Phenotypic Mutation 'r18'

• Allele: r18
• Mutation Type: small insertion
• Chromosome: 19
• Gene: Lrp5
• Gene Name: low density lipoprotein receptor-related protein 5
• Synonym(s): LRP7, LR3
• Chromosomal Location: 3,634,828-3,736,564 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane low-density lipoprotein receptor that binds and internalizes ligands in the process of receptor-mediated endocytosis. This protein also acts as a co-receptor with Frizzled protein family members for transducing signals by Wnt proteins and was originally cloned on the basis of its association with type 1 diabetes mellitus in humans. This protein plays a key role in skeletal homeostasis and many bone density related diseases are caused by mutations in this gene. Mutations in this gene also cause familial exudative vitreoretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014] ; PHENOTYPE: Homozygous mutants show variable bone loss, decreased osteoblast proliferation, impaired glucose tolerance, increased plasma cholesterol on high-fat diet and persistent embryonic eye vascularization, depending on allelic combination and strain background. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Ref Sequences:
  Ensembl: ENSMUSP00000025856
• Gene Model: not available
• AlphaFold: Q91VN0
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably essential (E-score: 0.923)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: None
• Last Updated: 2017-03-24 8:25 AM by Katherine Timer
• Record Created: unknown
• Record Posted: 2008-03-11
• Science Writers: Nora G. Smart
• Authors: Chun-Hong Xia, Xin Du, Xiaohua Gong, Bruce Beutler

Accession Number

NCBI RefSeq: NM_008513; MGI: 1278315

Alleles Listed at MGI

All alleles(15) : Targeted, knock-out(5) Targeted, other(4) Gene trapped(5) Chemically induced(1)

Repository

MMRRC: 030412-UCD

Phenotypic Description

R18 mice were identified among G3 generation ENU-mutagenized mice by fundus examination using an indirect opthalmoscope (1). The fundus image of homozygous r18 mice revealed pale and attenuated retinal arteries and mild hypopigmentation. Some r18 mice develop retinal hemorrhage at weaning age, which disappears with increasing age without any treatment (Figure 1).  R18 retinas are hyperpermeable to fluorescein dye, and contain a lower density of retinal small vessels and/or capillaries than heterozygous controls. The retinal vasculature is both reduced and abnormally patterned in r18 mice, and vessels of the outer plexiform layer (OPL) are rarely formed. Transmission electron microscopic analysis of r18 mutant retinas found the presence of immature endothelial cells in lumen-less capillaries, suggesting that the vasculature of r18 retinas fails to fully develop.

 

Homozygotes and heterozygotes are viable and fertile with no gross abnormalities.

Nature of Mutation

The r18 mutation was mapped to Chromosome 19, and corresponds to the insertion of a single nucleotide, C, after position 4838 in the low density lipoprotein receptor-related protein 5 encoding gene (Lrp5) transcript. This causes a frameshift after codon 1576, which encodes proline. The frameshift is predicted to replace the C-terminal 39 amino acids of LRP5 with 20 aberrant amino acids, and to cause premature termination at codon 1596 in exon 23 of 23 total exons.

4825  CCCCCCCCCGCCCACCCCCCACAGCCAGTACCTATCTGCAGAGGACAGCTGCCCACCCTCACCAGGCACTGA 4896
1574  -P--P--P--A--H--P--P--Q--P--V--P--I--C--R--G--Q--L--P--T--L--T--R--H--*  1596
         correct                       aberrant residues

The inserted nucleotide is indicated in red lettering.

Protein Prediction

The Lrp5 gene, like its human orthologue mapped to 11q13, encodes a type I single-span transmembrane protein with 1615 amino acid residues in humans and 1614 amino acids in mice.  The human and mouse LRP5 proteins are 95% identical (2).  Vertebrate LRP5 (low-density lipoprotein receptor-related protein 5) is a member of the LDL receptor (LDLR) family, and belongs to a subfamily that consists of the highly homologous LRP6 and the Drosophila homologue Arrow (3).  These proteins function as Wnt (wingless-related MMTV integration site) co-receptors and play critical roles in canonical Wnt/β-catenin signaling (4).

 

The LRP5/6 extracellular domain has three basic domains that define all LDLR family members: the YWTD (tyrosine, tryptophan, threonine, and aspartic acid) β-propeller domain, the EGF (epidermal growth factor)-like domain, and the LDLR type A (LA) domain (2;4;5) (Figure 1).  Each YWTD-type β-propeller domain has six YWTD repeats of 43-50 amino acid residues with the conserved YWTD residues located at the beginning of each repeat, and forms a six-bladed β-propeller structure (6).  LRP5 has four such β-propeller domains that are each followed by an EGF-like domain, which contains approximately 40 amino acids with six conserved cysteine residues, and feature an NGGC (asparagine, glycine, glycine, cysteine) motif. Following the β-propeller/EGF-like repeats are three LA domains, which bind to ligand in the LDL receptor.  It is unknown whether these sites in LRP5/6 interact with Wnt factors, but the β-propeller/EGF-like domains appear to bind extracellular ligands.  The first two sets of β-propeller/EGF-like domains bind Wnts, and two related proteins Wise (Wnt modulator in surface ectoderm), and Sclerostin/SOST (an osteoclast-secreted protein affected in sclerosteosis OMIM #269500) (7-12), while the last two sets of β-propeller/EGF-like domains bind Dickkopf (Dkk) ligands (11;13). Dkk, Wise, and SOST are secreted proteins that antagonize Wnt/β-catenin signaling (4;11-13).  The LA domains contain conserved cysteine residues, as well as a SDE (serine, aspartic acid, glutamic acid) motif.  There are 13 amino acids separating the LA domains from the transmembrane spanning domain of 23 residues from 1386 to 1408.  The extracellular domain of LRP5 has six potential sites for N-linked glycosylation at residues 93, 138, 446, 499, 705 and 878 (2;5).

 

The LRP5/6 intracellular domain is unique from other LDLR proteins and consists of 207 amino acid residues of which 15-20% are prolines and 15-20% are serines.  Scattered through the intracellular region are five conserved PPP(S/T)P motifs (4).  During Wnt signaling, these domains become phosphorylated and are then able to bind Axin, and recruit it to the plasma membrane (8).  Axin plays a critical role in Wnt/β-catenin signaling (see Background).  The PPP(S/T)P motifs have some similarity with SH3 and EVH1 domains.  SH3 domains are found in many scaffolding/signaling molecules (14), while EVH1 domains are present in a family of signaling proteins involved in actin cytoskeletal regulation (15).  LRP5/6 also contains putative internalization signals (4).

 

The r18 mutation disrupts the C-terminal 39 amino acids of LRP5 including the last three PPP(S/T)P repeats (1).

Expression/Localization

Both LRP5 and LRP6 are widely co-expressed during embryogenesis and in adult tissues.  Human Lrp5 mRNA is detected in most adult and fetal tissues, except testis, bone marrow, peripheral leukocyte and various regions of the brain.  The highest expression levels are found in aorta.  In addition, the tissues of the female reproductive system, including uterus, mammary gland, ovary and placenta all show relatively abundant mRNA levels.  Differential expression levels of Lrp5 mRNA in fetal versus adult tissues are noticeable in spleen, lung and kidney, with higher expression levels seen in fetal tissues (2;5).  

 

During mouse development, Lrp5 is expressed in early embryos beginning prior to gastrulation in visceral endoderm overlying the extra-embryonic ectoderm.  At this stage, Lrp5 is not expressed in mesoderm or definitive endoderm exiting the primitive streak (16).  Later in development and in the adult, immunohistochemistry studies revealed expression in developing osteoblasts (17), macrophages associated with the vitreous microvasculature in the eye, pancreas, spleen, and thymus (9;18), islets of Langerhans, and CNS neurons.  LRP5 expression is also found in two types of vitamin-A metabolizing cell: hepatic stellate cells, and cells of the retinal pigmented epithelium (RPE) (18).  More recently, a Lrp5 reporter gene was reported to be expressed in the endothelial cells of the eye microvasculature (19). In the eye, reporter gene expression is highest in the retinal glia Müller cells (20).

Background

Wnt proteins regulate many stages of development, from patterning of the embryo and generation of tissues and cell types, to regulation of cell movements, polarity, axon guidance and synapse formation (21-23).  Defective Wnt signaling plays major roles in diseases such as cancer and osteoporosis (21;24).  The first step in Wnt signaling is binding of ligand to receptor (Figure 4).  Wnt receptors include members of the Frizzled (Fzd) family of seven-pass transmembrane receptors (22), as well as LRP5/LRP6/Arrow (4), which function as co-receptors for Frizzled proteins.  Multiple studies suggest that Wnt ligands bind to both Frizzled and LRP5/6 receptors and induce a complex formation between Frizzled proteins and LRP5/6 (8;25).  Unlike Frizzled receptors, LRP5/6 specifically functions in canonical Wnt signaling.  Canonical Wnt signaling relies on the regulation of the stability/abundance of the β-catenin protein that acts as a nuclear co-activator for the TCF/LEF (T-cell factor/Lymphoid enhancer factor) family of transcription factors (26;27).  In the absence of Wnt signal, cytosolic β-catenin levels are low due to phosphorylation-dependent ubiquitination and subsequent degradation.  β-catenin phosphorylation involves the sequential actions of casein kinase 1 (CK1) and glycogen synthase kinase 3 (GSK3), and takes place in a protein complex assembled by Axin and APC (28).  Phosphorylated β-catenin is then recognized and ubiquitinated by a ubiquitin-ligase complex. Inhibition of β-catenin phosphorylation can occur through several mechanisms; degradation of the Axin protein, alteration of the Axin complex, or inhibition of CK1 or GSK3 activity (4).  In the absence of β-catenin, TCF/LEF suppresses Wnt-responsive gene expression.  Upon Wnt stimulation, β-catenin phosphorylation and degradation is inhibited, and β-catenin protein is available to associate with TCF/LEF to activate target gene expression. 

Figure 4. Wnt Signaling Pathways. Wnt glycoproteins are palmitolated by porcupine family proteins (Porcn) and secreted into the extracellular matrix with the assistance of the retromer complex. In the extracelluar matrix, heparan sulfate proteoglycans bind to Wnt proteins, stabilizing them for binding to the seven transmembrane Frizzled receptor and coreceptor LRP5 or LRP6. Several Wnt inhibitors, including Dickkopf (Dkk), Wnt-inhibitor protein (WIF), soluble Frizzled-related proteins (SFRP), Cerberus, Frzb, and Wise, bind Wnts or their receptors directly and prevent Wnt from interacting with LRP5/6 and Frizzled. Canonical Wnt/β-catenin pathway: In the absence of Wnt, β-catenin is constantly degraded. β-catenin is phosphorylated by glycogen synthase kinase 3 (GSK3) and casein kinase 1α (CK1α) in a destruction complex that also contains adenomatous polyposis coli (APC) and Axin. Phosphorylation allows association with β-TrCP, an E3 ubiquitin ligase subunit that targets β-catenin for proteasome-mediated degradation. Thus, β-catenin cannot travel to the nucleus and Wnt target genes are repressed by lymphoid enhancer-binding factor 1/T cell-specific transcription factor (LEF/TCF) proteins. Wnt binding to Frizzled and LRP5/6 results in recruitment of Dishevelled (Dsh) and Axin, and LRP5/6 phosphorylation by GSK3 and CK1γ. Dsh is also phosphorylated by casein kinase 1/2 (CK1/2), metastasis associated kinase (MAK), protein kinase C (PKC), and Par1. These events disrupt the β-catenin destruction complex, thereby permitting the stabilization of β-catenin, which accumulates in the cell and translocates into the nucleus where it associates with and coactivates LEF/TCF to stimulate target gene expression. The two non-canonical Wnt signaling pathways control cell polarization and migration and do not require LRP5/6 nor act through β-catenin. In the Planar Cell Polarity Pathway, Wnt-activated signals arising from Frizzled recruit Dsh to the cell membrane. Dsh activates cytoskeletal regulatory pathways, either directly (for Rac) or through Dishevelled associated activator of morphogenesis 1 (Daam1) (for Rho and profilin). In addition to cytoskeletal regulation, Rac also controls transcription through activation of JNK. In the Wnt/Ca²⁺ Pathway, binding of Wnt to Frizzled recruits G-proteins that activate Dsh. Several molecules subsequently control Ca²⁺ release from the endoplasmic reticulum, including Protein Kinase G (PKG) that inhibits Ca²⁺ release, and phospholipase C (PLC) that stimulates Ca²⁺ release through the generation of IP₃. Diacylglycerol (DAG), also generated by PLC, together with Ca²⁺, activates protein kinase C (PKC), leading to control of tissue separation through Cdc42. Ventral fate is regulated by the Wnt/Ca²⁺ pathway through the action of calcineurin and nuclear factor of activated T cells (NFAT). The Wnt/Ca²⁺ pathway also inhibits the canonical Wnt pathway through calcium/calmodulin-dependent protein kinase II (CamKII), TAK1, and NEMO. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

The eyes are bilaterally symmetrical organs that originate from a single field positioned in the anterior portion of the neural plate.  Eye formation is a complex process that involves multiple signaling pathways including Wnt signaling.  During embryogenesis, the development and differentiation of the eye requires the concomitant formation of the neural/glial elements along with a dense vascular network.  Blood vessels that supply the inner portion of the retina are extensively reorganized during development.  Initially, the inner part of the eye is metabolically supported by the hyaloid vasculature, an arterial network in the vitreous. In the latter stages of development, the hyaloid vasculature is replaced by the retinal vasculature.  This switch occurs in humans around mid-gestation and in mice around birth (29).  As hyaloid vessels regress, a vascular plexus emerges from the optic nerve head giving rise to the retinal vasculature. This primary vessel plexus remodels into three parallel inter-connected networks, located in the nerve fiber layer and the plexiform layers.  Vessels at the periphery of the retina are less mature than more central vessels during early postnatal development.  The outer plexiform layer (OPL) of the retinal vasculature develops by sprouting from the primary plexus.  Development of the outer plexus is disrupted by mutations in the Wnt receptor Frizzled 4 (FZD4), as well as the Norrie disease gene NDPH.  Norrie disease is characterized by retinal and mental defects, as well as deafness (OMIM #310600) (30).  NDPH and FZD4 are a ligand-receptor pair mediating activation of canonical Wnt signaling (31).  Mutations in these genes are also known to cause FEVR (see below).  In mice, regression of the embryonic hyaloid vessels can be inhibited by ablating macrophages (32).  The interaction between macrophages and blood vessels involves signaling of macrophage-secreted Wnt7b via FZD4 and LRP5 present on endothelial cells (19;31).

 

Genetic studies have linked mutant LRP5 proteins to various human diseases, including osteoporogenic-pseudoglioma syndrome (OPPG, OMIM #259770), familial exudative vitreoretinopathy (FEVR, OMIM #133780), and high bone mass (OMIM #601884).  OPPG is a recessive condition characterized by severe osteoporosis and eye defects due to remnants of embryonic hyaloid vessels in the eye (17;24).  FEVR is a genetically heterogeneous eye disease characterized by incomplete vascularization of the peripheral retina.  FEVR patients also exhibit low bone mass. Mutations of FZD4 and its ligand NDPH cause autosomal-dominant FEVR in some patients (31;33;34), while LRP5 mutations have been found to cause autosomal-dominant or recessive FEVR in humans (4;35;36).  Both OPPG and FEVR mutations in LRP5 are loss-of-function mutations.  Heterozygotes carrying these mutations often display a reduction in bone density (17).  LRP5 gain-of-function mutations in humans, typically clustered in the first β-propeller region of LRP5 (37-39), result in high bone mass.  As mentioned above (Protein Prediction), the Wnt antagonist Sclerostin/SOST binds to this region in LRP5 and is mutated in sclerosteosis, a rare autosomal-recessive bone disorder characterized by skeletal overgrowth and high bone density (OMIM #269500) (12).    

 

Lrp5^-/- mice have normal embryogenesis, grow to adulthood and are fertile, but have phenotypes strongly resembling OPPG syndrome in humans (9).  Transgenic mice expressing a missense form of LRP5, known to cause high bone mass in humans, exhibit a similar phenotype (40).  Lrp5^-/- animals also have metabolic defects that include impaired glucose tolerance and cholesterol metabolism (41).  Pancreatic islets isolated from Lrp5^-/- animals display a reduction in glucose-induced insulin secretion due to decreased levels of intracellular ATP and Ca²⁺ in response to glucose as well as reduced expression of genes involved in glucose sensing.  Wnts are able to stimulate glucose-induced insulin secretion from normal islets, while Lrp5-deficient islets are unresponsive.  When fed high-fat diets, Lrp5^-/- animals have increased levels of plasma cholesterol due to decreased hepatic clearance of remnants of cholesterol-carrying chylomicrons, which are large lipoprotein molecules.  LRP5 binds to apoliprotein E (apoE), a major component of chylomicrons (42).  The role of LRP5 in cholesterol metabolism is similar to classical LDLR function and is probably Wnt independent (43).

 

LRP6 appears to be redundant for LRP5 during development and in many tissues. Lrp6^-/- embryos are perinatal lethal and exhibit mid/hindbrain defects, posterior truncation and abnormal limb patterning, which resemble defects of mice mutant for some Wnts (please see gimpy) (44).  Lrp5/6 double mutants die much earlier during gastrulation and lack the primitive streak and nascent mesoderm (16).

Putative Mechanism

Lrp5^r18 mutation results in a truncated LRP5 protein that lacks the last three PPP(S/T)P repeats in the C-terminus.  This is likely to be a loss-of-function mutation as Lrp5 knockout mice exhibit similar defects in retinal vasculature (1).  The Wnt/β-catenin pathway is probably impaired in r18 mutants as multiple lines of evidence suggest that the intracellular domain of LRP5, particularly the PPP(S/T)P repeats, is necessary for Axin binding and canonical Wnt signaling (4;7;8;17).  Mutant LRP5 proteins lacking the extracellular domain constitutively bind to Axin and induce LEF-1 activation by destabilizing Axin and stabilizing β-catenin, and LRP5 proteins lacking the last three PPP(S/T)P domains are unable to bind to Axin in vitro (7).  Furthermore, the transfer of a PPP(S/T)P motif to the LDL receptor activates the Wnt pathway in vitro (8).

 

The Wnt/β-catenin pathway is involved in the regression of embryonic hyaloid vessels in the eye.  Mice with a hypomorphic allele of Wnt7b and mice mutant for Fzd4 display persistence of the hyaloid vessels (19;31).  Furthermore, Lrp5 knockout animals also display this phenotype (9).  It is interesting that many of the mutations affecting this process also affect the development of the adult retinal vasculature, particularly the OPL, suggesting that the same signaling pathways are used in both systems (29).  Mutations in NDPH, a non-Wnt ligand that binds to the FZD4 receptor, affect both retinal vasculature and regression of the hyaloid vessels (33;45).  This suggests that signaling through FZD4/LRP5 may be induced by either Wnt7b or NDPH. A role for Wnt7b in development of the adult retinal vasculature has not been demonstrated.  Hyaloid regression occurs through macrophage-induced death of the endothelial cells present in the vessels (19;32). In the retina, LRP5 expression in both endothelial cells of the microvasculature as well as retinal Müller cells suggests that Wnt signaling in either of these two cell types could be responsible for the lack of vasculature present in Lrp5 mutant mice.  Müller cells, in particular, may be important considering the high levels of Lrp5 expression in these cells (20).

Lrp5 mutant animals display a reduction of a Müller cell-specific glutamine transporter, Slc38a5, and showed a decrease in b-wave amplitude of electroretinogram (ERG) (20). The a-wave of an ERG is produced by photoreceptors while a mixture of retinal cells, including Müller cells, contributes to the b-wave.  Interestingly, the angiogenesis factor VEGF (vascular endothelial growth factor) and its receptor are transiently expressed in Müller cells prior to vascularization (46;47), and decreased Slc38a5 is also seen in Ndph knockout mice (48).  NDPH in Müller cells has been shown to activate FZD4 in endothelial cells (49).  Although  LRP5 is a co-receptor for FZD4, the phenotypes of Lrp5 knockout and Fzd4 knockout mice differ as FZD4 deficient animals also display defects in the vessels of the surface ganglion cell layer.  It is possible that LRP6 compensates for LRP5 function in this region.

 

Considering the diverse roles of canonical Wnt signaling in development and disease, it is likely LRP5 has additional roles beyond those described to date.  Wnt signaling has been shown to be important at multiple stages of eye development and is necessary for the specification of the eye field as well as appropriate retinal and lens development.  LRP5 has been shown to be expressed in many tissues in both the embryo and adult, including the RPE of the eye (18).  It is likely LRP6 has functional redundancy with LRP5 during early eye development (16;44), but it is possible that additional non-redundant roles for LRP5 remain to be discovered.

Primers

Primers cannot be located by automatic search.

Genotyping

R18 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. This protocol has not been tested.

 

Primers for PCR amplification

R18(F): 5’- CCACCACCACAGTATGCCTTTAGG -3’

R18(R): 5’- CCACTGTACAAAGTTTTCCCAGCCC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

R18_seq(F): 5’- TGGAACTCACTTTGTAGACCAGG -3’

R18_seq(R): 5’- CACATTTCTCACTTGTTAAAAATCCC -3’

 

The following sequence of 709 nucleotides (from Genbank genomic region NC_000085 for linear DNA sequence of Lrp5) is amplified:

 

100984    ccaccac cacagtatgc ctttaggaaa tctttctttt tttttttttt tttttttttt

101041 tttttttttg gtttttcgag acagggtttc tctttatagc tcctctggct gtctgtcttg

101101 gaactcactt tgtagaccag gctggcctcg aactcagaaa tccgcctgcc tctgcctccc

101161 gagtgctggg attaaaggcg tgcgccacca cacccggctc aaggagcagc cttgtacaca

101221 ggtggctagg cacacatgtg aacttcttct gtgttccttc taggccctac gtcattcgag

101281 gtatggcacc cccaacaaca ccgtgcagca cagatgtgtg tgacagtgac tacagcacca

101341 gtcgctggaa gagcagcaaa tactacctgg acttgaattc ggactcagac ccctaccccc

101401 cccccgcccac cccccacagc cagtacctat ctgcagagga cagctgccca ccctcaccag

101461 gcactgagag gagttactgc cacctcttcc cgcccccacc gtccccctgc acggactcgt

101521 cctgacctcg gccgtccacc cggccctgct gcctccctgt aaatattttt aaatatgaac

101581 aaaggaaaaa tatattttat gatttaaaaa ataaatataa ttgggatttt taacaagtga

101641 gaaatgtgag cggtgaaggg gtgggcaggg ctgggaaaac tttgtacagt gg

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the inserted C is shown in red text.

References

     1.  Xia, C. H., Liu, H., Cheung, D., Wang, M., Cheng, C., Du, X., Chang, B., Beutler, B., and Gong, X. (2008) A model for familial exudative vitreoretinopathy caused by LPR5 mutations, Hum. Mol. Genet.

     2.  Hey, P. J., Twells, R. C., Phillips, M. S., Yusuke, N., Brown, S. D., Kawaguchi, Y., Cox, R., Guochun, X., Dugan, V., Hammond, H., Metzker, M. L., Todd, J. A., and Hess, J. F. (1998) Cloning of a novel member of the low-density lipoprotein receptor family, Gene 216, 103-111.

     3.  Hussain, M. M., Strickland, D. K., and Bakillah, A. (1999) The mammalian low-density lipoprotein receptor family, Annu. Rev. Nutr. 19, 141-172.

     4.  He, X., Semenov, M., Tamai, K., and Zeng, X. (2004) LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the way, Development 131, 1663-1677.

     5.  Dong, Y., Lathrop, W., Weaver, D., Qiu, Q., Cini, J., Bertolini, D., and Chen, D. (1998) Molecular cloning and characterization of LR3, a novel LDL receptor family protein with mitogenic activity, Biochem. Biophys. Res. Commun. 251, 784-790.

     6.  Jeon, H., Meng, W., Takagi, J., Eck, M. J., Springer, T. A., and Blacklow, S. C. (2001) Implications for familial hypercholesterolemia from the structure of the LDL receptor YWTD-EGF domain pair, Nat. Struct. Biol. 8, 499-504.

     7.  Mao, J., Wang, J., Liu, B., Pan, W., Farr, G. H., III, Flynn, C., Yuan, H., Takada, S., Kimelman, D., Li, L., and Wu, D. (2001) Low-density lipoprotein receptor-related protein-5 binds to Axin and regulates the canonical Wnt signaling pathway, Mol. Cell 7, 801-809.

     8.  Tamai, K., Semenov, M., Kato, Y., Spokony, R., Liu, C., Katsuyama, Y., Hess, F., Saint-Jeannet, J. P., and He, X. (2000) LDL-receptor-related proteins in Wnt signal transduction, Nature 407, 530-535.

     9.  Kato, M., Patel, M. S., Levasseur, R., Lobov, I., Chang, B. H., Glass, D. A., Hartmann, C., Li, L., Hwang, T. H., Brayton, C. F., Lang, R. A., Karsenty, G., and Chan, L. (2002) Cbfa1-independent decrease in osteoblast proliferation, osteopenia, and persistent embryonic eye vascularization in mice deficient in Lrp5, a Wnt coreceptor, J Cell Biol. 157, 303-314.

    10.  Liu, G., Bafico, A., Harris, V. K., and Aaronson, S. A. (2003) A novel mechanism for Wnt activation of canonical signaling through the LRP6 receptor, Mol. Cell Biol. 23, 5825-5835.

    11.  Itasaki, N., Jones, C. M., Mercurio, S., Rowe, A., Domingos, P. M., Smith, J. C., and Krumlauf, R. (2003) Wise, a context-dependent activator and inhibitor of Wnt signalling, Development 130, 4295-4305.

    12.  Semenov, M., Tamai, K., and He, X. (2005) SOST is a ligand for LRP5/LRP6 and a Wnt signaling inhibitor, J Biol. Chem. 280, 26770-26775.

    13.  Mao, B., Wu, W., Davidson, G., Marhold, J., Li, M., Mechler, B. M., Delius, H., Hoppe, D., Stannek, P., Walter, C., Glinka, A., and Niehrs, C. (2002) Kremen proteins are Dickkopf receptors that regulate Wnt/beta-catenin signalling, Nature 417, 664-667.

    14.  Pawson, T. and Nash, P. (2003) Assembly of cell regulatory systems through protein interaction domains, Science 300, 445-452.

    15.  Niebuhr, K., Ebel, F., Frank, R., Reinhard, M., Domann, E., Carl, U. D., Walter, U., Gertler, F. B., Wehland, J., and Chakraborty, T. (1997) A novel proline-rich motif present in ActA of Listeria monocytogenes and cytoskeletal proteins is the ligand for the EVH1 domain, a protein module present in the Ena/VASP family, EMBO J 16, 5433-5444.

    16.  Kelly, O. G., Pinson, K. I., and Skarnes, W. C. (2004) The Wnt co-receptors Lrp5 and Lrp6 are essential for gastrulation in mice, Development 131, 2803-2815.

    17.  Gong, Y., Slee, R. B., Fukai, N., Rawadi, G., Roman-Roman, S., Reginato, A. M., Wang, H., Cundy, T., Glorieux, F. H., Lev, D., Zacharin, M., Oexle, K., Marcelino, J., Suwairi, W., Heeger, S., Sabatakos, G., Apte, S., Adkins, W. N., Allgrove, J., rslan-Kirchner, M., Batch, J. A., Beighton, P., Black, G. C., Boles, R. G., Boon, L. M., Borrone, C., Brunner, H. G., Carle, G. F., Dallapiccola, B., De, P. A., Floege, B., Halfhide, M. L., Hall, B., Hennekam, R. C., Hirose, T., Jans, A., Juppner, H., Kim, C. A., Keppler-Noreuil, K., Kohlschuetter, A., LaCombe, D., Lambert, M., Lemyre, E., Letteboer, T., Peltonen, L., Ramesar, R. S., Romanengo, M., Somer, H., Steichen-Gersdorf, E., Steinmann, B., Sullivan, B., Superti-Furga, A., Swoboda, W., van den Boogaard, M. J., Van, H. W., Vikkula, M., Votruba, M., Zabel, B., Garcia, T., Baron, R., Olsen, B. R., and Warman, M. L. (2001) LDL receptor-related protein 5 (LRP5) affects bone accrual and eye development, Cell 107, 513-523.

    18.  Figueroa, D. J., Hess, J. F., Ky, B., Brown, S. D., Sandig, V., Hermanowski-Vosatka, A., Twells, R. C., Todd, J. A., and Austin, C. P. (2000) Expression of the type I diabetes-associated gene LRP5 in macrophages, vitamin A system cells, and the Islets of Langerhans suggests multiple potential roles in diabetes, J Histochem. Cytochem. 48, 1357-1368.

    19.  Lobov, I. B., Rao, S., Carroll, T. J., Vallance, J. E., Ito, M., Ondr, J. K., Kurup, S., Glass, D. A., Patel, M. S., Shu, W., Morrisey, E. E., McMahon, A. P., Karsenty, G., and Lang, R. A. (2005) WNT7b mediates macrophage-induced programmed cell death in patterning of the vasculature, Nature 437, 417-421.

    20.  Xia,C.H., Yablonka-Reuveni,Z., and Gong,X. (2010) LRP5 is required for vascular development in deeper layers of the retina. PLoS One 5, e11676.

    21.  Logan, C. Y. and Nusse, R. (2004) The Wnt signaling pathway in development and disease, Annu. Rev. Cell Dev. Biol. 20, 781-810.

    22.  Packard, M., Mathew, D., and Budnik, V. (2003) Wnts and TGF beta in synaptogenesis: old friends signalling at new places, Nat. Rev. Neurosci. 4, 113-120.

    23.  Wodarz, A. and Nusse, R. (1998) Mechanisms of Wnt signaling in development, Annu. Rev. Cell Dev. Biol. 14, 59-88.

    24.  Patel, M. S. and Karsenty, G. (2002) Regulation of bone formation and vision by LRP5, N. Engl. J Med. 346, 1572-1574.

    25.  Semenov, M. V., Tamai, K., Brott, B. K., Kuhl, M., Sokol, S., and He, X. (2001) Head inducer Dickkopf-1 is a ligand for Wnt coreceptor LRP6, Curr. Biol. 11, 951-961.

    26.  Bienz, M. and Clevers, H. (2003) Armadillo/beta-catenin signals in the nucleus--proof beyond a reasonable doubt?, Nat. Cell Biol. 5, 179-182.

    27.  Cong, F., Schweizer, L., Chamorro, M., and Varmus, H. (2003) Requirement for a nuclear function of beta-catenin in Wnt signaling, Mol. Cell Biol. 23, 8462-8470.

    28.  Ikeda, S., Kishida, S., Yamamoto, H., Murai, H., Koyama, S., and Kikuchi, A. (1998) Axin, a negative regulator of the Wnt signaling pathway, forms a complex with GSK-3beta and beta-catenin and promotes GSK-3beta-dependent phosphorylation of beta-catenin, EMBO J 17, 1371-1384.

    29.  Fruttiger, M. (2007) Development of the retinal vasculature, Angiogenesis. 10, 77-88.

    30.  Berger, W., van de, P. D., Warburg, M., Gal, A., Bleeker-Wagemakers, L., de, S. H., Meindl, A., Meitinger, T., Cremers, F., and Ropers, H. H. (1992) Mutations in the candidate gene for Norrie disease, Hum. Mol. Genet 1, 461-465.

    31.  Xu, Q., Wang, Y., Dabdoub, A., Smallwood, P. M., Williams, J., Woods, C., Kelley, M. W., Jiang, L., Tasman, W., Zhang, K., and Nathans, J. (2004) Vascular development in the retina and inner ear: control by Norrin and Frizzled-4, a high-affinity ligand-receptor pair, Cell 116, 883-895.

    32.  Lang, R. A. and Bishop, J. M. (1993) Macrophages are required for cell death and tissue remodeling in the developing mouse eye, Cell 74, 453-462.

    33.  Shastry, B. S., Hejtmancik, J. F., and Trese, M. T. (1997) Identification of novel missense mutations in the Norrie disease gene associated with one X-linked and four sporadic cases of familial exudative vitreoretinopathy, Hum. Mutat. 9, 396-401.

    34.  Robitaille, J., MacDonald, M. L., Kaykas, A., Sheldahl, L. C., Zeisler, J., Dube, M. P., Zhang, L. H., Singaraja, R. R., Guernsey, D. L., Zheng, B., Siebert, L. F., Hoskin-Mott, A., Trese, M. T., Pimstone, S. N., Shastry, B. S., Moon, R. T., Hayden, M. R., Goldberg, Y. P., and Samuels, M. E. (2002) Mutant frizzled-4 disrupts retinal angiogenesis in familial exudative vitreoretinopathy, Nat. Genet 32, 326-330.

    35.  Toomes, C., Bottomley, H. M., Jackson, R. M., Towns, K. V., Scott, S., Mackey, D. A., Craig, J. E., Jiang, L., Yang, Z., Trembath, R., Woodruff, G., Gregory-Evans, C. Y., Gregory-Evans, K., Parker, M. J., Black, G. C., Downey, L. M., Zhang, K., and Inglehearn, C. F. (2004) Mutations in LRP5 or FZD4 underlie the common familial exudative vitreoretinopathy locus on chromosome 11q, Am. J Hum. Genet 74, 721-730.

    36.  Jiao, X., Ventruto, V., Trese, M. T., Shastry, B. S., and Hejtmancik, J. F. (2004) Autosomal recessive familial exudative vitreoretinopathy is associated with mutations in LRP5, Am. J Hum. Genet 75, 878-884.

    37.  Boyden, L. M., Mao, J., Belsky, J., Mitzner, L., Farhi, A., Mitnick, M. A., Wu, D., Insogna, K., and Lifton, R. P. (2002) High bone density due to a mutation in LDL-receptor-related protein 5, N. Engl. J Med. 346, 1513-1521.

    38.  Little, R. D., Carulli, J. P., Del Mastro, R. G., Dupuis, J., Osborne, M., Folz, C., Manning, S. P., Swain, P. M., Zhao, S. C., Eustace, B., Lappe, M. M., Spitzer, L., Zweier, S., Braunschweiger, K., Benchekroun, Y., Hu, X., Adair, R., Chee, L., FitzGerald, M. G., Tulig, C., Caruso, A., Tzellas, N., Bawa, A., Franklin, B., McGuire, S., Nogues, X., Gong, G., Allen, K. M., Anisowicz, A., Morales, A. J., Lomedico, P. T., Recker, S. M., Van, E. P., Recker, R. R., and Johnson, M. L. (2002) A mutation in the LDL receptor-related protein 5 gene results in the autosomal dominant high-bone-mass trait, Am. J Hum. Genet 70, 11-19.

    39.  Van, W. L., Cleiren, E., Gram, J., Beals, R. K., Benichou, O., Scopelliti, D., Key, L., Renton, T., Bartels, C., Gong, Y., Warman, M. L., De Vernejoul, M. C., Bollerslev, J., and Van, H. W. (2003) Six novel missense mutations in the LDL receptor-related protein 5 (LRP5) gene in different conditions with an increased bone density, Am. J Hum. Genet 72, 763-771.

    40.  Babij, P., Zhao, W., Small, C., Kharode, Y., Yaworsky, P. J., Bouxsein, M. L., Reddy, P. S., Bodine, P. V., Robinson, J. A., Bhat, B., Marzolf, J., Moran, R. A., and Bex, F. (2003) High bone mass in mice expressing a mutant LRP5 gene, J Bone Miner. Res. 18, 960-974.

    41.  Fujino, T., Asaba, H., Kang, M. J., Ikeda, Y., Sone, H., Takada, S., Kim, D. H., Ioka, R. X., Ono, M., Tomoyori, H., Okubo, M., Murase, T., Kamataki, A., Yamamoto, J., Magoori, K., Takahashi, S., Miyamoto, Y., Oishi, H., Nose, M., Okazaki, M., Usui, S., Imaizumi, K., Yanagisawa, M., Sakai, J., and Yamamoto, T. T. (2003) Low-density lipoprotein receptor-related protein 5 (LRP5) is essential for normal cholesterol metabolism and glucose-induced insulin secretion, Proc. Natl. Acad. Sci. U. S. A 100, 229-234.

    42.  Kim, D. H., Inagaki, Y., Suzuki, T., Ioka, R. X., Yoshioka, S. Z., Magoori, K., Kang, M. J., Cho, Y., Nakano, A. Z., Liu, Q., Fujino, T., Suzuki, H., Sasano, H., and Yamamoto, T. T. (1998) A new low density lipoprotein receptor related protein, LRP5, is expressed in hepatocytes and adrenal cortex, and recognizes apolipoprotein E, J Biochem. 124, 1072-1076.

    43.  Magoori, K., Kang, M. J., Ito, M. R., Kakuuchi, H., Ioka, R. X., Kamataki, A., Kim, D. H., Asaba, H., Iwasaki, S., Takei, Y. A., Sasaki, M., Usui, S., Okazaki, M., Takahashi, S., Ono, M., Nose, M., Sakai, J., Fujino, T., and Yamamoto, T. T. (2003) Severe hypercholesterolemia, impaired fat tolerance, and advanced atherosclerosis in mice lacking both low density lipoprotein receptor-related protein 5 and apolipoprotein E, J Biol. Chem. 278, 11331-11336.

    44.  Pinson, K. I., Brennan, J., Monkley, S., Avery, B. J., and Skarnes, W. C. (2000) An LDL-receptor-related protein mediates Wnt signalling in mice, Nature 407, 535-538.

    45.  Richter, M., Gottanka, J., May, C. A., Welge-Lussen, U., Berger, W., and Lutjen-Drecoll, E. (1998) Retinal vasculature changes in Norrie disease mice, Invest Ophthalmol. Vis. Sci. 39, 2450-2457.

    46. Stone,J., Itin,A., Alon,T., Pe'er,J., Gnessin,H., Chan-Ling,T., and Keshet,E. (1995) Development of retinal vasculature is mediated by hypoxia-induced vascular endothelial growth factor (VEGF) expression by neuroglia.  J.Neurosci.15, 4738-4747.

    47. Saint-Geniez,M., Maharaj,A.S., Walshe,T.E., Tucker,B.A., Sekiyama,E., Kurihara,T., Darland,D.C., Young,M.J., and D'Amore,P.A. (2008) Endogenous VEGF is required for visual function: evidence for a survival role on muller cells and photoreceptors. PLoS One 3, e3554. 

    48. Schafer,N.F., Luhmann,U.F., Feil,S., and Berger,W. (2009) Differential gene expression in Ndph-knockout mice in retinal development. Invest.Ophthalmol.Vis.Sci. 50, 906-916.

    49. Ye,X., Wang,Y., Cahill,H., Yu,M., Badea,T.C., Smallwood,P.M., Peachey,N.S., and Nathans,J. (2009) Norrin, frizzled-4, and Lrp5 signaling in endothelial cells controls a genetic program for retinal vascularization. Cell 139, 285-298.