Phenotypic Mutation 'Ultraman'

• Allele: Ultraman
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 45,856,018 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Tlr3
• Gene Name: toll-like receptor 3
• Chromosomal Location: 45,848,702-45,864,112 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor is most abundantly expressed in placenta and pancreas, and is restricted to the dendritic subpopulation of the leukocytes. It recognizes dsRNA associated with viral infection, and induces the activation of NF-kappaB and the production of type I interferons. It may thus play a role in host defense against viruses. Use of alternative polyadenylation sites to generate different length transcripts has been noted for this gene. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes for a null allele show alterations in innate immunity against different viruses, viral pathogenesis, anxiety, hippocampal synaptic plasticity, memory retention and neurogenesis. Homozygotes for another null allele show altered ds-RNA responses in dendritic and aorta smooth muscle cells. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Lysine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000034056] [ENSMUSP00000126556] [ENSMUSP00000147961] [ENSMUSP00000147738] [ENSMUSP00000147783] [ENSMUSP00000148263] [ENSMUSP00000148127]
• AlphaFold: Q99MB1
• PDB Structure: Crystal structure of mouse TLR3 ectodomain [X-RAY DIFFRACTION] ; Mouse Toll-like receptor 3 ectodomain complexed with double-stranded RNA [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000034056; Gene: ENSMUSG00000031639; AA Change: I54K

Domain	Start	End	E-Value	Type
LRRNT	28	56	1.14e1	SMART
LRR	50	74	1.33e1	SMART
LRR_TYP	99	122	4.72e-2	SMART
LRR	123	146	2.47e2	SMART
LRR	171	194	3.36e1	SMART
LRR	198	220	7.57e0	SMART
low complexity region	224	238	N/A	INTRINSIC
low complexity region	252	263	N/A	INTRINSIC
LRR	274	297	1.06e1	SMART
LRR_TYP	298	321	1.28e-3	SMART
LRR	355	378	6.23e1	SMART
LRR	379	404	3.18e2	SMART
LRR	405	430	8.98e1	SMART
LRR	431	455	6.78e1	SMART
LRR_TYP	506	529	1.79e-2	SMART
LRR	530	553	2.63e0	SMART
LRR_TYP	562	585	1.56e-2	SMART
LRR	586	609	1.37e1	SMART
LRR	611	633	8.48e0	SMART
LRRCT	646	698	1.07e-10	SMART
transmembrane domain	705	724	N/A	INTRINSIC
TIR	756	901	2.43e-26	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000034056)
• SMART Domains: Protein: ENSMUSP00000126556; Gene: ENSMUSG00000031639; AA Change: I54K

Domain	Start	End	E-Value	Type
LRRNT	28	56	1.14e1	SMART
LRR	50	74	1.33e1	SMART
LRR_TYP	99	122	4.72e-2	SMART
LRR	123	146	2.47e2	SMART
LRR	171	194	3.36e1	SMART
LRR	198	220	7.57e0	SMART
low complexity region	224	238	N/A	INTRINSIC
low complexity region	252	263	N/A	INTRINSIC
LRR	274	297	1.06e1	SMART
LRR_TYP	298	321	1.28e-3	SMART
LRR	355	378	6.23e1	SMART
LRR	379	404	3.18e2	SMART
LRR	405	430	8.98e1	SMART
LRR	431	455	6.78e1	SMART
LRR_TYP	506	529	1.79e-2	SMART
LRR	530	553	2.63e0	SMART
LRR_TYP	562	585	1.56e-2	SMART
LRR	586	609	1.37e1	SMART
LRR	611	633	8.48e0	SMART
LRRCT	646	698	1.07e-10	SMART
transmembrane domain	705	724	N/A	INTRINSIC
TIR	756	901	2.43e-26	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000167106)
• Predicted Effect: probably benign
• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000209772)
• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000211370)
• Meta Mutation Damage Score: 0.9412
• Is this an essential gene?: Probably nonessential (E-score: 0.175)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Last Updated: 2019-09-04 9:41 PM by Anne Murray
• Record Created: 2017-02-19 8:53 AM by Lei Sun
• Record Posted: 2017-03-31
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Lei Sun and Bruce Beutler

Accession Number

NCBI RefSeq: NM_126166; MGI:2156367

Alleles Listed at MGI

All mutations/alleles(8) : Chemically induced(ENU)(1) Chemically induced(other)(1) Targeted(6)

Phenotypic Description

Figure 1. Ultraman mice exhibited decreased TNFα secretion in response to TLR3 ligand, poly(I:C) and priming with IFNγ. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Ultraman phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5129, some of which exhibited decreased TNFα secretion from macrophages in response to the Toll-like receptor 3 (TLR3) ligand, poly(I:C) and priming with IFNγ (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of reduced TNFα secretion after poly(I:C) stimulation (and IFNγ priming) using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 52 mutations (X-axis) identified in the G1 male of pedigree R5129. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 52 mutations. The diminished poly(I:C)-induced TNFα secretion phenotype was linked by continuous variable mapping to a mutation in Tlr3:  a T to A transversion at base pair 45,402,981 (v38) on chromosome 8, or base pair 8,969 in the GenBank genomic region NC_000074. Linkage was found with an additive model of inheritance, wherein nine variant homozygotes and 29 heterozygotes departed phenotypically from 23 homozygous reference mice with a P value of 2.288 x 10^-13 (Figure 2).  

The mutation corresponds to residue 522 in the mRNA sequence NM_126166 within exon 4 of 7 total exons.

506 GATCTTCCCTCTAACATAACAGTGTTGAATCTT 49  -D--L--P--S--N--I--T--V--L--N--L-

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine (I) to lysine (K) substitution at position 54 (I54K) in the TLR3 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 3. Protein and domain structure of TLR3. (A) Schematic representation of TLR3 based on crystalized structures of mouse TLR3 LRR (PBD 3CIY) and human TLR2 TIR (1FYW) domains. The residue affected by the Rakshasa mutation is highlighted. 3D image was created using UCSF Chimera. (B) TLR3 is a 905 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane (TM) domain (blue) and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain (green). The Ultraman mutation (red asterisk) results in an isoleucine (I) to lysine (K) substitution at position 54 (I54K) of the TLR3 protein.

TLR3 is a type I integral membrane glycoprotein containing 905 amino acids (Figure 3). Like the other TLRs, its cytoplasmic domain (at its C terminus) shares similarity with the interleukin-1 and IL-18 receptors (IL-1R and IL-18R) in a conserved region of approximately 200 amino acids known as the Toll/IL-1R (TIR) domain (1-3), which mediates homo- and heterotypic protein interactions during signal transduction. The extracellular domains of TLRs contain multiple leucine-rich repeats (LRRs), which mediate ligand recognition by TLRs. LRRs consist of 24-29 amino acids with two conserved leucine-rich sequences: XLXXLXLXXN (residues 1-10, present in all LRR subtypes) followed by XØXXØX₄FXXLX (residues ~11-24, but variable in length, sequence and structure), where X is any amino acid and Ø is a hydrophobic amino acid [discussed in (4)]. TLR3 has 23 predicted LRRs in its ectodomain along with the LRR-NT (LRR N-terminal) and LRR-CT (LRR-C-terminal) regions encoded by the N-terminal half of the protein. The Ultraman mutation results in an isoleucine (I) to lysine (K) substitution at position 54 (I54K); residue 54 is within the LRR region (LRR1).  

For more information about Tlr3, please see the record for Rakshasa.

Putative Mechanism

Toll-like receptors (TLRs) play an essential role in the innate immune response as key sensors of invading microorganisms by recognizing conserved molecular motifs found in many different pathogens, including bacteria, fungi, protozoa and viruses. TLR signaling initiates a cascade of signaling events involving various kinases, adaptors and ubiquitin ligases, ultimately leading to transcriptional activation of cytokine and other genes through the transcription factors NF-κB, AP-1, interferon responsive factor (IRF)-3, and IRF-7. TLR3 is an endosomal TLR along with TLR7 (see the record for rsq1), TLR8, and TLR9 (see the record for Cpg1). The endosomal TLRs recognize exogenous nucleic acids:  double-stranded DNA unmethylated at CpG motifs [TLR9; (1)], single-stranded (ss) RNA viruses (TLR7 and TLR8; (5)] and double-stranded RNA (dsRNA; TLR3]. TLR3 recognizes both virus-derived dsRNA and the synthetic dsRNA, poly(I:C) (6;7). The defective poly(I:C)-induced TLR signaling defect observed in Ultraman indicates that TLR3^Ultraman exhibits loss-of-function. 

Primers

PCR Primer
Ultraman_pcr_F: ACATTAGATCGAGTTCTGTCAGG
Ultraman_pcr_R: GCTGAATCATGAAAGGGTGTTC

Sequencing Primer
Ultraman_seq_F: CTGTCAGGTTCGTGCAGAAGAC
Ultraman_seq_R: AGGGTGTTCCTCTTATCTAATGTAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 405 nucleotides is amplified (chromosome 8, - strand):

1   gctgaatcat gaaagggtgt tcctcttatc taatgtactc ctttggggga cttttgtccc
61  tatggattct tctggtgtct tccacaaacc aatgcactgt gagatacaac gtagctgact
121 gcagccattt gaagctaaca cacatacctg atgatcttcc ctctaacata acagtgttga
181 atcttactca caaccaactc agaagattac cacctaccaa ctttacaaga tacagccaac
241 ttgctatctt ggatgcagga tttaactcca tttcaaaact ggagccagaa ctgtgccaaa
301 tactcccttt gttgaaagta ttgaacctgc aacataatga gctctctcag atttctgatc
361 aaacctttgt cttctgcacg aacctgacag aactcgatct aatgt

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M., Hoshino, K., Wagner, H., Takeda, K., and Akira, S. (2000) A Toll-Like Receptor Recognizes Bacterial DNA. Nature. 408, 740-745.

  2. Du, X., Poltorak, A., Wei, Y., and Beutler, B. (2000) Three Novel Mammalian Toll-Like Receptors: Gene Structure, Expression, and Evolution. Eur Cytokine Netw. 11, 362-371.

  3. Chuang, T. H., and Ulevitch, R. J. (2000) Cloning and Characterization of a Sub-Family of Human Toll-Like Receptors: HTLR7, hTLR8 and hTLR9. Eur Cytokine Netw. 11, 372-378.

  4. Bell, J. K., Mullen, G. E., Leifer, C. A., Mazzoni, A., Davies, D. R., and Segal, D. M. (2003) Leucine-Rich Repeats and Pathogen Recognition in Toll-Like Receptors. Trends Immunol. 24, 528-533.

  5. Heil, F., Hemmi, H., Hochrein, H., Ampenberger, F., Kirschning, C., Akira, S., Lipford, G., Wagner, H., and Bauer, S. (2004) Species-Specific Recognition of Single-Stranded RNA Via Toll-Like Receptor 7 and 8. Science. 303, 1526-1529.

  6. Matsumoto, M., Kikkawa, S., Kohase, M., Miyake, K., and Seya, T. (2002) Establishment of a Monoclonal Antibody Against Human Toll-Like Receptor 3 that Blocks Double-Stranded RNA-Mediated Signaling. Biochem Biophys Res Commun. 293, 1364-1369.

  7. Alexopoulou, L., Holt, A. C., Medzhitov, R., and Flavell, R. A. (2001) Recognition of Double-Stranded RNA and Activation of NF-kappaB by Toll-Like Receptor 3. Nature. 413, 732-738.