Phenotypic Mutation 'Dum_dum' (pdf version)
List |< first << previous [record 2 of 18] next >> last >|
AlleleDum_dum
Mutation Type makesense
Chromosome8
Coordinate10,987,012 bp (GRCm38)
Base Change A ⇒ C (forward strand)
Gene Irs2
Gene Name insulin receptor substrate 2
Synonym(s) Irs-2
Chromosomal Location 10,984,681-11,008,458 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene results in type 2 diabetes due to insulin resistance and pancreatic beta cell dysfunction, causes defects in leptin action, energy balance, lipid homeostasis and vascular wound healing, and leads to female infertility due to hypothalamic and ovarian dysfunction. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001081212; MGI:109334

Mapped Yes 
Amino Acid Change Stop codon changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000038514]
PDB Structure
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide and ATP [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB phosphopeptide [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000038514
Gene: ENSMUSG00000038894
AA Change: *1322G

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 19 28 N/A INTRINSIC
PH 31 146 2.83e-13 SMART
IRS 191 293 4.98e-38 SMART
PTBI 191 293 2.24e-51 SMART
low complexity region 301 309 N/A INTRINSIC
low complexity region 364 377 N/A INTRINSIC
low complexity region 435 473 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 688 710 N/A INTRINSIC
low complexity region 721 730 N/A INTRINSIC
low complexity region 834 846 N/A INTRINSIC
low complexity region 923 959 N/A INTRINSIC
low complexity region 976 984 N/A INTRINSIC
low complexity region 997 1028 N/A INTRINSIC
low complexity region 1137 1154 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
low complexity region 1274 1296 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
30 Min. Insulin - increased
30 Min. Insulin (Female) - increased
30 Min. Insulin (Male) - increased
fasting hyperglycemia 15841180
fasting hyperglycemia (female) 15841180
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(7) : Targeted(6) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Irs2 APN 8 11005867 missense probably benign 0.00
IGL01328:Irs2 APN 8 11004792 missense probably damaging 0.99
IGL01875:Irs2 APN 8 11006221 missense probably damaging 0.98
IGL02444:Irs2 APN 8 11006306 missense probably benign 0.03
IGL02448:Irs2 APN 8 11007862 missense probably benign 0.21
IGL02945:Irs2 APN 8 11007781 missense probably damaging 1.00
IGL03068:Irs2 APN 8 11004974 missense probably damaging 0.99
R0062:Irs2 UTSW 8 11005723 missense possibly damaging 0.65
R0062:Irs2 UTSW 8 11005723 missense possibly damaging 0.65
R0107:Irs2 UTSW 8 11004691 missense probably damaging 1.00
R0147:Irs2 UTSW 8 11007568 missense probably damaging 1.00
R0501:Irs2 UTSW 8 11006396 missense probably damaging 1.00
R0565:Irs2 UTSW 8 11004592 missense probably damaging 0.98
R2042:Irs2 UTSW 8 11007580 missense probably damaging 0.99
R2268:Irs2 UTSW 8 11007586 missense probably damaging 0.98
R2518:Irs2 UTSW 8 11005352 missense probably benign 0.00
R2762:Irs2 UTSW 8 11006408 missense probably damaging 1.00
R3623:Irs2 UTSW 8 11007643 missense probably damaging 1.00
R3624:Irs2 UTSW 8 11007643 missense probably damaging 1.00
R5022:Irs2 UTSW 8 10987012 makesense probably null
R5270:Irs2 UTSW 8 11006678 nonsense probably null
R5377:Irs2 UTSW 8 11005277 missense probably benign 0.00
R5604:Irs2 UTSW 8 11005007 missense possibly damaging 0.84
R6049:Irs2 UTSW 8 11006805 missense probably benign 0.01
R6219:Irs2 UTSW 8 11005121 missense probably damaging 0.99
R6654:Irs2 UTSW 8 11006486 missense probably damaging 1.00
R6726:Irs2 UTSW 8 11004961 missense possibly damaging 0.86
R6813:Irs2 UTSW 8 11004659 nonsense probably null
R6934:Irs2 UTSW 8 11004697 missense probably damaging 0.99
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-10-24 3:24 PM by Anne Murray
Record Created 2017-02-20 8:22 PM
Record Posted 2018-10-24
Phenotypic Description

Figure 1. Dum_dum mice exhibited high insulin 30 minutes after glucose challenge. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Dum_dum mice exhibited high fasting glucose levels. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Dum_dum mice exhibited low residual glucose levels. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Dum_dum phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5022 in which some mice showed high insulin 30 minutes after glucose challenge (Figure 1) fasting hyperglycemia (Figure 2), and a decrease in the level of 30 minute glucose residual levels (Figure 3).

Nature of Mutation
Figure 4. Linkage mapping of the fasting glucose levels using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 111 mutations (X-axis) identified in the G1 male of pedigree R5022. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 111 mutations. All of the above abnormalities were linked by continuous variable mapping to a mutation in Irs2: a T to G transversion at base pair 10,987,012 (v38) on chromosome 8, or base pair 21,420 in the GenBank genomic region NC_000074 encoding Irs2. The strongest association was found with a recessive model of inheritance to the fasting glucose levels, wherein six variant homozygotes departed phenotypically from eight homozygous reference mice and 15 heterozygous mice with a P value of 2.481 x 10-6 (Figure 4). A semidominant model of inheritance was observed in the insulin level assay after glucose challenge (P = 2.856 x 10-6).

 

The mutation corresponds to residue 3,964 in the mRNA sequence NM_001081212 within exon 2 of 2 total exons.

 
3949 ACAGTCGTGAAAGAGTGAGCGCTACCAGCCCCATCGCCGCCATGTTGA…… 
1317 -T--V--V--K--E--*-
 

The mutated nucleotide is indicated in red. The putative novel stop codon is in blue. The mutation results in substitution of the stop codon at position 1,322 to a glycine (*1322G) in the IRS2 protein. The next potential stop codon is 30-base pairs following the original site, putatively after coding 10 aberrant amino acids.

Protein Prediction
Figure 5. Domain organization of IRS2. The Dum-dum mutation results in substitution of the stop codon at position 1,322 to a glycine in the IRS2 protein. The next potential stop codon is 30-base pairs following the original site, putatively after coding 10 aberrant amino acids.
Figure 6. Crystal structure of human PH-PTB in IRS1. UCSF Chimera model is based on PDB 1QQG, Dhe-Paganon, et al. Proc.Natl.Acad.Sci.USA. 96, 8378-8383 (1999). Click on the 3D structure to view it rotate.

Irs2 encodes insulin receptor substate-2 (IRS2), one of four members of the IRS family (IRS1 through IRS4). The IRS proteins consist of N-terminal pleckstrin homology (PH) and phosphotyrosine binding (PTB) domains followed by long, unstructured C-terminal tails containing numerous tyrosine, serine, and threonine residues [Figure 5; reviewed in (1)]. IRS1 (see the record for runt) and IRS2 have highly similar PH and PTB domains; the two proteins function analogously in insulin receptor (IR; see the record for gummi_bear) signaling (2). IRS1 and IRS2 differ within their respective tail regions. The PH and PTB domains of IRS1 interact with the activated IR and are therefore necessary for insulin-stimulated tyrosine phosphorylation of IRS1 (3-6). Both domains fold into a seven-stranded, antiparallel β-sandwich capped at one end by an α-helix [Figure 6; PDB:1QQG; (7;8)]. The PTB domain binds to the juxtamembrane region of the IR (8); in vitro binding experiments showed that the IRS1 PTB recognizes an NPXpY sequence motif with a hydrophobic residue at pY−8 (6;9). The IRS1 PH domain binds to phosphatidylinositol phosphates, an interaction that may help bring IRS1 to the IR at the cell membrane (7).

 

IRS1 and IRS2 are regulated by phosphorylation of more than 50 serine/threonine residues within their long, unstructured C-terminal tails (1;10). Depending on the sites affected and the time course of phosphorylation, phosphorylation can have positive or negative regulatory effects on IRS function.

 

The Dum_dum mutation results in substitution of the stop codon at position 1,322 to a glycine (*1322G) in the IRS2 protein.

 

Please see the record runt (Irs1) for more information about the IRS proteins.

Expression/Localization

Both IRS1 and IRS2 are widely expressed in mammalian tissues. IRS1 is predicted to predominantly function in skeletal muscle and fat, and IRS2 predominantly functions in the liver.

Background
Figure 7. Binding of insulin to the insulin receptor (IR) propagates signaling to activate three main pathways: the MAP kinase, Cbl/CAP, and PI3K pathways. Insulin binding to the IR promotes autophosphorylation of the receptor. IRS1/2 recruitment to the IR results in PI3K and GRB2 activation. Activated PI3K phosphorylates membrane phospholipids, the major product being phosphatidylinositol-3,4,5-trisphosphate (PIP3). PIP3 in turn activates PIP3-dependent kinase 1 (PDK1). PDK1 activates another kinase called protein kinase B (PKB; alternatively, AKT). Insulin-mediated activation of AKT2/PKBβ results in inhibition of lipolysis and gluoconeogenesis as well as activation of protein and glycogen synthesis. PDK1 phosphorylates some isoforms of protein kinase C (PKC). The PKC isoform, PKCλ/ζ, phosphorylates proteins associated with intracellular vesicles containing the glucose transporter, GLUT4, resulting in their migration to and fusion with, the plasma membrane and subsequent increased glucose uptake and metabolism in adipose tissue. GRB2 activation results in signal transduction via the monomeric G-protein, RAS. Activation of RAS ultimately leads to changes in the expression of numerous genes via activation of members of the extracellular signal-regulated kinases, ERK.

The insulin signaling pathway regulates glucose uptake and release as well as the synthesis and storage of carbohydrates and lipids (Figure 7). Binding of insulin to the ectodomain of the IR activates the insulin signaling pathway by triggering a conformational change that facilitates IR autophosphorylation of the kinase domain. Phosphorylation of the kinase activation loop stimulates IR catalytic activity. Phosphorylation of the juxtamembrane region of the IR recruits downstream signaling proteins (e.g., IRS1, IRS2, and Shc [see the record for shrine (Shc2)]). IRS1 and IRS2 do not have intrinsic enzyme activity, but function as docking proteins that bind and activate signal transduction proteins (11). Activated IR propagates signaling to activate three main pathways: the MAP kinase, Cbl/CAP, and PI3K pathways (12). The PI3K pathway, activated by IRS proteins, mediates the metabolic functions of insulin through effectors such as GSK3β, mTORC1, mTORC2, and Forkhead transcription factors. Shc activates the Shc-Grb2-Sos-Ras-Raf-MAPK pathway, which controls cellular proliferation and gene transcription. Of four mammalian IRS proteins, IRS1 and IRS2 are the main substrates phosphorylated by the IR in response to insulin binding. Tyrosine phosphorylated IRS1 and IRS2 act as scaffolding proteins that recruit SH2 domain-containing proteins including the p85 regulatory subunit of class 1A PI3K (see the record for anubis) (13). For more information about IR-associated signaling, please the record for gummi_bear.

 

Whether a p.G1057D mutation in IRS2 is associated with noninsulin-dependent diabetes mellitus (OMIM: #125853) is unclear. One study found a strong association between type II diabetes in Italian patients and the mutation (14), but another study in Italian patients found that the p.G1057D mutation did not affect insulin secretion and insulin sensitivity (15).

 

Systemic knockout of either IRS1 or IRS2 in mice leads to hyperinsulinemia, impaired glucose tolerance, and reduced insulin sensitivity (16-19). However, distinct phenotypes are also observed in Irs1-/- and Irs2-/- mice.  Irs1-/- mice display growth retardation (50 to 60% of WT weight) and their insulin resistance is compensated by β cell hyperplasia so that fasting blood glucose levels are normal in 4-8 week old mice (16;17)Irs1-/- mice also showed higher blood pressures and plasma triglyceride levels with concomitant reduced levels of lipoprotein lipase activity than wild-type mice (20).  In contrast, Irs2-/- mice show mild growth retardation (90% of WT weight) and develop diabetes due to a lack of β cell compensation for insulin resistance (18). Irs2-/- female mice were infertile, with anovulatory ovaries and reduced numbers of follicles (21). The Irs2-/- female mice also showed increased food intake and obesity (21).

Primers PCR Primer
Dum_dum(F):5'- AGCCCGTCAGTTCACAAAGG -3'
Dum_dum(R):5'- CACAGATGGTTGCTGGGAAG -3'

Sequencing Primer
Dum_dum_seq(F):5'- GGTTCCTTATCTAATTCACAGAAGTC -3'
Dum_dum_seq(R):5'- TTACTGGAATGCTTGGCAAAAAGTG -3'
References
Science Writers Eva Marie Y. Moresco, Anne Murray
Illustrators Diantha La Vine
AuthorsEmre Turer and Bruce Beutler
List |< first << previous [record 2 of 18] next >> last >|