ1 abolishes binding to the corepressor N-CoR (2).
 
Figure 4. Crystal structure of the RORβ ligand binding domain in complex with stearate (blue). The twelve helices as well as H2’ and H11’ are indicated. UCSD Chimera model based on Stehlin-Gaon et al. Nat. Struct. Biol. 10, 820-825 (2003). This image is interactive. Click on the structure to view it rotate.
The N-terminal A/B domain influences the binding affinity of RORs. In certain retinoid receptors, but not RORβ, it contains the ligand-independent transactivation function 1 (AF-1) motif. The A/B domain differs between the isoforms of RORs due to alternative promoter usage or exon splicing.  Two splice variants of Rorb exist, which diverge in sequence upstream from the DBD, and give rise to two protein isoforms (RORβ1 and RORβ2) that display differential tissue-specific expression patterns and response element specificity (15). RORβ2 displays a much stronger preference for a T residue at the -1 position preceding the core RORE consensus sequence than RORβ1, suggesting that it regulates distinct target genes (15). The A/B domain may control the binding affinity for ROREs by affecting the tertiary structure, and in turn DNA contacts, of the DBD and CTE (5).
 
The 4-limb clasper mutation is a serine to proline change in the first residue of the CTE, at the C-terminal boundary of the DBD and adjacent CTE domains. The mutation affects both RORβ isoforms. A serine residue at this position is conserved in all of the RORs.
Expression/Localization
In situ hybridization demonstrates high localized RORβ mRNA expression in several brain areas involved in the processing of sensory information, and in the retina.  RORβ is also detected in the dorsal horn of the spinal cord, in the layers receiving sensory input from the periphery. In the rat brain, RORβ transcript is most highly expressed in the cortex and the thalamus, with no expression in striatum, hippocampus, or cerebellum (16-18). In the cortex, RORβ expression is restricted to layer IV and layer V non-pyramidal neurons of the primary sensory cortices. In the thalamus, it is found in the three prinicipal relay nuclei: the dorsal lateral geniculate nucleus, the medial geniculate nucleus, and the ventroposterior nuclei.  RORβ is also expressed in the suprachiasmatic nucleus of the hypothalamus, the pineal gland, and the retina, areas involved in the generation and maintenance of circadian rhythms (16). Retinal expression of RORβ is developmentally modulated, such that at E15, all cells in the retina express RORβ, and by P9, RORβ is preferentially expressed in the inner nuclear layer. At P16, coincident with eye opening, the inner nuclear layer loses most expression, and expression is confined to the outermost part of the outer nuclear layer where the photoreceptor cones reside, and to some ganglion cells. 
 
In the pineal gland and retina, RORβ mRNA abundance oscillates with circadian rhythmicity, peaking during the hours of darkness (16;19). Cycling begins during the first postnatal week in the pineal gland, and the second postnatal week in the retina of rats (20). The cycling of RORβ transcript abundance was found to be truly circadian in that it is not subject to light entrainment, and a phase advance shift suppresses RORβ cycling until the new circadian rhythm is installed (20). Most of the nocturnal increase of RORβ mRNA is due to the expression of RORβ isoform 2. RORβ2 is found in the pineal gland and retina, but is absent from the cerebral areas. Conversely, RORβ1 is strongly expressed in cerebral cortex, thalamus and hypothalamus, with little expression in the retina and pineal gland (15). The level of RORβ mRNA in the suprachiasmatic nucleus does not cycle.
Background
Using an RT-PCR strategy and degenerate primer sequences based on the two most highly conserved receptor DBD regions, RORβ was identified from rat brain RNA in a search for novel members of the nuclear receptor superfamily (3). Its overall expression pattern suggested that RORβ functions in the context of sensory input integration and in circadian rhythm timing.
 
Circadian rhythms are intrinsic daily cycles of behavioral and physiological changes driven by an endogenous “clock” or “oscillator” [reviewed in (21-23)]. Changes in sleep/wakefulness, locomotion, feeding, and temperature are all overt signs of the body’s circadian rhythm. These rhythms, which follow a 24 hour cycle or period, are both self-sustained, occurring even in the absence of external inputs, and entrained (synchronized) by environmental cues such as the light-dark cycle. In mammals, the master circadian clock is located in the hypothalamic suprachiasmatic nucleus (SCN) (24), where a network of interconnected and therefore synchronized neurons receives photic input from the retina and provides circadian timing information to the rest of the body (25). This information is conveyed by direct neuronal projections to other brain and peripheral regions, as well as by diffusible factors from the SCN (26;27).  Peripheral oscillators, including the kidney and liver, can run independently of the SCN for a few days, but rely on the central clock for long term synchronization to an internally coherent timing system (28;29).
 
Figure 5. Molecular components of the basic circadian clock. A, transcriptional feedback interactions between clock components. PER and CRY inhibit transcription by directly binding to CLOCK-BMAL1 heterodimers. Rev-Erbα and RORα/β compete for binding to the RORE of Bmal1; at low levels of Rev-Erba, RORα/β can bind and transactivate Bmal1. B, Recurrent oscillations of clock proteins drive circadian rhythms. Components of the core loop are shown. RORβ oscillates in a pattern anti-phase to PER and CRY; the mechanism of its regulation is unknown. RORa does not show a circadian pattern of expression but is required for circadian expression of BMAL1.
At the molecular level, the circadian clock consists of several interacting positive and negative transcriptional feedback loops that drive recurrent cycling of RNA and protein levels of clock components (Figure 5) (21-23). The core feedback loop consists of BMAL1 (also called Arntl, aryl hydrocarbon receptor nuclear translocator-like) and CLOCK, components of the positive arm of the loop, and three Period (PER) and two Cryptochrome (CRY) proteins, components of the negative arm of the loop. CLOCK-BMAL1 heterodimers activate the transcription of Per, Cry, and Rev-Erbα genes through interaction with E-box enhancers (30;31). PER and CRY proteins translocate back into the nucleus where CRY proteins act as negative regulators by directly interacting with CLOCK and BMAL1 and inhibiting transcription (32;33). On the other hand, Rev-Erbα binds to ROREs in the promoter of Bmal1 and acts as a transcriptional repressor, reducing BMAL1 levels (31;34). Remaining CRY and PER proteins entering the nucleus inhibit transcription activated by CLOCK-BMAL1, including that of Cry, Per, and Rev-Erbα. Rev-Erbα levels decrease, resulting in a de-repression of Bmal1 transcription and beginning the whole cycle again. On top of these loops, regulated protein phosphorylation and turnover provide temporal separation of the signaling events and stretch the period to 24 hours.
 
Disruption of Rorb in mice demonstrates a role for RORβ in the regulation of circadian timing. Targeted replacement of the second zinc finger of the RORβ DBD with the gene for β-galactosidase results essentially in a null allele, which lacks all sequence downstream of the disruption site including the entire LBD, but retains expression of the N-terminal sequence (20). No gross anatomical abnormalities are observed in the brain, but the retinas of Rorb-/- mice are severely malformed, with significantly fewer cells and a disorganized structure lacking the layers of a normal retina. No visual activity can be measured in response to strong light flashes in the retino-cortical pathway of adult Rorb-/- mice. Nonetheless, Rorb-/- mice can be entrained by light-dark conditions sensed by intrinsically photosensitive retinal ganglion cells (ipRGCs), which express the sensory photopigment melanopsin (35;36). However, Rorb-/- mice display an altered free-running or autonomous rhythm: Upon release of animals from a light-dark schedule into constant darkness, Rorb-/- mice adopt a cycle length about 0.4 hours longer than their wild type littermates (an average of 23.84 hours for wild type versus 24.26 hours for Rorb-/-) (20). RORβ expression in the pineal gland and the photoreceptors, the two principal sites for production of the sleep-promoting hormone melatonin, along with cycling coincident with melatonin biosynthesis, led to the hypothesis that RORβ may participate in the transcriptional regulation of melatonin synthesis (20). However, Rorb-/- mice bred to the C3H/HeN background (in which melatonin levels are detecable) still show a robust diurnal rhythm of melatonin synthesis (37).
 
RORβ may influence the timing of circadian rhythm through transcriptional activation of the clock gene Bmal1 (Figure 5).  RORβ, along with RORα, has been shown to interact with several ROREs in the promoter of Bmal1, competing with the transcriptional repressors Rev-Erbα and Rev-Erbβ for binding (31;34;38;39). Similar to Rorb-/- mice, RORα-deficient mice display altered free-running locomotor activity rhythms and altered feeding patterns during the circadian cycle (39;40)Bmal1 promoter activity in a luciferase reporter assay oscillates in a 24 hour circadian rhythm, but coexpression of a dominant negative RORα lacking the LBD or knockdown of RORα expression severely dampened this oscillation (34;39). Mutation of one of the RORE sequences also abolishes BMAL1 oscillation (34;39). Although the effect of RORα appears to be stronger than that of RORβ in inducing Bmal1 promoter activity, RORβ may regulate Bmal1 transcription through a similar mechanism.
 
Rorb-/- mice exhibit developmental abnormalities in addition to alterations in circadian timing (20). Young Rorb-/- mice are smaller than their wild type littermates, and they sometimes fall sideways and roll over as they begin to walk. With increasing age, they gain normal muscular strength but develop a “duck-like” gait and a hind paw clasping reflex when suspended by the tail. These are reported to be the two most conspicuous phenotypes observed in adulthood. Rorb-/- mice display normal grasping, limb flexion and righting reflexes, respond normally to auditory stimulation, show normal rearing, balancing and climbing responses, and display normal temperature-related pain reflexes. When placed in a new environment, Rorb-/- mice display erratic movements for the first minute and seem reluctant to explore. Male Rorb-/- mice are never observed to sexually reproduce before the six months of age, but assume normal reproductive behavior thereafter.
 
The molecular basis for the developmental abnormalities of Rorb-/- mice remains unknown. The duck-like gait has been suggested to arise from aberrant wiring of RORβ-expressing neurons in the spinal cord, resulting in overlap of sensory and other projections to the brain. An overlap of sensory and nociceptive projections could cause Rorb-/- mice to feel pain when walking, eliciting the high leg-lifting observed (20). With regard to the delayed reproductive behavior of male Rorb-/- mice, RORβ is expressed in the hypothalamus and anterior pituitary gland, and may function in the endocrine network of sexual maturation. RORβ is also expressed in the epididymis and the vas deferens, and may be required for terminal maturation or storage of sperm cells (20).
 
In order to further understand the physiolocial functions of RORβ, several groups have searched for RORβ protein interactors and target genes. A 27 kDa protein, designated neuronal interacting factor X 1 (NIX1), was identified to interact with RORβ through yeast two-hybrid screening (41). NIX1 contains two LXXLL motifs, is exclusively expressed in the brain, and inhibits transcriptional activation by RORβ. Two-hybrid analysis also identified the nucleoside diphosphate kinase Nme1 (also known as NM23) and the thyroid-hormone-receptor interacting protein (TRIP-1) as RORβ-interacting proteins, but the significance of these findings is unknown (42). Other co-activators and co-repressors have been identified as interactors of RORβ, including NCOA1, NCOA6, NRIP1, NCOR1, NCOR2, and the Hairless (HR) protein (mutated in prune and mister clean) (43)Opn1sw is the first natural target gene identified for RORβ (44)Opn1sw encodes the short wavelength- or blue light-sensitive opsin photopigment called S opsin, one of the opsins expressed in retinal cone photoreceptors and required for color vision. RORβ activates the S opsin gene by binding to promoter ROREs, and functions synergistically with the retinal cone-rod homeobox factor (CRX) transcription factor. RORβ-deficient mice display a drastically reduced induction of S opsin expression during postnatal cone development (44)
 
Other members of the ROR subfamily of nuclear receptors regulate a wide range of biological processes, revealed in part through study of mice with targeted deletions of each ROR. RORα-deficient mice display cerebellar degeneration (45-48), deficits in muscle coordination (49), and osteopenia (50). Their spleens and thymi are reduced in size, as are the populations of thymocytes, splenocytes, and CD4+ and CD8+ T lymphocytes in the spleen (51). These defects are derived from non-hematopoietic cells, as determined using bone marrow chimeric mice (51). Mast cells and macrophages from RORα-deficient mice produce increased levels of interleukin (IL)-6 and tumor necrosis factor (TNF)-α, and CD8+ T cells produce increased levels of interferon (IFN)-γ, in response to LPS treatment, suggesting that RORα inhibits inflammation by negatively regulating cytokine production (51;52).
 
Mice lacking both isoforms of RORγ (RORγ1 and RORγ2) or RORγ2 (also called RORγt) do not have lymph nodes and Peyer’s patches due to the absence of lymphoid tissue inducer (LTi) cells, which require RORγt for their generation and survival (53-55). In addition, thymus size and thymocyte number are greatly reduced in RORγ-null and RORγt-deficient mice. In particular, they lack CD4+CD8+ double positive (DP), and CD4+ and CD8+ single positive (SP) thymocytes because of a block in thymocyte development from the immature single positive stage (ISP, CD4-CD8lowCD3-) to the DP stage (53;55). RORγt is normally upregulated during the ISP to DP transition. DP thymocytes from RORγ-deficient mice have a shorter lifespan, impaired TCRα rearrangement, and undergo increased apoptosis related to decreased expression of the antiapoptotic protein Bcl-XL (53;55;56). Ectopic expression of RORγt has been shown to protect T cell hybridomas from activation-induced cell death (AICD) by inhibiting FasL upregulation (57). Interestingly, RORγ-null mice show increased susceptibility to thymic lymphomas, resulting in 50% mortality by four months of age (58). Recently, RORγt and RORα were shown to regulate T helper 17 (Th17) lineage differentiation. RORγt and RORα are expressed in Th17 cells, and are induced in a STAT-3-dependent manner by transforming growth factor (TGF)-β and IL-6, cytokines required for Th17 effector differentiation (59-61).
Putative Mechanism
The phenotype of 4-limb clasper mice closely approximates that of Rorb-/- mice, suggesting that the 4-limb clasper mutation abrogates much of the function of mutant RORβ. Domain swapping experiments using the DBD and CTE domains of RORα and the orphan nuclear receptor NGFI-B demonstrates that the CTE, in which the 4-limb clasper mutation is located, is essential for RORE recognition through binding to the 5’ AT-rich sequence (6). The serine mutated in RORβ4-limb clasper is conserved in all the RORs, as well as in Rev-Erbα and Rev-Erbβ. Point mutation of this serine and the adjacent arginine in RORα (SR->AS) results in significant loss of RORE-binding activity (61% of the wild type sequence) (6). In addition, whereas wild type RORα still binds a mutant RORE sequence, RORαSR->AS binding to the mutant RORE is almost completely abolished. Since the effects of the protein and RORE mutations are additive, it has been hypothesized that the serine and arginine residues in question are directly involved in base pair recognition, possibly at position -1 relative to the core RORE sequence (6). Thus, it is likely that the mutation in 4-limb clasper abolishes DNA binding activity of RORβ, by preventing direct contact with the 5’ AT-rich sequence and/or by disruption of the secondary structure of RORβ by substitution of a rigid proline residue for serine.
Primers Primers cannot be located by automatic search.
Genotyping
4-limb clasper genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.  This protocol has not been tested.
 
Primers
4-limb clasper (F): 5’- AACAGCCAGTGGTCTGTCTCACTTC -3’
4-limb clasper (R): 5’-TGCCCAATTACCCATAGCACTTAGTTC -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C              ∞
 
Primers for sequencing
4-limb clasper_seq(F): 5’- GTGACTTTAACACTGAAGACCTC -3’
4-limb clasper_seq(R): 5’- GAAAGATCCTGTGAATTGCCC -3’
 
The following sequence of 1000 nucleotides (from Genbank genomic region NC_000085 for linear genomic sequence of Rorb) is amplified:
                                                                      tg
127321 cccaattacc catagcactt agttcaaacc taagccagac acccgtcgtc atacttgatt
127381 tagcagtaac atgcctcttt gacattcttt ccctgttctt ttctcttcaa agaaattagt
127441 ttagtaaata ttaaatagtg agtgagtgag tgagtgagtg agtgagtgag tgagtgagtg
127501 agtgagtgga caactgaagg aaagatcctg tgaattgccc ataaataagt acatatattc
127561 tgctcagaac cacctagaag ccctctaaga agcattagga aacttttgaa agatgaaagt
127621 tggctatact cggtgtagaa agtatagcag tgtgtatgct aatgccgccc ttcctctgag
127681 tctcctgccc ttgctttctc ttttcctctt tagggattct tcaggaggag ccagcagaac
127741 aatgcctctt actcctgccc aaggcagaga aactgtttaa ttgacagaac caacaggaac
127801 cgttgccaac actgccgcct gcagaagtgt cttgccctag gaatgtcaag agatggtaag
127861 cctctccctt tctgttcctt aagagttttc aaatggatgt tttgctagag gctgttcaag
127921 ccactgaaag agttttaacg gtgggaattg gggatataaa gaaaagagaa ccagaggact
127981 ggtcgtgaat taagaagtaa agcagaaata tatcaaatgt agcattgcct gagaaataag
128041 aaaaaggaag gtggtagagg cttgcagaca gcctacacta tctaggataa gtataggcca
128101 ggtaagacat ttgatagtaa gtgactacct gagcatattt tcttgtaatg gagggtttcc
128161 tgggatgtga ggtcttcagt gttaaagtca caaagctata aatgaacaga agccattcat
128221 ccaccagagc catctgactt gtacacaagt tactaatata tgaagatcct aggaacagaa
128281 cacgcttcca cgggaagtga gacagaccac tggctgtt
 
Complement sequence is shown. Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsOwen Siggs, Bruce Beutler
List |< first << previous [record 3 of 511] next >> last >|
Edit History
01/28/2011 6:51 PM (current)
11/04/2010 10:02 AM
09/28/2010 4:03 PM
09/28/2010 3:59 PM
09/28/2010 3:45 PM
09/28/2010 10:43 AM
09/28/2010 10:41 AM
02/03/2010 2:52 PM