Phenotypic Mutation 'Park8' (pdf version)
List [record 1 of 1]
AllelePark8
Mutation Type missense
Chromosome11
Coordinate59,566,199 bp (GRCm38)
Base Change G ⇒ C (forward strand)
Gene Nlrp3
Gene Name NLR family, pyrin domain containing 3
Synonym(s) Cias1, cryopyrin, Pypaf1, NALP3, Mmig1
Chromosomal Location 59,541,568-59,566,956 bp (+)
MGI Phenotype Strain: 3686871
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_145827; MGI:2653833

Mapped Yes 
Amino Acid Change Arginine changed to Proline
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000071835] [ENSMUSP00000078440] [ENSMUSP00000098707] [ENSMUSP00000149821] [ENSMUSP00000149533]
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: R1013P

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
(Using ENSMUST00000079476)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: R1013P

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
(Using ENSMUST00000101148)
Phenotypic Category
Phenotypequestion? Literature verified References
NALP3 inflammasome signaling defect
NLRP3 inflammasome: low response
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(22) : Chemically induced (ENU)(10) Chemically induced (other)(1) Targeted(11)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59565943 missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59565116 missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59551887 missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59549378 missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59549535 missense probably benign
IGL02334:Nlrp3 APN 11 59565083 missense probably benign
IGL02417:Nlrp3 APN 11 59566023 unclassified probably benign
IGL02578:Nlrp3 APN 11 59548401 missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59565976 missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59555782 missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59549546 missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59549016 missense probably damaging 1.00
Nd1 UTSW 11 59565974 missense probably benign 0.33
Nd14 UTSW 11 59555875 missense
Nd3 UTSW 11 59565974 missense probably benign 0.33
Nd5 UTSW 11 59565879 missense probably benign 0.00
Nd6 UTSW 11 59549354 missense possibly damaging 0.59
Nd7 UTSW 11 59555875 missense probably damaging 0.99
Nd9 UTSW 11 59549354 missense possibly damaging 0.59
Park2 UTSW 11 59565128 nonsense probably null
Park3 UTSW 11 59565850 missense probably benign 0.02
Park4 UTSW 11 59549531 missense probably benign 0.19
Park5 UTSW 11 59548476 missense probably damaging 0.99
Park6 UTSW 11 59549036 missense probably damaging 1.00
Park7 UTSW 11 59548010 nonsense probably null
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59565128 nonsense probably null
R0362:Nlrp3 UTSW 11 59548797 missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59555924 splice site probably benign
R0649:Nlrp3 UTSW 11 59548542 missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59548256 missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59565850 missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59555768 missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59549531 missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59548476 missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59543123 missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59543351 missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59558402 missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59548916 missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59549036 missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59549136 missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59549661 missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59548010 nonsense probably null
R4540:Nlrp3 UTSW 11 59551899 missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59549222 missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59548301 missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59549238 missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59566199 missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59565084 missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59549063 missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59555748 nonsense probably null
R5869:Nlrp3 UTSW 11 59548134 missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59546852 missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59546791 missense probably benign
R5979:Nlrp3 UTSW 11 59548971 missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59548566 missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59565192 missense probably damaging 1.00
Z1088:Nlrp3 UTSW 11 59551860 missense possibly damaging 0.67
Mode of Inheritance Autosomal Dominant
Local Stock Sperm
Repository
Last Updated 2018-02-02 1:16 PM by Anne Murray
Record Created 2017-02-23 9:36 PM by Hexin Shi
Record Posted 2017-03-03
Phenotypic Description
Figure 1. Park8 mice exhibited diminished IL-1β secretion in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Park8 phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R5051, some of which showed  reduced secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment compared to wild-type littermates (Figure 1).

Nature of Mutation
Figure 2. Linkage mapping of the reduced IL-1β secretion after nigericin treatment using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 54 mutations (X-axis) identified in the G1 male of pedigree R5051. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 54 mutations. The impaired inflammasome response was linked by continuous variable mapping to a mutation in Nlrp3: a G to C transversion at base pair 59,566,199 (v38) on chromosome 11, or base pair 24,631 in the GenBank genomic region NC_000077. Linkage was found with a dominant model of inheritance (P = 6.751 x 10-8), wherein four variant homozygotes and 16 heterozygotes departed phenotypically from 15 homozygous reference mice (Figure 2).  

 

The mutation corresponds to residue 3,264 in the mRNA sequence NM_145827 within exon 10 of 10 total exons.

 

3248 AATCGTGAAACAAAACGTGCCTTAGAAGCGCTC

1008 -N--R--E--T--K--R--A--L--E--A--L-

 

The mutated nucleotide is indicated in red.  The mutation results in an arginine to proline substitution at position 1,013 (R1013P) in the NLRP3 protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.195).

Protein Prediction

Figure 3. Domain structure of NLRP3. Shown are the pyrin domain (PYD), NACHT domain, NACHT-associated domain (NAD), and leucine-rich repeat (LRR) domain. Together, the NACHT and NAD domains are known as the nucleotide-binding domain (NBD). The Park8 mutation is shown. Click on the image to view other mutations found in NLRP3. Click on each mutation for more specific information.

The Nlrp3 gene encodes a 1,033 amino acid protein that is a member of the nucleotide-binding and oligomerization domain (NOD)-like receptor (NLR) or CATERPILLER [for CARD, transcription enhancer, R(purine)-binding, pyrin, lots of leucine repeats] family [Figure 3; (1)]. NLRP3 has a pyrin domain (PYD) at the N-terminus (amino acids 1-91). NLRP3 has a C-terminal leucine-rich repeat (LRR) domain (amino acids 739-988), a central oligomerization NACHT usually with a C-terminal extension known as the NACHT associated domain (NAD) that together comprise a nucleotide-binding domain (NBD; amino acids 216-532), and an N-terminal effector domain. The N-terminus of NLRP3 contains a pyrin domain (PYD; amino acids 1-91). The Park8 mutation results in an arginine to proline substitution at position 1,013 (R1013P); Arg1013 is within an undefined region following the LRR domains.

 

For more information about Nlrp3, please see the record for ND1.

Putative Mechanism

NLRP3 is able to oligomerize through its NBD domain and assemble into large caspase-1-activating multiprotein complexes termed inflammasomes upon the detection of pathogenic or other danger signals in the cytoplasm. A large variety of agents have been shown to activate the NLRP3 inflammasome, and NLRP3 plays an important role in the innate immune response. Mutations within the NBD have been shown to reduce ATP binding, as well as NLRP3 protein function including caspase-1 activation, IL-1β production, cell death, macromolecular complex formation, self-association, and association with apoptosis-associated speck-like protein (ASC). The phenotype of the Park8 mice suggests that the mutated protein, if expressed, is inactive or has reduced activity.  

Primers PCR Primer
Park8(F):5'- TGCCTAGAGCTTCTCATGGG -3'
Park8(R):5'- ATTTGGTCCCACACAAGCC -3'

Sequencing Primer
Park8_seq(F):5'- CCTAGAGCTTCTCATGGGGTAGG -3'
Park8_seq(R):5'- CCTCGGCTGTGATCCTGATG -3'
References

1. Ting, J. P., Lovering, R. C., Alnemri, E. S., Bertin, J., Boss, J. M., Davis, B. K., Flavell, R. A., Girardin, S. E., Godzik, A., Harton, J. A., Hoffman, H. M., Hugot, J. P., Inohara, N., Mackenzie, A., Maltais, L. J., Nunez, G., Ogura, Y., Otten, L. A., Philpott, D., Reed, J. C., Reith, W., Schreiber, S., Steimle, V., and Ward, P. A. (2008) The NLR Gene Family: A Standard Nomenclature. Immunity. 28, 285-287.

Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsHexin Shi and Bruce Beutler
List [record 1 of 1]