Phenotypic Mutation 'splenda2'

• Allele: splenda2
• Mutation Type: missense
• Chromosome: 19
• Coordinate: 54,035,070 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Adra2a
• Gene Name: adrenergic receptor, alpha 2a
• Synonym(s): alpha2A-adrenergic receptor, Adra-2, alpha2A-AR, alpha(2A)AR, alpha2A, Adra-2a
• Chromosomal Location: 54,033,690-54,037,413 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-2-adrenergic receptors are members of the G protein-coupled receptor superfamily. They include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. These receptors have a critical role in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. Studies in mouse revealed that both the alpha2A and alpha2C subtypes were required for normal presynaptic control of transmitter release from sympathetic nerves in the heart and from central noradrenergic neurons; the alpha2A subtype inhibited transmitter release at high stimulation frequencies, whereas the alpha2C subtype modulated neurotransmission at lower levels of nerve activity. This gene encodes alpha2A subtype and it contains no introns in either its coding or untranslated sequences. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene fail to produce hypotensive responsiveness to alpha2AR agonists, including failure to inhibit voltage-gated Ca2+ currents and spontaneous neuronal firing. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Threonine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000036203]
• AlphaFold: Q01338
• SMART Domains: Protein: ENSMUSP00000036203; Gene: ENSMUSG00000033717; AA Change: I142T

Domain	Start	End	E-Value	Type
Pfam:7tm_4	55	237	1.5e-7	PFAM
Pfam:7TM_GPCR_Srx	56	188	2.5e-6	PFAM
Pfam:7TM_GPCR_Srsx	59	245	3.7e-7	PFAM
Pfam:7tm_1	65	441	1.5e-73	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000036700)
• Meta Mutation Damage Score: 0.6666
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Last Updated: 2021-11-10 12:13 PM by Diantha La Vine
• Record Created: 2017-02-07 8:34 PM
• Record Posted: 2018-12-19
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_007417; MGI:87934

Alleles Listed at MGI

All Mutations and Alleles(6) : Targeted(5) Transgenic(1)

Phenotypic Description

Figure 1. Splenda2 mice exhibited decreased glucose levels in response to glucose challenge. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The splenda2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4984, some of which showed diminished glucose levels 30 minutes after glucose challenge (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the hypoglycemic phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 37 mutations (X-axis) identified in the G1 male of pedigree R4984. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. The hypoglycemia phenotype was linked by continuous variable mapping to a mutation in Adra2a: a T to C transition at base pair 54,046,639 (v38) on chromosome 19, or base pair 1,458 in the GenBank genomic region NC_000085 encoding Adra2a. Linkage was found with an additive model of inheritance, wherein eight variant homozygotes and 30 heterozygous mice departed phenotypically from 11 homozygous reference mice with a P value of 7.121 x 10^-5 (Figure 2).  

The mutation corresponds to residue 1,458 in the mRNA sequence NM_007417 within exon 1 of 1 total exons.

1442 GTGCACCTGTGCGCCATCAGCCTTGACCGCTAC 137  -V--H--L--C--A--I--S--L--D--R--Y-

The mutated nucleotide is indicated in red. The mutation results in an isoleucine to threonine substitution at amino acid 142 (I142T) in the ADRA2A protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 3. Topology of α_2AAR. α_2AAR has seven transmembrane (TM) domains. Other mutations found in the α_2AAR protein are noted in red. 

Adra2a encodes the alpha-2a adrenergic receptor (α_2AAR). The adrenergic receptors are G protein-coupled receptor (GPCRs). GPCRs consist of seven transmembrane-spanning α-helices connected by alternating intracellular (C-) and extracellular (E-) loops (Figure 3). The N-terminus is located on the extracellular side and the C-terminus on the intracellular side (1). Adrenergic, adenosine, and rhodopsin (see the record for Bemr3) belong to the class A subfamily of GPCRs, which are characterized by a highly conserved (E/D)RY motif at the cytoplasmic end of the third transmembrane helix (TM3) (1). Many GPCRs also contain an NPXXY motif located in the TM7, and a stabilizing Cys-Cys disulfide bond (2). 

The second and third intracellular loops interact with G protein-coupled receptor kinase-2 (GRK2) (3;4). In addition to mediating an interaction with GRK2, the third intracellular loop also interacts with arrestins (5;6), heterotrimeric G proteins (7), spinophilin (8), and 14-3-3 (9). The second and third intracellular loops and the juxtamembrane regions of the third cytoplasmic loop putatively regulate coupling to G-proteins (10-13). The third intracellular loop also functions in α_2AAR stabilization at the cell surface (14). The N-terminus of the third intracellular loop regulates agonist-associated downregulation of α_2AAR (15).

The splenda2 mutation results in an isoleucine to threonine substitution at amino acid 142 (I142T); I142 is within the cytoplasmic loop between transmembrane domains three and four.

Please see the record for splenda for more information about Adra2a.

Putative Mechanism

Adra2a is highly expressed in the brain, including the locus ceruleus, midbrain, hypothalamus, amygdala, hippocampus, spinal cord, cerebral cortex, cerebellum, septum, and brain stem (16-18). The α_2AAR is also expressed in human platelets, β cells of the pancreas, adrenal gland, intestinal epithelia, vascular endothelium, and smooth muscle cells (19). The α_2AAR The α_2AAR is localized to both the pre- and post-synapse (19).

The α₂-adrenergic receptors (α_2AAR, α_2BAR, and α_2CAR) mediate decreases in adenylyl cyclase activity, activation of receptor-mediated K+ channels, and inhibition of voltage-gated Ca2+ channels by coupling to G_i and G_o proteins (20). α_2AAR can also stimulate G_s proteins (21). The α₂-adrenergic receptors have critical roles in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. α_2AAR is the main inhibitory presynaptic feedback receptor (22-24). α_2A and α_2C served as heteroreceptors to inhibit the release of dopamine an serotonin in the central nervous system (25;26).

α_2AAR activation inhibits insulin secretion from pancreatic islets; increased expression of ADRA2A depresses insulin release (27). α_2AAR inhibits insulin secretion by modulating cAMP levels after being activated by neuronal norepinephrine, circulating epinephrine, or by spontaneous activation. α_2AAR activation results in receptor- G_i coupling and subsequent inhibition of adenylyl cyclase, reduced conversion of ATP to cAMP, and reduced protein kinase A-mediated exocytosis of insulin granules (28).

Mutations in human ADRA2A have been linked with increased fasting glucose levels and reduced insulin secretion during glucose challenge as well as obesity, high blood pressure, and increased type 2 diabetes risk (27;29-31). Adra2a-deficient (Adra2a^-/-) mice exhibit reduced fasted circulating glucose levels, increased plasma insulin and glucagon levels, improved glucose tolerance, reduced startle reflex, and reduced prepulse inhibition [(32) and MGI:5695965]. Glucose-stimulated insulin secretion was not increased in the Adra2a^-/-mice (32).

The phenotype of the splenda2 mice is similar to that of Adra2a^-/-mice, indicating loss of α_2AAR-associated function in regulating insulin secretion from pancreatic islets (27).

Primers

PCR Primer
splenda2_pcr_F: TTATCGCGGTGTTCACCAGTC
splenda2_pcr_R: TGATCTTGCAGCTTGGCTCG

Sequencing Primer
splenda2_seq_F: TCGCGCGCTCAAAGCTC
splenda2_seq_R: CCACACGGTGACAATGA

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 408 nucleotides is amplified (chromosome 19, + strand):

1   ttatcgcggt gttcaccagt cgcgcgctca aagctcccca aaacctcttc ctggtgtccc
61  tggcctcagc ggacatcctg gtggccacgc tggtcattcc cttttctttg gccaacgagg
121 ttatgggtta ctggtacttt ggtaaggtgt ggtgtgagat ctatttggct ctcgacgtgc
181 tcttttgcac gtcgtccata gtgcacctgt gcgccatcag ccttgaccgc tactggtcca
241 tcacgcaggc catcgagtac aacctgaagc gcacgccgcg tcgcatcaag gccatcattg
301 tcaccgtgtg ggtcatctcg gctgtcatct ccttcccgcc actcatctcc atagagaaga
361 agggcgctgg cggcgggcag cagccggccg agccaagctg caagatca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Mustafi, D., and Palczewski, K. (2009) Topology of Class A G Protein-Coupled Receptors: Insights Gained from Crystal Structures of Rhodopsins, Adrenergic and Adenosine Receptors. Mol Pharmacol. 75, 1-12.

  2. Fotiadis, D., Jastrzebska, B., Philippsen, A., Muller, D. J., Palczewski, K., and Engel, A. (2006) Structure of the Rhodopsin Dimer: A Working Model for G-Protein-Coupled Receptors. Curr Opin Struct Biol. 16, 252-259.

  3. Pao, C. S., and Benovic, J. L. (2005) Structure/function Analysis of alpha2A-Adrenergic Receptor Interaction with G Protein-Coupled Receptor Kinase 2. J Biol Chem. 280, 11052-11058.

  4. Benovic, J. L., Onorato, J., Lohse, M. J., Dohlman, H. G., Staniszewski, C., Caron, M. G., and Lefkowitz, R. J. (1990) Synthetic Peptides of the Hamster Beta 2-Adrenoceptor as Substrates and Inhibitors of the Beta-Adrenoceptor Kinase. Br J Clin Pharmacol. 30 Suppl 1, 3S-12S.

  5. Wu, G., Krupnick, J. G., Benovic, J. L., and Lanier, S. M. (1997) Interaction of Arrestins with Intracellular Domains of Muscarinic and alpha2-Adrenergic Receptors. J Biol Chem. 272, 17836-17842.

  6. DeGraff, J. L., Gurevich, V. V., and Benovic, J. L. (2002) The Third Intracellular Loop of Alpha 2-Adrenergic Receptors Determines Subtype Specificity of Arrestin Interaction. J Biol Chem. 277, 43247-43252.

  7. Wade, S. M., Dalman, H. M., Yang, S. Z., and Neubig, R. R. (1994) Multisite Interactions of Receptors and G Proteins: Enhanced Potency of Dimeric Receptor Peptides in Modifying G Protein Function. Mol Pharmacol. 45, 1191-1197.

  8. Richman, J. G., Brady, A. E., Wang, Q., Hensel, J. L., Colbran, R. J., and Limbird, L. E. (2001) Agonist-Regulated Interaction between alpha2-Adrenergic Receptors and Spinophilin. J Biol Chem. 276, 15003-15008.

  9. Prezeau, L., Richman, J. G., Edwards, S. W., and Limbird, L. E. (1999) The Zeta Isoform of 14-3-3 Proteins Interacts with the Third Intracellular Loop of Different alpha2-Adrenergic Receptor Subtypes. J Biol Chem. 274, 13462-13469.

  10. Dalman, H. M., and Neubig, R. R. (1991) Two Peptides from the Alpha 2A-Adrenergic Receptor Alter Receptor G Protein Coupling by Distinct Mechanisms. J Biol Chem. 266, 11025-11029.

  11. Eason, M. G., and Liggett, S. B. (1996) Chimeric Mutagenesis of Putative G-Protein Coupling Domains of the alpha2A-Adrenergic Receptor. Localization of Two Redundant and Fully Competent Gi Coupling Domains. J Biol Chem. 271, 12826-12832.

  12. Wade, S. M., Lim, W. K., Lan, K. L., Chung, D. A., Nanamori, M., and Neubig, R. R. (1999) G(i) Activator Region of Alpha(2A)-Adrenergic Receptors: Distinct Basic Residues Mediate G(i) Versus G(s) Activation. Mol Pharmacol. 56, 1005-1013.

  13. Eason, M. G., and Liggett, S. B. (1995) Identification of a Gs Coupling Domain in the Amino Terminus of the Third Intracellular Loop of the Alpha 2A-Adrenergic Receptor. Evidence for Distinct Structural Determinants that Confer Gs Versus Gi Coupling. J Biol Chem. 270, 24753-24760.

  14. Edwards, S. W., and Limbird, L. E. (1999) Role for the Third Intracellular Loop in Cell Surface Stabilization of the alpha2A-Adrenergic Receptor. J Biol Chem. 274, 16331-16336.

  15. Jewell-Motz, E. A., Donnelly, E. T., Eason, M. G., and Liggett, S. B. (1997) Role of the Amino Terminus of the Third Intracellular Loop in Agonist-Promoted Downregulation of the alpha2A-Adrenergic Receptor. Biochemistry. 36, 8858-8863.

  16. Nicholas, A. P., Pieribone, V., and Hokfelt, T. (1993) Distributions of mRNAs for Alpha-2 Adrenergic Receptor Subtypes in Rat Brain: An in Situ Hybridization Study. J Comp Neurol. 328, 575-594.

  17. Scheinin, M., Lomasney, J. W., Hayden-Hixson, D. M., Schambra, U. B., Caron, M. G., Lefkowitz, R. J., and Fremeau, R. T.,Jr. (1994) Distribution of Alpha 2-Adrenergic Receptor Subtype Gene Expression in Rat Brain. Brain Res Mol Brain Res. 21, 133-149.

  18. Wang, R., Macmillan, L. B., Fremeau, R. T.,Jr, Magnuson, M. A., Lindner, J., and Limbird, L. E. (1996) Expression of Alpha 2-Adrenergic Receptor Subtypes in the Mouse Brain: Evaluation of Spatial and Temporal Information Imparted by 3 Kb of 5' Regulatory Sequence for the Alpha 2A AR-Receptor Gene in Transgenic Animals. Neuroscience. 74, 199-218.

  19. Saunders, C., and Limbird, L. E. (1999) Localization and Trafficking of alpha2-Adrenergic Receptor Subtypes in Cells and Tissues. Pharmacol Ther. 84, 193-205.

  20. Dorn, G. W.,2nd, Oswald, K. J., McCluskey, T. S., Kuhel, D. G., and Liggett, S. B. (1997) Alpha 2A-Adrenergic Receptor Stimulated Calcium Release is Transduced by Gi-Associated G(Beta Gamma)-Mediated Activation of Phospholipase C. Biochemistry. 36, 6415-6423.

  21. Eason, M. G., Kurose, H., Holt, B. D., Raymond, J. R., and Liggett, S. B. (1992) Simultaneous Coupling of Alpha 2-Adrenergic Receptors to Two G-Proteins with Opposing Effects. Subtype-Selective Coupling of Alpha 2C10, Alpha 2C4, and Alpha 2C2 Adrenergic Receptors to Gi and Gs. J Biol Chem. 267, 15795-15801.

  22. Altman, J. D., Trendelenburg, A. U., MacMillan, L., Bernstein, D., Limbird, L., Starke, K., Kobilka, B. K., and Hein, L. (1999) Abnormal Regulation of the Sympathetic Nervous System in alpha2A-Adrenergic Receptor Knockout Mice. Mol Pharmacol. 56, 154-161.

  23. Hein, L., Altman, J. D., and Kobilka, B. K. (1999) Two Functionally Distinct alpha2-Adrenergic Receptors Regulate Sympathetic Neurotransmission. Nature. 402, 181-184.

  24. Vonend, O., Habbel, S., Stegbauer, J., Roth, J., Hein, L., and Rump, L. C. (2007) Alpha(2A)-Adrenoceptors Regulate Sympathetic Transmitter Release in Mice Kidneys. Br J Pharmacol. 150, 121-127.

  25. Scheibner, J., Trendelenburg, A. U., Hein, L., and Starke, K. (2001) Alpha2-Adrenoceptors Modulating Neuronal Serotonin Release: A Study in alpha2-Adrenoceptor Subtype-Deficient Mice. Br J Pharmacol. 132, 925-933.

  26. Bucheler, M. M., Hadamek, K., and Hein, L. (2002) Two Alpha(2)-Adrenergic Receptor Subtypes, Alpha(2A) and Alpha(2C), Inhibit Transmitter Release in the Brain of Gene-Targeted Mice. Neuroscience. 109, 819-826.

  27. Rosengren, A. H., Jokubka, R., Tojjar, D., Granhall, C., Hansson, O., Li, D. Q., Nagaraj, V., Reinbothe, T. M., Tuncel, J., Eliasson, L., Groop, L., Rorsman, P., Salehi, A., Lyssenko, V., Luthman, H., and Renstrom, E. (2010) Overexpression of alpha2A-Adrenergic Receptors Contributes to Type 2 Diabetes. Science. 327, 217-220.

  28. Liggett, S. B. (2009) Alpha2A-Adrenergic Receptors in the Genetics, Pathogenesis, and Treatment of Type 2 Diabetes. Sci Transl Med. 1, 12ps15.

  29. Langberg, E. C., Seed Ahmed, M., Efendic, S., Gu, H. F., and Ostenson, C. G. (2013) Genetic Association of Adrenergic Receptor Alpha 2A with Obesity and Type 2 Diabetes. Obesity (Silver Spring). 21, 1720-1725.

  30. Talmud, P. J., Cooper, J. A., Gaunt, T., Holmes, M. V., Shah, S., Palmen, J., Drenos, F., Shah, T., Kumari, M., Kivimaki, M., Whittaker, J., Lawlor, D. A., Day, I. N., Hingorani, A. D., Casas, J. P., and Humphries, S. E. (2011) Variants of ADRA2A are Associated with Fasting Glucose, Blood Pressure, Body Mass Index and Type 2 Diabetes Risk: Meta-Analysis of Four Prospective Studies. Diabetologia. 54, 1710-1719.

  31. Boesgaard, T. W., Grarup, N., Jorgensen, T., Borch-Johnsen, K., Meta-Analysis of Glucose and Insulin-Related Trait Consortium (MAGIC), Hansen, T., and Pedersen, O. (2010) Variants at DGKB/TMEM195, ADRA2A, GLIS3 and C2CD4B Loci are Associated with Reduced Glucose-Stimulated Beta Cell Function in Middle-Aged Danish People. Diabetologia. 53, 1647-1655.

  32. Savontaus, E., Fagerholm, V., Rahkonen, O., and Scheinin, M. (2008) Reduced Blood Glucose Levels, Increased Insulin Levels and Improved Glucose Tolerance in alpha2A-Adrenoceptor Knockout Mice. Eur J Pharmacol. 578, 359-364.