Phenotypic Mutation 'typhoon' (pdf version)
List |< first << previous [record 537 of 584] next >> last >|
Alleletyphoon
Mutation Type critical splice donor site
Chromosome11
Coordinate60,487,425 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Myo15
Gene Name myosin XV
Synonym(s) sh2; sh-2; Myo15a
Chromosomal Location 60,469,339-60,528,369 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010862NM_182698NM_001103171; MGI:1261811

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000071777] [ENSMUSP00000080507] [ENSMUSP00000091686]
SMART Domains Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
MyTH4 2049 2195 1.8e-42 SMART
low complexity region 2396 2405 N/A INTRINSIC
low complexity region 2451 2461 N/A INTRINSIC
Blast:MYSc 2665 2848 2e-14 BLAST
SH3 2851 2933 1.55e-4 SMART
low complexity region 2949 2962 N/A INTRINSIC
MyTH4 3031 3185 5.59e-48 SMART
B41 3188 3400 6.94e-3 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
MYSc 13 697 N/A SMART
IQ 698 720 1.63e-1 SMART
IQ 721 743 1.77e-2 SMART
IQ 744 766 2.97e2 SMART
low complexity region 787 801 N/A INTRINSIC
MyTH4 844 990 1.8e-42 SMART
low complexity region 1191 1200 N/A INTRINSIC
low complexity region 1246 1256 N/A INTRINSIC
Blast:MYSc 1460 1643 7e-15 BLAST
SH3 1646 1728 1.55e-4 SMART
low complexity region 1744 1757 N/A INTRINSIC
MyTH4 1826 1980 5.59e-48 SMART
B41 1983 2195 6.94e-3 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1974 1988 N/A INTRINSIC
MyTH4 2031 2177 1.8e-42 SMART
low complexity region 2378 2387 N/A INTRINSIC
low complexity region 2433 2443 N/A INTRINSIC
Blast:MYSc 2647 2830 2e-14 BLAST
SH3 2833 2915 1.55e-4 SMART
low complexity region 2931 2944 N/A INTRINSIC
MyTH4 3013 3167 5.59e-48 SMART
B41 3170 3382 6.94e-3 SMART
Predicted Effect probably null
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological
NALP3 inflammasome signaling defect
NLRP3 inflammasome: low response
Penetrance  
Alleles Listed at MGI

All alleles(13) : Targeted(6) Spontaneous(2) Chemically induced (ENU)(3) Chemically induced (other) (1) Radiation induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Myo15 APN 11 60477779 missense probably damaging 1.00
IGL01011:Myo15 APN 11 60476992 missense probably benign 0.33
IGL01100:Myo15 APN 11 60511158 missense probably damaging 1.00
IGL01357:Myo15 APN 11 60502289 unclassified probably benign
IGL01634:Myo15 APN 11 60495472 missense probably damaging 1.00
IGL01763:Myo15 APN 11 60521738 missense probably benign 0.07
IGL01901:Myo15 APN 11 60527434 utr 3 prime probably benign
IGL01931:Myo15 APN 11 60496138 missense probably damaging 1.00
IGL02006:Myo15 APN 11 60511128 missense probably damaging 1.00
IGL02041:Myo15 APN 11 60506863 missense probably damaging 0.99
IGL02094:Myo15 APN 11 60510647 unclassified probably benign
IGL02122:Myo15 APN 11 60483466 missense probably benign 0.23
IGL02153:Myo15 APN 11 60498397 missense probably damaging 1.00
IGL02328:Myo15 APN 11 60526607 missense probably benign 0.13
IGL02330:Myo15 APN 11 60477161 missense possibly damaging 0.94
IGL02431:Myo15 APN 11 60510639 unclassified possibly damaging 0.73
IGL02639:Myo15 APN 11 60478621 missense probably benign
IGL02659:Myo15 APN 11 60491783 unclassified probably benign
IGL02800:Myo15 APN 11 60502369 missense probably damaging 1.00
IGL02812:Myo15 APN 11 60477179 missense probably benign 0.15
IGL02863:Myo15 APN 11 60478127 missense probably damaging 1.00
IGL02873:Myo15 APN 11 60483482 missense probably damaging 1.00
IGL02990:Myo15 APN 11 60479440 missense probably benign 0.02
IGL03011:Myo15 APN 11 60509531 unclassified probably benign
IGL03243:Myo15 APN 11 60496518 missense probably damaging 1.00
IGL03297:Myo15 APN 11 60479141 missense probably damaging 1.00
parker UTSW 11 60520914 critical splice donor site probably null
PIT4131001:Myo15 UTSW 11 60483127 missense probably damaging 1.00
PIT4131001:Myo15 UTSW 11 60495454 missense probably damaging 1.00
R0133:Myo15 UTSW 11 60477850 missense possibly damaging 0.94
R0265:Myo15 UTSW 11 60514897 critical splice acceptor site probably null
R0389:Myo15 UTSW 11 60478538 missense probably benign
R0416:Myo15 UTSW 11 60511174 missense probably damaging 1.00
R0449:Myo15 UTSW 11 60509596 missense possibly damaging 0.92
R0477:Myo15 UTSW 11 60520914 critical splice donor site probably null
R0543:Myo15 UTSW 11 60479051 missense probably benign
R0546:Myo15 UTSW 11 60506313 missense probably damaging 1.00
R0555:Myo15 UTSW 11 60521638 missense probably damaging 1.00
R0639:Myo15 UTSW 11 60479336 missense probably benign 0.12
R0723:Myo15 UTSW 11 60478977 missense possibly damaging 0.94
R0837:Myo15 UTSW 11 60487251 missense probably damaging 0.98
R0865:Myo15 UTSW 11 60491688 missense probably damaging 1.00
R0899:Myo15 UTSW 11 60477185 missense possibly damaging 0.87
R1022:Myo15 UTSW 11 60479616 missense probably benign 0.00
R1024:Myo15 UTSW 11 60479616 missense probably benign 0.00
R1035:Myo15 UTSW 11 60510558 splice site probably benign
R1109:Myo15 UTSW 11 60493066 missense probably damaging 1.00
R1170:Myo15 UTSW 11 60479407 missense probably benign 0.04
R1241:Myo15 UTSW 11 60499430 missense possibly damaging 0.58
R1392:Myo15 UTSW 11 60477974 missense possibly damaging 0.95
R1392:Myo15 UTSW 11 60477974 missense possibly damaging 0.95
R1434:Myo15 UTSW 11 60504331 missense probably benign 0.00
R1450:Myo15 UTSW 11 60495482 missense probably damaging 1.00
R1456:Myo15 UTSW 11 60508202 missense probably damaging 1.00
R1468:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R1468:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R1548:Myo15 UTSW 11 60488238 missense probably damaging 1.00
R1551:Myo15 UTSW 11 60492965 missense possibly damaging 0.70
R1571:Myo15 UTSW 11 60518464 missense probably damaging 1.00
R1662:Myo15 UTSW 11 60501701 missense probably damaging 1.00
R1777:Myo15 UTSW 11 60514936 missense probably benign
R1778:Myo15 UTSW 11 60478412 missense possibly damaging 0.57
R1847:Myo15 UTSW 11 60499495 nonsense probably null
R1875:Myo15 UTSW 11 60507528 missense probably damaging 0.99
R1944:Myo15 UTSW 11 60502083 missense probably damaging 0.99
R1945:Myo15 UTSW 11 60502083 missense probably damaging 0.99
R2013:Myo15 UTSW 11 60494231 missense probably damaging 1.00
R2107:Myo15 UTSW 11 60491810 missense probably damaging 1.00
R2108:Myo15 UTSW 11 60491810 missense probably damaging 1.00
R2112:Myo15 UTSW 11 60494168 missense probably damaging 0.99
R2147:Myo15 UTSW 11 60510229 missense possibly damaging 0.66
R2196:Myo15 UTSW 11 60510021 nonsense probably null
R2207:Myo15 UTSW 11 60506034 missense probably benign 0.01
R2245:Myo15 UTSW 11 60509099 missense probably damaging 1.00
R2367:Myo15 UTSW 11 60517238 missense probably damaging 0.99
R2374:Myo15 UTSW 11 60478843 missense possibly damaging 0.88
R2438:Myo15 UTSW 11 60483052 missense probably damaging 1.00
R3154:Myo15 UTSW 11 60479360 unclassified probably null
R3423:Myo15 UTSW 11 60510300 critical splice donor site probably null
R3551:Myo15 UTSW 11 60509663 missense possibly damaging 0.93
R3552:Myo15 UTSW 11 60509663 missense possibly damaging 0.93
R3612:Myo15 UTSW 11 60477679 missense probably damaging 1.00
R3620:Myo15 UTSW 11 60478642 missense possibly damaging 0.63
R3713:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3714:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3715:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3783:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3784:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3785:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3786:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3787:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3894:Myo15 UTSW 11 60504319 missense probably benign 0.00
R3962:Myo15 UTSW 11 60479828 missense probably benign 0.00
R4082:Myo15 UTSW 11 60487196 missense possibly damaging 0.92
R4555:Myo15 UTSW 11 60496937 missense probably damaging 1.00
R4641:Myo15 UTSW 11 60503041 missense probably damaging 1.00
R4665:Myo15 UTSW 11 60504879 critical splice acceptor site probably null
R4713:Myo15 UTSW 11 60479930 missense probably benign 0.21
R4820:Myo15 UTSW 11 60476915 missense probably damaging 0.98
R5013:Myo15 UTSW 11 60491667 missense probably damaging 1.00
R5051:Myo15 UTSW 11 60487425 critical splice donor site probably null
R5187:Myo15 UTSW 11 60503614 missense probably damaging 1.00
R5230:Myo15 UTSW 11 60502848 missense possibly damaging 0.68
R5277:Myo15 UTSW 11 60477114 nonsense probably null
R5345:Myo15 UTSW 11 60497538 missense probably damaging 0.99
R5349:Myo15 UTSW 11 60493583 missense probably damaging 1.00
R5356:Myo15 UTSW 11 60498366 missense probably damaging 1.00
R5445:Myo15 UTSW 11 60520777 nonsense probably null
R5477:Myo15 UTSW 11 60477677 missense probably damaging 1.00
R5629:Myo15 UTSW 11 60479752 missense probably benign
R5728:Myo15 UTSW 11 60488896 missense probably damaging 1.00
R5818:Myo15 UTSW 11 60497951 missense probably benign 0.06
R5952:Myo15 UTSW 11 60479420 missense possibly damaging 0.50
R6338:Myo15 UTSW 11 60478133 missense probably damaging 0.99
R6467:Myo15 UTSW 11 60526661 critical splice donor site probably null
R6488:Myo15 UTSW 11 60478487 missense possibly damaging 0.86
R6521:Myo15 UTSW 11 60502369 missense probably damaging 1.00
R6645:Myo15 UTSW 11 60477292 missense probably benign 0.00
R6702:Myo15 UTSW 11 60492992 missense probably benign 0.16
R6703:Myo15 UTSW 11 60492992 missense probably benign 0.16
X0021:Myo15 UTSW 11 60482359 nonsense probably null
X0066:Myo15 UTSW 11 60478220 missense probably damaging 1.00
X0067:Myo15 UTSW 11 60478618 missense possibly damaging 0.88
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 2017-03-03 9:32 AM by Anne Murray
Record Created 2017-02-16 8:48 AM by Jamie Russell
Record Posted 2017-03-03
Phenotypic Description

Figure 1. The typhoon mice exhibit ataxia and head tilt.

The typhoon phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5051, some of which showed ataxia and a head tilt (Figure 1). Some mice also ran in circles.

Nature of Mutation

Figure 2. Linkage mapping of the behavioral phenotypes using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 54 mutations (X-axis) identified in the G1 male of pedigree R5051. Phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 54 mutations. The behavioral phenotypes were linked to two genes: Nlrp3 and Myo15. However, the mutation in Myo15 was presumed to be causative because the typhoon behavior phenotypes mimic other known alleles of Myo15 (see MGI for a list of Myo15 alleles as well as the entry for parker). The mutation in Myo15 a G to A transition at base pair 60,487,425(v38) on chromosome 11, or base pair 113,685 in the GenBank genomic region NC_000077 encoding Myo15; the mutation is within the donor splice site of intron 10.  Linkage was found with a recessive model of inheritance (P = 1.981 x 10-5), wherein four variant homozygotes departed phenotypically from 20 homozygous reference mice and 18 heterozygous mice with (Figure 2).  A substantial semidominant effect was also observed (P = 4.274 x 10-5). 

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in the use of a cryptic site in intron 10, resulting in a transcript that has an 8-base pair insertion on intron 10. This predicts a frame shifted protein product beginning after amino acid 1,386 of the protein, which is normally 3,511 amino acids in length, and terminating after the inclusion of 23 aberrant amino acids.


 
         <--exon 9     <--exon 10 intron 10-->             <--exon 11-->
17906 ……TTTCTAGAAGG ……ATTGTGTTCCAG gtaggcaggtcagag…… GCCAAAAATGAAA……TCCCTGCTCAACTAA…… 18927
1362  ……-F--L--E--G ……-I--V--F--Q-                   --P--K--M--K-……-S--L--L--N--*- 

                 correct                                       aberrant


 

The donor splice site of intron 10, which is destroyed by the typhoon mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 3. Domain structure of myosin XV. At its N-terminus, myosin XV has an N-terminal extension (NTE); isoform 3 does not have the NTE. Within the motor domain, myosin XV has an ATP- and actin-binding site. Two IQ motifs are located within the neck of myosin XV. The C-terminal tail contains two myosin tail homology 4 (MyTH4) domains, a Src homology 3 (SH3) domain, and a 4.1/ezrin/radixin/moesin (FERM) domain. A FERM-like domain is predicted based on sequence similarity to one in human myosin VIIa, however, the precise location in mouse myosin XV has not been documented. At the C-terminus, myosin XV has a PDZ-ligand motif (ITLL*). The typhoon mutation (red asterisk) is located in the donor splice site of intron 10. See the text for more details.

Myo15 encodes myosin XV (alternatively, Myosin XVa), a 3,511 amino acid member of the unconventional myosin family. Myosin XV has a proline-rich N-terminal extension that does not have sequence similarity to reported proteins and the function is unknown [Figure 3; amino acids 1-1200; SMART; (1-3)]. Myosin XV has a highly conserved motor domain (amino acids 1200-1884; NM_010862SMART) following the N-terminal extension (2). The motor domain contains an adenosine triphosphate (ATP)- and an actin-binding site (amino acids 1299-1306 and 1776-1783, respectively; Uniprot) (4-6). The myosin neck region contains a variable number of light-chain binding (IQ) motifs (IQxxxRGxxxRK) and is linked to the motor domain by a converter region [(7); reviewed in (8;9)]. Myosin XV has two IQ motifs (amino acids 1909-1920; LQRCLRGFFIKR and amino acids 1932-1943; LQSRARGYLARQ) (5;8;9). The IQ motif is an α-helical structure that often mediates the binding of myosins to calmodulin, members of the EF-hand family of calcium-binding proteins, or myosin light chains [reviewed in (8;9)]. The myosin XV tail region is 1584 amino acids in length and has two myosin tail homology 4 (MyTH4) domains (amino acids 2049-2195 and 3031-3185; SMART), a band 4.1/ezrin/radixin/moesin (FERM)-like domain (amino acids 2687-2867, human myosin XVa), a Src homology 3 (SH3) domain (amino acids 2851-2933), and a FERM domain (alternatively, talin-like domain; amino acids 3188-3400) (1;2;10;11). The MyTH4 domain is proposed to function in microtubule binding as well as in actin binding to the plasma membrane (12). The FERM domain of myosin XV is proposed to be involved in anchoring myosin XV to the cell membrane (1). The function of the myosin XV SH3 domain is unknown, but it is proposed to mediate an intramolecular interaction with a region in the proline-rich N-terminal extension to regulate the activity of myosin XV (2). Myosin XV is unique among the myosins in that it has a predicted class I PDZ-ligand motif (ITLL*) at the C-terminus (11;13;14). The PDZ-ligand motif of myosin XV is required for association of myosin XV with whirlin as well as the localization of whirlin to stereocilia tips (13;15).

 

The typhoon mutation is predicted to result in a frame-shift and coding of a premature stop codon within exon 10. Premature truncation of myosin XV within exon 10 would result in loss in a portion of the motor domain and the domains following the motor domain.

Putative Mechanism

Myosin XV functions in the assembly and maintenance of actin organization in hair cells of the inner ear by acting as a motor and carrier along the length of the actin filament within the hair cells (16). Myosin XV senses the tension between the plasma membrane and the actin filaments, a function that is necessary in the growth of the steocilia (11). Myosin XV contributes to the elongation of stereocilia by delivering whirlin, a multi-PDZ domain-containing scaffold protein, to the stereocilia tips (13). Both myosin XV and whirlin are required for the elongation and staircase formation of the stereocilia bundle and myosin XV and whirlin may function as part of a complex that modulates the growth of actin bundles in the stereocilia (11;13). Another proposed function of myosin XV is the maintenance of the hair cell mechanotransduction apparatus at the tips of the stereocilia (4;13). Two myosin XV mutant mouse models, shaker 2 (Myo15sh2; MGI:1857036) and shaker 2(Myo15sh2J; MGI:1889795) have been characterized. Both the shaker 2 and shaker 2J mice have abnormally short stereocilia bundles on the inner ear hair cells compared to wild-type mice; the bundles are correctly positioned (1;4). As a result, the shaker 2 and shaker 2J homozygous mice are congenitally deaf and exhibit vestibular defects that cause head-tossing and circling behavior (2-4). Similar to the shaker 2J mice, the typhoon mice exhibit head-tossing and circling behavior. Anderson et al. propose that the myosin XVshaker 2J protein is unable to exert force on the actin cytoskeleton because the truncated protein is improperly anchored, resulting in a failure to form the scaffolding to form the normal stereocilia structure (1).  

Primers PCR Primer
typhoon(F):5'- AGGAATGACAACTCCAGCCG -3'
typhoon(R):5'- AAGTGACAGGTTGCAGGCTC -3'

Sequencing Primer
typhoon_seq(F):5'- GAATGACAACTCCAGCCGCTTTG -3'
typhoon_seq(R):5'- TTGCAGGCTCAGGAACAC -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsLauren Prince, Jamie Russell, and Bruce Beutler
List |< first << previous [record 537 of 584] next >> last >|